Microcebus_murinus Locus RC3H2
snOPY snoRNA Orthological Gene Database
Microcebus_murinus RC3H2
Microcebus_murinus
RC3H2
GeneScaffold_89
SNORD90
22214..22324
42439
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATTTTTAGTACCTCATTTAG
CCTCCTAATCAAGTCCTGCAGGGATTTCCTCTTTCAGATGGCAAGCTGTTTCTCACATTT
AACTCACTATGATATTGTCTGAATCAGTAGTTTCCAAAGTTCACTAACGCTTGCCCATAT
TCTAGTATGTTTTGGGGTAGTGATTATCAAGGGAAACACTTTTTTAAAAATTTTTTTGGA
GACAAGGTCTCACTCTGTTGTCCTGGCTAGAGTTCAGTGATGTGATCATAGCTCACTGCA
ACCTGAAACTCCTGGGCTCTGATCCCCCTGCCTCAGCCTCCTGAGTAGCTGGGACTACAA
GTGTTTTCCACCAGACCTGGCTAACTGTTCTATTTTTTGTAGAGAAAGTTTCTCATTCTT
GCTCAGGCTGGTCTCGAACTCTGACCTCAAGCGATCCTCCTTCCTCAGCTTCCCAAAATG
CTAGGATTACAATCATGCGCCACCCGGTCCAGCCTGGGGGAACATTTAAAAAAAAAAAAC
AACAGAAAAATGTGAAAGTTAATCTGCTTATTTAATATGATCATTAAGAAAAATACTTAG
AAGCTTTGATGATGGTTTTATGAACACCCAATGTAAATACAGTTTAGTTAAAAGGAACAC
TTTTAGGTTAGGTGTTTCCTTTTTGTTTCTGGGCAAAATTGCAGAAATTTAATTAATTCA
GCAAATAGTTTTTTTTGGAAAAAAGACATCTAAAGCATAAAGAATTATTAAGAAGTGTTT
TAAGTTCTGAAGCTGTGGTGGTTGACTGTAGGAGTTAACTCTTGAAAGGTGGCTGATGAT
TATGTGGTTCATTCTTATTTTTGTCCGTTTCCAGCTTACAAAACACTACACAGCAAAATA
ATGATCTACTAGACTGCTAACCCGAGCATCCAGCTTCCACAATGCCTGTACAGGCAGCTC
AATGGACAGAATTTCTGTCCTGTCCAATCTGCTATAATGAATTTGATGAGAATGTGCACA
AACCCATCAGTTTAGGTTGTTCACACACTGTTTGCAAGACCTGCTTGAATAAACTTCACC
GAAAAGCTTGTCCTTTTGACCAGACTGCCATCAACACTGACATTGATGTGCTTCCTGTCA
ACTTTGCACTTCTCCAGTTAGTTGGAGCCCAGGTAAGCTTTCAGGATTTTACTTATTTGG
TATATGTAGTAACTATTGAACTTAGTTCATTAAGGGATACAAAGCATGTTTAGTGATTGT
TGAGGCATAAAAAATAAACATTATTGGCCAGGCGCGGTGGCTCACGCCTGTAATCCTAGC
ACTCTGGGAGGCCGAGGCGGGCGGATTGCTCGAGGTCAGGAGTTAGAAACCAGCCTGAGC
AAGAGTGAGACCCCGTCTCTACTATAAATAGAAAGAAATTAATTGGCCAACTAATATATT
TAGAAAAAAATTAGCCGGGCATGGTGGCACATGCCTGTAGTCCCAGCTACTTGGGAGGCT
GAGGCAGCAGGATTGCTTGAGCCCAGGAATTGAGGTTGCTATGAGCTAGGCAGACGCCAC
AGCCCTCACTCTAGTCTGGGCAACAAAGCGCAACTCTGCCTCATAAATAAATAAATAAGT
AAATAAATAAACAAACAAATATTATCAATGTACCTAATTTTCATAATTGTTTTCTACAGA
AGAATGTTTAGATACTGTCATAAATCCTTTTACAAAACCATAAATTACATTATAGTTATA
TATTTTTATCTTCAAGGCTGTGGTCAAAATTTCTGTACATAAGTGATTTCAATGGAGAAT
AAATATTTTTATGTAAGTTATACATAAATATTCAGTAGGTGATATGAAAAGAAATGTAAT
CAAAGCTTTGGCCAGAAATGGGTGTTTTTTGTTTCTCATTTTAGCTTCACTTGACTTTTA
GGATAATAATGTAAATGAAAAAATAAGCTCTATTTAGGGATATGTATATGGAAAACCAAT
TACTAGAGTGTCAGTAATAAATTCTGCACAGTTTTTTAAGCACATGTGCTATATATGAGT
ATTTCATGTTTATAGTGATTTTATTGAATCAGAGCAAGACTATAGGTTTATAATAACTTC
CATTTAATTGGGCCCTACTCTGTGTAAGGTATCACAGTAAGTATTCAGCAACTATTATTA
CTAATTCTTACCATAGCTCTTCAGGTAGTTATTATCCCCATTTTACAGGTGAGGAAGAAG
ATGAAATTCTGTACTTCATGCACTACATATTAAAGCAAGAAAGTAAGGACTTTTCTGATT
TATTGGAACATTTCAATGAACTAAAATACTTCATTCACTTAGTATCTTGATATTTGAAGT
TTTCCTTTTAAAGCACAAAATGCATTTTCAGTGTTTATGATCAAGTTAGAAATCACTATG
AAATCAATGTGTAACTAATCAGTAGTGTGTCCTAATTTAATTGGCAGCATATTTAATGGA
GTGTAAAATAATGTTGCCTTTTGCAAACAGTGGCATTTTAGATTCAATAAACTACCATAG
ACTTTTTGTAATAATACAAGCTACCATTTACTTAGCATCTGCTAGATTCAGATATTGTGT
TGATATTATTTATAAATGTTATCTCAGTTGGTCCTTAAAATAGCCTACAGGTCTATACAA
TGTGTCTTTTGTTATCTCTCCAGCCTCGTCTCCTACTACTGTCCTTGCTGTGCTTAAGCC
ACATTACCCTCCTAGCCAGTTCTCAGATATTCTAAGTATATTGCCACTTGAGGGTTTTTG
CAGTGATTGTTATTTTTTCCTAGAATGTTTATTACTTCTCCTTTCAAGTCTTTATTCAAA
GTCACAGTTCTTAAGGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTTTCCTA
AGTCCACTGAAATCAGCTAGAAGCAATAAATACCATAGCACCAGATTATGGGCTTAATAA
ATACCATTTTCACTAAAGAAGACAGGGCTCTTTGGATAAATCCTTTTCTCCAGTTCTAGT
GTAAGAAAGTAGAAGATGAGCCTGTGAAATCTTGTGCTAGAAAGCAAAAAAAGCTATCAA
AGAATACTGGAATTTTGTCAAAAGTACATAGAATTGAACTGGAAGGAGCTCCCACTGGAC
ATAAGTGGGGCAATTTAAACATCATCAAAATGAATGATGACTACAATGCATTGGAATGCA
AAATATATAAAAATATATGAGTTCATAGTGATAGTGCAGAAAATATTGGTTATTTTTGGC
AATTGCTTGAGCACCAACACATTGTTTTGAAAATTCAATAAAGGTTAGAAAATAATCAAG
TGGTTTTTTTCTGCCTTTCTTATACAGAGTATTTCAGGGATAGTTCTGTGTTGAAAGAAG
TTTCCTCTTTTAGCAGAATTCCAAATAATGCTGTTAAAATCATTAGATGAAAGATTACTG
GGGAAATCTGTAATGGATGGATAAGGCCTGAACCCACTGATCACTCTTAACATTACTAAA
AGTGAAACAACTAGGCCTTATGCTGTGTATCTCCTGATACGGAATACACAGAATAAGTAA
GTATGCTTGGCAACCAACAAACCTAATTCTGACTCTAAACAAGGCTCTAGTTTACATGAA
TTAAAGGGGCTAGAGGAACATATTTTAAAATGCTAGAAGCACAGAATTAGCCAACTCTAG
AATGTGGGAAACTCTATAGAAAAATGATTGTTTCTTCAAATTAATGGATTTTCTTTTAAA
TAGGGTGGACAGTGATGGGGAAATGGTATAGTTCTTTTTTTTTAAGCCTAAAGACATATC
AGCCAAAAACAGGGTACAGGGTGTGAACTTTATTTAAATACTTAAACCAACTATAAGAAG
TCATTTTTGAGACAATGGGGGAAAATTAACATGGACTGGGTATTAGATCACATTAGGATA
TTGGCCTGGTGCGGTGGGTGGGTCACCCCTGTAATACCAGTGTTTTGGAAGGCTGAGGCT
GGAGAGTTGCTTGAGGCCAGTTCAAGAACAACCTGGGCAATATAGCAAGTCCCTGACTCT
GCAAAAAATTTAATAAATTAGCTAGGCATGGTGGTACATGCCTGTGGTCCCAGCTATTGG
AGAGAATGATGCAGGAGGATCTCTTGAGCCAAGGAGTTTAGAGCTGCAGTGAGCTATGAT
CACACCACTGCACTCCAGTCGGGGCAACAGAGTGAAATTAAAATTCTGTCTCAAAAAAAA
AAGAAAGAAAGAAAAAATATATTACTTTTGGTAGGTGTGATAATTTTTTAAAAAAAGCCT
TACCTATTAGAAATACATACTGAAGTATTAATGCTTAAAGGTGAAATAATATACTTTCTG
GGACTTCAATATACCCCAGCCTAAACAAACTAGAAAAGTAAGAAGTAGATGAAACCTGAC
TGGCAACAGGTGTGTCATGGGTGTATGTTATCTCTGTTTTTGTGTGTATTTAAAATTTTC
CATAATACAAAGTTAAATGTAAAAATACTTTTATAATCCACAGTTGTGTATAATTTAAGA
ATATTATCTATTGATATTTTCTCATGTTTACTTACCTTAACCAAAGACTAGATATCAAAT
CTCCTTTGTTCTACAACTCAATTCAAAGACAACCCAATTTAAAAATATGCAAGGAACTTG
AATAGACATTTCTCAGAAGAAGAGACACAGATGACCAACAAGCACATGAAAGGATGCTGA
ATGCCTGTAGTTGTTAGAGAAATACAAAGCAAAACTGCAGTGAGACACCAGTTCACACTC
ACTCGGTTAGCCATAATTTTTAAAAATGGAAAATAACAAATGTTGATGAGGATGTAGAGA
ATGTGGGCCTATAAAATAGTGTACTGCTGTGGAAAACAATTTGACAGTTCTTCAAAAAGT
TAAACAGAATTATTATATGACTCAACATTTTCATTCCTAGGTAGATACCCAAAAGAATAT
AAAACAGGTATTCAAAAGTAATATTTACACATGAATGTTTATAATAACAGCATTATTCAT
AATAGTAAAAATTTGGAAATCAACTGATAAACAAAATGTGGTATATCCATAGTTAAACTA
TTATTCAGCCATAAAAAGGAATGAAGTACTAATACATTCTGCATGCAGATGAACTTGGAA
AATACTATGTTAAATGAAAGAAACCAGACAACAGACTATTGGTTGCCAGGCGGCTATGGA
TATTGAGTGCGAGGAATGACTGCTTAATGGCTATTGGGTTTTGTTTGGTGTTGACAAAAA
TGTCTTAGAACCAGATAGAGTTGATGGTTGTAGAACACTGTGAATATACTAAATGTCTCT
CAGTTGTACACTTTAAAAGGGTCAATTGAATTTTTTGTAAAAAAAATCCTATAGTTCTAG
CTCCAGTGATGCTGCTAACTAGGTTGGTTCCCTGGTGTAGTCACTTAACCTCTCTGGGCC
TCAATAGCCTAACTTAGCTAGAGAAAGGGATTTTGAATCTAGATGATCTCTCAGCTCTTC
ATTTCCATTGTTTTGACTAATAACCAGGTGTTTTTAACTTTTACTTTTGAAATAATTTCA
AATTTACCGAAAAGTTGCAAGAAAAATGCAGAGAATTCCCTGAATACTCTTTAAACAGAT
TTCTGATATTTTGCCATATTTGTTAATTATGCTTTCTTTCTCTCTCTGCTCCTTTAACCT
TAATACTTCAGTGTGTTTCCTAAAAATAAGGATATTCTCTTATATAACAATAGTACATTA
ATCAAAGTTTTAAAATTTAACGTTTATACAATACAGTACTACGATCTGTAGTTCATACTC
CAATTTTGTCAATTGTTCCAAAAATATCTTATATGGCATTTATTTACTTTGAGTATAAGG
TCTAGTACAGAAGATACTTATGTATTTATTTATCATGTCTTCTTTAATCTTCCTCTAATC
TGAAACCATTTTTTAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAATGTAGTTTGTGT
CTAATAGGCCAGTGGGTGGTGACAGGTACTGAAAGCAGGCTGAGTCCTTGAAGTTTCTGT
ATGTTACAAGAGTGTAGGTTGCTGATTGGGTCTTAAGAAAGGCCCAAAGACTTGGAAATA
GAAAATCCCATTACTTTCTATGAAAGTAAAATATCAAAATTTGAAAGCAAAGATTATTTA
GATTATTTTGCTGGGTATATAGCCCCAAGAATGAAAATAGTACAGACAGAAAAATGTTTT
CTTGGCAGACAGTTGGTTTGCAGTAACAGATAATTGATGATGGAAATGTGTTCAAATGAA
TTCATTTAACTCTGCTAATGGTTTGAACACTATCTGCCTCATATTCAATAGTGGTTGATC
CATGTCCTTAGGGCAACAATTGAAATGAATATCTGATTCCTCAAACATTATGGTTTTAGC
TAAGCAGATGAATTACAGAGATCATTTGTCCCCCTGAAGTAACAGACTAGGTTCTCATAC
TCGGTATCACCAATGTAGTAGGTTTTTTGTTTTTTTTTACTGATTGGTGATTTATGATTG
CCATACAGCTATAGCTGCTACTAATATCTGATATTTGAATGACACTAGTTTAGAAAGTAA
TTTCAATTTTATGCTCTCATTTTATCCTCACTGCCTCATAGTTTAAAATGTTAAAGCATA
GTGTTTGGATAAATAAAAGGGTATCATGCCAACATAACTGCCAAAAGGCCTTACTCAGGT
GGCATTTGCTTTTAATAAACTGATAATTGTCCAAGGTCTTTTCCTCATCTTTATAGGCTG
GGACCTCAATTGTATGGATGCATAAGGTATTTTTTTTCCTCAGATCAGAATTGCCCTACC
AAGTCATCTGTACAGTCATCAGTTTTATATTTGTAAAGAGAAATGCAATCTAAATGCCTT
GTATTCTCCATGTTGGTGGATATTTTCCTGTAAAAGAGTATCAAACCTTTGCTTGCTGAG
CATGGACTCAGAACAGGGGTTCATCATTCTAATATTTAGTGCAGTAGTTCTCAACTAAAG
TTACACATCAGAATTGCATGTGAAGCTTTTAAAAGTATACATTCCTAGGCTCTATCCCCA
GGGATCCTGTTTGAGTATATCTGAAATGTGACTTGAGCATTCACATATACTTTTTAATTA
TATGGTCTTCCAGGGATTATGATTTCAGTAGGCCTGAGATTGTGTTTTCAAAGCTTCACA
GATGATTTTGCTGCATGCTATTAGCACCAGACTTGTTTACCACCTATGTCCTTCTTCACT
ACTCAAACAGATAGATAGATGCTTATGCTGCCTGTGTCACTCTGTGTCCTATGTGGTTCT
TTGGGTTTGTTTTCATGTATAGGTTGAATATGCCTCCTTTTGTTTCCTCAGTTTTCCTTT
AAGTAGGGTATAGTGGAATATAGATTTTTGTGACTTTTAAGTTATACTTTACTTGCTATT
TTTTTATTCTTTTGAGGCAGGGTCTTGCTATGTTGCCCAGACTGATCTTGAACTCCTGGG
ATCAAGTGATCCTCCCGCCTCAGATTCTCAAGTAGCCGGGACTACAAGCATGTGCCACTG
TGCCCAAGTTCTCTACTCTTTCTTAAATCATACCTAAGATTATGTTAATTAAAATTGTCC
ATGTCCCAAGCTCCTCTGTAATGTATTTGTAGATTACTGAAGAGAATTAATTGTGACCTA
TTCACTTTCAGATGGTAACTTGATTTCCCCATCTTCATAATCTTGGGGGCATATTACTGT
TGTCTGATGTGCCAACAACAGCAATAAAAACAACCAGTGAAATGGTCTGGGGATATTTTC
TTTTACCAATGAGGAAACTAGGTTTTGAATAGTTAGAGTGACTTGTCCAATCTAAATTTC
AGAACCTGTACTAGTATTATATAGTCTTCCAGTGTTATGAATGACTTGTCCAATTTAAGT
TTCAGAGCCTTTTACGTATTCTGAGTCCTAACCAAGTTTCAGTTACCACTGTAGTCCTTA
GCCAATTTTAGTGGTTCAGGAATAAAAGTGTATTATTTATTTTTGAAACCATGTAGCTAT
ATGCCTGCATGTTTGGATTATTAAACAACTTTACTAGGATATGTGAAACTCTGTAACTTT
TAAATGTATGGGGTTTCTTTTTTATCACTTAAGTAGAGATTGAAGCTATATAAATACTCT
AACGTCTGTGGTGGCAGAAAATTTCTTAATCAACATATGGTAGTGCTGATATATGCCTAC
CCATTGACTGGATTCTTATCTGTCTTTATCTATGCTGTACTGCTACCAAAGTGATGTTTT
TAAAAACACAAATCTGATCATGTCATTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACTTGCTT
CTCTTTTTAGAATTCTATTCTTCACCCTTCTTTGCCTGGGGAACTCTTGTTTATTCTTTA
AGACTCAGTTCATGTAGCTTTCAGCTGGGAGAATCCTTTTCTGAAATCCCTTTCTCATCC
TTACCAGTCAGATTTAATTGCCTTTCCTATAAGATACCGTAGAGTCTTATAATAGCACTT
TTACTGTAATTTTCTGTTTACATGTCTCTTTCCTAACAGCTGTTGAACCCATTGAAGACA
AGGACTATGTATTTAGTTATATAAATTCTGTTTTGTTCCTAAAAGGATTTGTGGTGAGGG
CATTGTCTTACTACCTTATTCTTGTGGTATCTGATATGTAGAAGGTGTCGTCCTGCCCCC
CAAAGAATAAATGAATTGGTTAAGGGGAAGAAGAGCAAACCAGTTCTAATGAATTTTTTT
TTTTCTTTTCATTTTTCAGGTTACCAAAAGGGATGAAGACTCTTCCCTGATGCAGCTAAA
GGAAGAATTTCGGAGTTATGAGGCATTACGCAGAGAACATGATGCCCAAATTGTTCATAT
TGCTATGGAAGCAGGACTCCGTATTTCACCTGAGCAATGGTCTTCACTTTTATATGGTGA
CTTGGCTCATAAGTCACACATGCAGTCTATCATTGATAAGGTTTGTGAAATTAGAGATGC
TAATTTTATAACTCTGCTATTACTTTGAAGAATATTAGGATATTCTAAAGAAACTAGAAA
CAGTTGGAGATTCCTGTGTTTTTAAATATCAGACTCTTATAAATTATCTTTTATTCTTTT
TATTATTTTGATTTTCAACATAAACTAAAGGATGCAATAAGGAAGCAAATACAGGGTATT
AGCATAAAAGCAACTAGGCTTACAAAGTCTCCAGCTTGTCTGTGTTCTAGCCCCAGAGAG
CTAACATAGTTTGTAAATAAGTTTTCTAAGTGTCTAATGATGAATTTCATAGGGCAGATT
CTGAGGTGAAAATGTAATTCATCATTGATACCGCTACTATGGAATCTGAAGACACTTGAA
AACCTAGTAAATGTGTTAACTAATTGAAAGCATTTGATTATACATGTGCCATAAAAACCA
TTCATTCTCTTTTCTGTTTGTTAGCTGCAGTCTCCAGAATCATTTGCAAAGAGTGTCCAG
GAATTGACAATTGTTTTGCAAAGAACAGGTGACCCAGCTAACTTAAATAGACTGAGGCCT
CATTTAGAGCTTCTTGCAAACATAGACCCTAATCCAGGTATGCAGAAATATGCTCAATTG
CTTATACTTTTTTCTACCTTTGAGGTAAGTAACACAAGAGAATTACTGCTAACATTCTTA
ACCCCTTTCCCCATCCTCTTGGTGGCTTATTTTAGATGCTGTTTCACCAACTTGGGAGCA
GCTAGAAAATGCAATGGTAGCTGTTAAAACAGTGGTTCATGGCCTTGTGGACTTCATACA
AAATTATAGTAGAAAAGGCCATGAGACACCTCAGGTAAGTACATTTATTACACTTCTGAT
TGCTGTTATCTCTAGTACAGTTTCATCCTGAATATCTTAAGCTGTTTAGTTGAGCTTCTT
ATGTGACTCTAGTCTCATAAGTTTTTATTGTCTCTGTTCTTTTGGGAAAAGCTCAGTTTT
TAATGTATCTAATAAGCATTTCATAACATAGCAAGAGTTCTGAGGGTGTCTGGAATATGG
TGAGTTTACTTCATTATAAAATGTTGAGTCCTTCCAAATATTTTGTCTAATTCATTTCTA
CTGTGGGAAATTGTGACTTTTTTCTCTATTGCTGTCACCCAAATGAATTTTTGTTTGTAA
ATGTACGGAATTTCAATTTTCAAGATATTTTCAATGTACTTTAGAAGTTAAGATATTAAT
ATAATCCTTTATTTTATAATAATAACTTCCATTTATTAGTTACTATAGACCAGTCCCTAT
GTGCAGTATTTTTACATATATTATTTCTAGTCATCACAGACATTTGCAAGGTAATTGCTG
GTCCTAAGCTGAAATTTAAAGAGGTTAAATAACATATCTAAGGTTATGCTGTCAGTAAAT
GACAGAGCTAGGATCCAACCTACTCCAAAGTCTGAGATCTTTCTATATTCTTCTATCCTT
ATTCTATTAGAGGACATTATAATTTCAAATATTAACTGGAAGATGAATGCTTTTATCTTA
TTAGGGTCATAAAAATATGAATAACATCTTAGATTTTAATGCAAATTATAGCAGTCATAA
TGAGTTTTTAATATTCTGCATCATTGTTTGTGTGAACTTGACTAGCTTAAGCCTAAGAAT
AGAGTTGTACCCTCAAGTTGACAGTTAGACAAATGAANNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCAAAAACTAGCATGTGCCCGAGATCTGCGACAGCAAAGGA
GGATGTCCACGAGACAAATGTACATTTGCCATCTCAGAAGAGCTTGAAAAGTAAGTTTTG
AGAATCCTTTTTCATATGGATTTAATTTTTGGTTATTACAGGAGTGTCATATACAGTCCT
AAAGTTTGTGATGAGTTTCAAAATTGGAAGTAAGTTCACGTCGTAGAGTTCTTTAAATTG
CAAAATAATCTTTTCTTTTGAAACCATAAGAAGATTAATCTAGGTGCAAGATTAACATGA
TAAGTGAGTTAGAACCTTATTCAAGGGTCATATTTTGAGACATTTTATAGCTAGAACCCA
TGTTTCTGCTCAGCACCTGTACAGAATGAAAATACTCCTATATTCAGTCTTATTTGCTCA
GGTTCATTTAAATATCACTGTAGAGTTTCAGGCAAAATAGTAACTGGAAAAAAAGACTTT
TGGTCTTTTTTTAAATTAATTTTTTTTAAAAAATAGATCCTGGGTCTTACTTTGTTTCCC
AGGGCTGTCTTGAACTCCTGGGCTTAAGTGATCTTCCTGTCTTGGTCTCCCGATGTGTTG
GGATTATAGGCATGAGCCACCATGCCTGATTGCTTTTGGTGTTTTTGACATTCTTTTTTC
TGTGTCATATTTTGTCTTTCTCTTCTCCTGTGGGTAATCCCTTTTTCTGTATCCATTTAC
CCCAGACATAAAAGATGTATTATCCAAGTTTTGTTTTGTTTTTGAACCAAAACTTTCATT
ATCAAGACTTCACCAAAAATTCATACCAGCCTTTCTACTGAATAACTGACCTGTGTATCA
ACTCTTGCTGGGCATCTTAAACTCAAACTGAGCTGATTTTCTCCTCCCATACCTCCTTTT
TGACCTTCCATTCTACTCTCCCCTTGTACTCTGTTTAGCCATCCAGCCAGTTATATATGC
TATGTTATAGGAATCTTCTTTGTCAGCTGTCCTTCCTTTAGCTTTTCCTGTGTATTCAGT
ACTCATGTTCTGGCAATTCAGCTTCCTATCTATTTCACAACTCTCTCTTCTTTTTTCCAT
CCTTCTAGTCCAAGCTGTCATCCCTTTTTCTTGATCCACAGTTGCCTCCTAACTAGTTGT
CTTACATCTCCTGTTGCCCACCCCTTCTCCCATTATTTCTTACAAAACAGAGAGAAGTCT
TTTAAAAGCACAGATCTACTTATGTCACTCCTCTGTACCTAAGCATTTGATAGTTTCTCA
TTGCCTTGTAGATAAAGATATAAAATCTGTGTGGTGGCCTGTAAGACCCTGTGTCTAACC
TGTTTCTGCCTTCCTAATGTCATCTCACAACACTCTCTAATTATACTCTATACTTAAAGC
CACACTGAACTTCATTCAATTCCAGGAATGTACCATGCTCCTTCCCATTCAGGTCTTTTA
CATAATGCTGTTCCTTCTAGCCTTGCCTTTGAGACCTTTCCTTTGTACAGCTCATCCTTC
ACTTTTCCAGAGAAATCCCCTCCCAACACTTCAAACTAGCCAGCTTCTTCTTTTGTCACA
CTTATCACAATTATAATTAATTAAGGGTCTGTTTTAGAAGTTGCCTAACTTTTCTGTAAA
GTCCAGATAGTAAATATTTTAGGCTTTGTGGATTATGCAATCTCTGTTACAGCCACTCAT
TTCTGCCACTGTAGCAAAAAAGCAGCCATAGACAAATGTGTAAAATGGGCATGGCTGTAA
ACTTTATTTACAGAAACAATTTATAAAATCTATGGACCCTGATCTGTTTATTAAATGTTT
GTTTACCTTAAGTGTAAGCTCTGTGGACTATATCTGTCTTGTTTGTTGTTAATCCCCTTT
TCCTTGGTGGCTGGCACTGGGCCCTGCACATAATGAACCCTACAGCAGCAATAGTGTGAT
AGAAGATATATGTGTGTGCAGCAAAAAGAGTAGAAACATGCTTCTCTTCTCAATTTTTTC
ATCTGCTTGAAGAGCCTAGAGAGGCTACAGGAGTCCTAAGAAAAAAAGATGGTGTTTATA
CCCAGTATAATGCTACATCAAGATAAATTTTGAGACTCTATGAGGTATATTCAGCTTGTC
CATACCTGAAATAGAGCTTTTTTAGAGGACCTTGCTCAGGAGCAATTAGACTAAAATCAG
AGAAGAAACTGGTTTCGTTGCCATTCCACACTCAACTGGTACCCTAGCTGAAAAATCCTC
TCCCTTATGTCTTAAAGCTGGCTTCTTATCTGTAGTACTACCTACTGCAGAACTTTATTG
TAGTAGCAAAGAAATAGAAATAACAATAGCCGAATTAATTAATTACATTTTGTGCCTGGT
ACCATTTTAGTGTTTCACATGTTAACTCAATGTATCCATTTTACTGCTTCAGTGACTTTT
TTTTTTTTTTTTTTTTGATAGAATCTCGCACTCTTGCCCAGGATAAAGTACAATGACATC
ATCATAGTTCACTGCAGCCTCAAACTCCTGGGCTCAAGCCATCCTCCCACCTCAGCCTCT
TGAGTAGCTGGGATCACAGACACACCACACCACTCCTATTTTTTGTTAATATTTTTTGTA
GAGACAGGGTCTCACTTTCTTGTACAGGCTGGTCTCAAACTGCAGGCCTCAAGCAGTCCT
CCCACCTTGGCCTTCAGTGGCCTTTTACCTAGTATCTCCCTATGTCTCAACCTGTCTTTT
CCATTTCCACTTAGATTTTTTTTCCAAAATATGTGTCTAAGTATGTCTATCTTCTTTAAA
ATCTTAATTAGTTCCTCAGTACATCTTAAAGGTACATTCTGTTAATCACTGTGTAAGTTT
TTTTTTTTTTGGAGACTGAGTCTTGCTCTGTTGCCTGGACTAAAGTTGGTGTCATCATAG
CTCACTGCAACCTCAAACTCCTGGGCTCAAGCAGTCCTCCTGCCTCAGCCTCCCACGTAA
TTAGGACTACTGGCATGTACTACCGCACCTGGCTAATTTTTCTATATTTTGTAGAGATGG
CATCTCATATTTCTCAGGCTGGTCTGAATCTCCGGGCCTCCCAAAGTGCCAGGATTACAG
GCATGAGCCATTGCACTGCCATGTATAAGTTTCTTGTACTTTTCCCTTGCATATGTTGTT
TACTCCATATCATGTTTTTTTCTCTCTTCTCTATCTGGGGGGTATTTCTAATCATACGCA
GGTATTGTCTTCCTTCTGTGGACTTCCCTGACTTCCTAAGGCACTCTTACTTGCTTCCTT
CACTGTGTTGCCATTGTAGTTTTACACGGTAATTATAACTGGTGGTTACAAGATTATAGT
ATCACAATTGCTTTTTTACATGTGCATTTTTACTGGACTGCATTTATCCCATGGATTATT
CACCTCTGTATTTCCTGCACCTAGAAAATACCTGATAATGTAAACTCAATATGTTTGTGT
TGAAAAAACAAATACTCTTTAGTTTTTGTTTCTTATTTCCAACCAGCTTTACACTCTCTA
TTGCTTTTAAAACAAACAAATGGGTAATGCAAGGGATTAGAGAAGTAGATGATGTCACTG
TCCTCTTGGTTTAAAAAACACACGTTGCTATCTCACTCTGAGCTTTTAAGGATAGGCCCT
CAGTTCACATAACACACCAGAAACTCAGCAATTGTTTGTTCAACTTAAATAAATTAATTT
TACCCATGTTTGCTTTCTCTGCTATACACCCCCAATCATTTAAAATGTACATGCCCAACA
GTCTCTACTCAGCATAAATATTTATTTATTACATATAAATATAGAATGAATAATATATGC
AGAATAAATATTATGTAAATATTTATATGGGTATATTTTAGAACTAGGATGTTGGGATGA
CATTCCTAAGAATTGCTACATTCTGGGGAGTGTCAAAAGCCTGGGATCAACCAGCTCAAC
AAATATTTATAAAAGATTATTATGTGCTTAGGTACTTCCCAAGATGCTTCTCATGGAGCA
AGAGGAACAGTAAACATGTAAATAAGCAAATTCACTGGTTTGGTGGGCCATGGCAAGAAA
TTTGGATTTTATTCTGGTTGTAACAGGAAGCCATTGTAGGGGTTTTTTTTTTTAGTTTTT
TTGTTTGTTTGTTTGTTTGTTTGTTTTTTGTGAGACAGACTCTTACTCTGTTTCCCGGGC
TAGAGTGCCTTAGCATCAGCCTAGCTCACAGCAACCTCAAACTCCTGGGCTCAAGCAATC
CTTCTACCTCAGCTTCCCAAGTAGCTGGGACTACAGGCATGCACACATGCCCGGCTAAAG
TTTTCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTGAG
TGATGTCTATTACTGAGATGGGAAATGCTTTGGGACAGAAAATCAGTTCTCTTGGCCACA
TGAAATATACTCCACATTCATGCAACAAATATTAATTGGATACCTAATATGCAGGAAGCA
CTGTATTATTTGCTAAATATAGAGAGGTGCATAGAAAGGTAAAACCCTTGTCTCATGGCA
CTTACATTGCAGTAGAGACAGACGTAAAGCAAATAAATAGAAAGGAAAACAATATATGGT
AGTGATTGGTGCTATATAAAAAAAAATAAAGTAATGAGAAAGAATGATTGGGGAAGGGGA
GGTCTTTTAGATAGCATAGTCCAGGCAAGGCTTTCAGATGATGTAACATTTAAGCAGATA
CCTGAATGAAGTGAAGGTATGCACAAGAGAAAAGGAGATAATTACATGAGTGAAGTTTTT
AAGGAAGGCACATAGGCTTGTGAAGTGGGGCACAGGTGGAGAGATTGGCCTTAGTTAGGA
ACAGGAACTCTTTGTCCCTCCTCTTAGGAGGATTGTGTGGTTACAGATGTAGGAAGGTTA
GCGGAATTAGTGGTGGAAAGTAATTCTCTGGTTTCATTTCTTTTCTCTGTTAAGAGGGAG
TATCATCAGATGTGGAGAGGCTGTGAGAGTGGAGGGGGAAAGGATGTTAGCCAGTGGGAA
AATGAATGTGATTAAGAAGTGTATTAATGAATTGCTTGGCCATTTTAAACAATTGTTTAA
AATTGTTCTAAAGGTAATCTAGACAGCATGGTTGCATAGTTTTTCTCTAGCTACCTTTAG
TTGCTTGGGAGCAGGCACAAATAAATGCAGAATTGGATTGTGGTTTTACCAAATGAGTTC
TACAAGAGGTTGTGGGCCAAGGGAGTTAAAGGGAGGGATTAATGGTAGATAGTGAATTGC
AGGATGGGGAAGAAGGGAGTGAATACTTGAGCGACCTCATGGATGATTTAAAAAGAATTG
GGAAAGCCAGGTACAATGGTGTATGCACCTGTAGTACCAGTTCCTTGGGAGGCTGAGGCT
CACCAATTGCTTGAGCCCAGGAGTTTGAGTCCAGCCTGGGCAAAATAGCAAGAACCCATC
TCTTTTAAAAAAAAAAAAAAAGAAAGAAAGAAAAAAGAAAAAGAGGTAATTGGCTTTTTC
AAGTGCGAGGTCCATATTCTAAGTCCAAGCCTTTAGCTGCCCAGATACTAGGAGTCCAAT
GTGTATCCCTACTTGCCACTTTACCTCACTTGGTTAAGGTTTTACTTCTCCTGACTCCTG
TCTTTTGAGAAGCTCACAGTCAAAACTTTATTTTTTGCTTGCTAGAGCAACCTTAAGGAT
ATTTGAGATTTGTTCTTTGAGAAAGGAAAACAGGGAGCAGCTGGACATTTCGAATAAGAA
TTTCAAAGAAAAGAATGAGTAGATTTCATAGAGCAAATTGAGGAAAGTACGAGGATCTTT
GGGCCCTTTCGTGCCACCAAATTGCCTTCATAAAATATAGGTCTATAAAGATACACACCT
ATTATTTACCTATAATAATTAAAAATAAAAATTTTTTTAAAAAATACAGGTCCACTCATG
CCCCTCCTTCTTAAAGAAGTAATCAGTGGCTCCATTGTCCACAAGATGCCATGGGTATAA
ACTGGCCATCAGTTTTTTTTTTGTTTTTTTTAAACTTTATGTTCTATTACTCCACTTTCA
GCCAGTTTGATCTGGGAGTACTTGTCTTTTATTGAGCTTCACCTTCCTCTGTTAGTGTGT
GTATGTGTGAAAAGGAGAACAAGAGAAGGATTGAATGATGAAGCTGTTTTGTAGATACTG
GAAAATTAAAAGGGAAACTATAGTAAACTGGGTATTGTTTATGACCCCAAATGTATGTAA
TCTTCTTTCTGTTCATGTAACTTAATTTTTCACCACTTTAAAATACTGGAGGTAATGTTT
ACAAGGAAGGACTACATTATAATGAAATTTTTGATATACAAGTACAAACAAATTGTCTTA
AATGGAGTCCCAAGATCAAATTGCTTTATATATTAGAGTATTATATCTGATGATAACCAT
AAATAAAAGTCAAAACTTAGTATGAGAAAAGTCTTTAATTCAAATGCACTTTAGGCATAA
GCTAATCTGAAAAATATAATACAAAATTTCTATATTTTGTGTGTAATGTTTAAGTTTTGG
TTTTCTTAATTTTTAAAAACACATATGTAATGCTTTAACAGTTCGGTAACAACAGAGAAT
GCTTCAACTCTTGCGTATCTTTTCTCTTCATTCTGTGTTCCCAACTAAATTTGGTGCTGG
TTCCTGTCATTTTAACATAGTGTACTTTATAATCCAGTTATATAAAATTATCAAATGATC
CCTTCCCACTCTCTCAAAAGGATTTTTTGAATATGTGTGTATNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGATTATTTAGCTGAAGAAGCTATTTTAGAGCTGTTTCT
ACCTTTTTAAATCCTTTCCTATGTCTTTTTTTCTTCAGAGTAAGATTTAGTGAAATATTC
ACCAATATGTTCATTTTTTTAAAACAGGTATCGATTAAGGAACAAAAAGATCAATGCCAC
TGTAAGAACGTTTCCTCTTCTAAATAAAGTTGGTGTAAACAACACTGTCACAACCACAGC
CGGAAATGTCATTTCTGTCATAGGAAGTACTGAAACAACGGGAAAAACTGTTCCAAGTAC
AAACGGAATTTCAAATGCAGAAAACAGTGTTTCCCAGCTAATCTCACGTAGTACTGACAG
TACCTTAAGAGCTCTGGAGACTGTGAAGAAAGTGGGGAAGGTTGGCACTAATGGTCAGAA
TGCTACTGGGCCCTCTGCAGATTCTATAACTGAAAGGTAGGTATTAGGCAAAAATGGTTA
ATATTAATTCTTTATCCTTTTTAGATGCCTGAGTATTTTTATTTATCCCAAGGAATAGCA
GTTAATCAGAATTTTTATGCACAATGTTTCATGTAGTAGAAGAAACACTAAATACCAAAA
AATGTTCGTTCTAGTCCTGGCTCTACAACTGAATAGTTCTGTAAAGTTGGAAGGTCATTT
CAACTCTGGGTTTGGTTTTCCTCAACTGTATACTGAAGAGGTTAAACCAGAATTGGGTTT
TTTGATACCTTACTTCCTTTAACTTTAGTATTGATTCCATAGAGGTGCTAGAAAGAAACT
AATAGAGACCTGAGCAAGTGAGATGCTCAGCCTCTAGCCCTGTTTCAGTCAGAGCACTTC
TGCTTTATTTATATTCTATAATTATGTATAGTAGTTAAGAGGGGGAATCTTGGAGCCAAA
CTCTTTGGGCTCAAGTTCTGCTTATTGTTTCCTAGCTGTGTGATCTTGGGCCAGTTGCTT
AACTGTGTTCCTCAGTTTACACATCCATAAAGTTACAGTTACAAATAATACTTCATATGT
TGGGCTGTGAAGACTAAATGAGGTTAACTCTGCAATATGCTTTGAACAATGCCTACCAGA
TAGTAGGCACTCAGTAAATACTTGTTTTATTACTATTGTATTATTACCACCATTGCGGTA
GTGATTGGATACCAGGCATAAGATTTCATTTGGCAAAGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNACTCTAAAATCCCATGTTTTGGTATTCTTTTGTAGGTTAAAA
TCTGAGTTAAAGCATGTTAAGATTTTGTTGCCTACAAATAGTCTGTCAGTATCTGTTGTA
TGCCTGCTAGGAAAAAAGCATTGTTGTGCTAGACACAAAGTACACTGGTAGTGGTTTCAT
GTAATAATAATGGGTAGATAAGCAGTAATATTTGCTCCTTCTGCAGTGAGCATATGATGG
GGGAAATTATTTATTAAAGGACCCCTAAATCTTTCCTGGGAGAGATTTTAGAAAATATGT
ATCAGAGAACATTATCTAGCGAACACATGTTTTTTATGCACTCATTCTGACCTGTGTTTT
TGTCACTGTTGGAAGTACATGAGACATACAAGGTATCTCTGCCTGTAAGGAATTTATGAT
AATGTAGTTGTGGAAATAGCATTCACACAAATGAAGCAATATTGGAATTGGATTATAGGA
CAGGAAAATCTTATATTGCTGGGAAAAATACAGGAGATTTCAGAAAAGAAAACAGTATAA
CATGGATTAAGTTTGTAGATAATTATATGGAATATTGAGGAAACCAGCCTTTTAGATTTG
AAGCTTTATGTTAAGGACTGGCATAAATAAGATTAGATAGATAGGTTGGCACCAGATTAT
GGAGACCTTATGTTACAGATGTTTAGGAAATGAGTTTTTGAAGGGTTTTGGCAAGGTAAT
GTTGTAAAACTATTTTATATCCATACAATGGAATATTATTCAGCTATAAAGAATGAAGTG
CTATTACATGCTACAATATGGATGGATCTTGAAAACATTGTGCTAAATGAAAGAAGGCAG
ACACAGAAGGCCACATGTTGTATAATTTCATTTATGTAGAATGTTCAGAATAGGCAAATC
CATAGAGACAGAAAGTAGATTAATAGTTTCTAGGAGCTTAGGGTGGGAGCAGGAATGGAG
AGTGCATGCTAATGGGTACAAGTTTCCCTTGAGAGTGGTGAAAATGTTTCAGGATTAAAG
AGTGGTGATAATTAGACAACCTTATGATTATACCAATAACCACTGATTGTACACTTTGAA
CGGGTGAATTGTATTATCTCAGTATTTTTAATGGACTAGGGTAACAACTTTAAAAATAAT
CTACATAAATTATTTATTCAAATACTTAAAGAAATCTACATACTTTATTTATTCATCAGA
TATTACAGATCATCTAATATGTGCCAAACATCAAGCCAATTGGTGTAGCTAATGAAAATG
AGCCATGGTGGATACAGTGGCTCATGCCTATAATCCCACCACTTTGGGTGCATGAAGTGG
GAGGATTGCTTGAGGCCAGGAGTTGCAGACCAGCCCAGGCAACATAGTGAGACCCCATCT
CTAGGAAAAAAAAAAAAGCTGGATAAGATGGCATGCACCTGTAGTCTTAGTGGCTCAGGT
GGGAGGATCTCTTGATCCTAGGAGTTTGAGGTTGCAATGAGCTATGATGACGCCACTGCA
CTCTAGCCAGGTGATAGAGCAAGACTGTCTCAACGACAAAGAAAGCATGGGTAAAAGAGT
CATGTTAATGCCTGGGAATTGTTTTCATTTCCTGTTGTCCCCACCAGAATGTGAGATCTC
TTACCATTATCATTTTCTATTAGTGTTTTCACTATATAATTTTATGAAAAATTGTTTTTT
AAGAAGACATTTGGTTATCTTTTTTTTTTTTCTACACCACTGTGATTTGGGATGGTTATC
CTTTGTTGTTTGTTAAACTCTCTCTCCAGTAAAATTGGTTCTCCACCCAAGACTCCTGTA
AGTAATGTAGCGGCTACCTCAGCTGGACCCTCTAATGTTGCAACAGAGCTGAATTCTGTG
CCTCAAAAATCCAGCCCATTTCTAACTAGAGTACCAGTATATCCTCAGCATTCTGAAAAC
ATTCAGTATTTTCAAGATCCAAGGACTCAGATACCCTTTGAAGTCCCACAGTATCCACAG
ACAGGTAAATAATTTTATATAATTGTGTAATTAAGAAAAAAAGAAGCTGTAATCTGACAT
GTGTTTCCCTTAGATAAATGAGTGAATCATTTATATCTGTCTAGAGTGTCCACATTAAAA
AATTAATCCTTTGGAGTATGTGACCCATATGTTTTCTCCTGCCCTAAGAATCTGGTTCTA
GATACTAATAGTTATCAGATTGTCATTCCTATGAATCAAATAAGGTTCATGAATGAGCTT
CAGGGAATACTGAAAATCCCCTGAAATAGTATGTAAAATGTTTTGTTTATGTATGCTTAT
GTACAATTTTGGAATGACAGTGAACAACTTACATAGATTTTGAAAGAGGTCTTTAACCTC
TGCTCCCAAAAAGGGTAATAAGAATCAATGGTGTAATCATTTAATCCAAAACCTGTGGCA
ATAGATGCTCTAGAAGGAAATTTACCAGCCATCTATTAATAGCTATGTCATGTGTTTTTA
AAAACCAGTTTAACAAAGTGTTGAATGTTAATGATTTTCATATAGTAGTATCTTGAAAAT
ACATAGCTGCTTTGTAAAGCAGGGTAACTGAAGTAAATTCAAAGCTTATATTTTCCCACA
TTAAAGGCTACCTTAGATTTAAACCATTATAAAATGTTGGATTTTACTAAGATTACATTA
AATATTCCTTTTTCCAATTTTCAAGGATACTACCCACCACCTCCAACGGTACCAGCTGGT
GTGGCTCCCTGTGTTCCTCGATTTGTGAGGTCCAATAATGTTCCAGAGTCCTCCCTCCCA
CCTGCTTCCATGCCATATGCCGATCATTACAGTACATTTTCCCCTCGAGATCGAATGAAT
TCCTCTCCTTACCAGCCTCCTCCTCCGCAGCCGTATGGACCAGTTCCTCCAGTACCTTCT
GGGATGTATGCTCCTGTGTATGACAGTAGGCGCATCTGGCGCCCACCTATGTACCAACGA
GATGACATTATTAGAAGCAATTCTTTACCTCCAATGGATGTGATGCACTCGTCTGTCTAT
CAGACATCTTTGCGAGAAAGATATAATTCATTAGATGGATATTATTCAGTGGCTTGTCAG
CCACCAAGTGAGCCAAGGACAACTGTGCCTTTACCAAGGGTAAGTGATGGTGGAAATAGG
AATGCTACTATAGTGTAGTCGTTAGTGAGTCATTAGTGAGTAGTTAGTGTAGTAGTTAAG
AGTCAATGTGTGGAGTTAAACCACCCAAGTATACCTTCTAGCTCCTCCACTTACAGTTGT
GTCACCCAGGGAAGTTACTTGACCTCATGTGCCTCAGTTTTTTCATCTATTTGATGGCAA
TAACAGTAGTACCTACCCTCAAGGCTGTTGTGAGAATTAAATTAGAAAAACAAAACTTTT
GGAACTAGGCCTGATACATATGAATGCTCAATAAATGTCATATTTGGATAGAAACTGTTG
GGAAGGTAAAAATAAATCTCAGAATTACAAGGACAAGGCTTCTTTTCAGTATCTCCACAT
TTATACAAATGACTTCCCTAAACCAGAAAAGTGAGTGCTCAGATTTTACTTCTAACATCA
CTTGAATAAATATTAACCTTTTTGTTTAAGTGTGTGGAGAATAGACTAGGTGACTTTCCC
TCCTGTGTTTTTTTTATCCCCAAAATATCATAAACTGTTTACATTATTTTCACAGAGCAT
AGTTAAATTTATTCACCACTCCCTAGCTGATTAAGATTGTTTCTTTTATCCTCCATTAGG
AACCTTGTGGTCATTTGAAGACCAGTTGCGAGGAGCAGATAAGAAGAAAGCCAGATCAGT
GGGCACAGTACCACACTCAGAAAGCACCTCTTGTCTCTTCAACTCTTCCTGTGGCAACAC
AGTCACCAACACCACCTTCTCCTCTATTCAGTGTAGACTTTCGCACGGATGTAAGAAAGG
TTTTAATCACTTGATCTTGCAGGGATAGTTTAAAGAGTTAACTTCAAATTTCTCATTCAA
ACCAGGGTTAGTTATTTTGGATATTTTGCAGTGGTTTCCTGCTCACTAGGTGTTGTGAGA
CTCTGAAGACCATCATCATATATCTTTCAGTCCTTTATCAACCAAGAATTAAAAATCTTT
CCAGCAGTACAGTTATTTTTATAGCCTTTATTAATAATAAGCTTTATATCTGCCATTTAT
TGAGCACCTACTCATGCCAGGCACTGTACCAAGCATTTACATTAAGCTATTTTATTTAAT
TCTCACAAAAACCTTAGGACACAGGTATTATCCGTACTTTACAGGTTAGGAATCCAACTC
AGAAGTTATGTAATTAGCCCAAGATAATTCAGCCTGTAAGCAGCTGGGATTTGAATCCTG
GGCTCAAGCATTTCTTCCCTACTTCACAAGAGGTACAGAAATGCCAACTAATTATTCATG
CTGTTTACATCACTGCTAATTATTGTTCTTGGCATTACAAAACAAGTTTTTGTACCAGAA
TGATTTTAATTTAATCTGGTGTTTTTAGTATTGTTATATTTAGAGAAAACCATTAATTTC
TTTTTAAAGTTTCTTCTAATTTATTCCCCACCCCCAGAGGATCTGATACAAAAATTTTTC
AGTCTTTTTTATTATAAACAATTTCAAACATATGGCAGCCACAGTGTCTCATACCTATAA
TCCAAACAACTCAGGAGGCTGAGTCAGGAGGATTGCTTGATGCCTAGAGTTCCAGACCAG
CCTGAGCAACATAGCAAGACCCTGTCTCTAAAAAAAAAATTTCAGACATATACAAATGTA
GAGTGAATAGTATAATAAACTCTACCTATTGCCAAGCTTTCACAATTATCAACTCAGCCA
ATCTTATTTTATTTGTATCCCCTTTTCTGCTGGTTTATTTTGAAATAATCCTAGGCATTA
TTTTTTTTAATCCATAAATCTTTTAATAAAGCATTGACTTTTTAAACTAGATCCAAATTT
GTCTTATCAAACTTCTTCGAAGCAGGTAAACATCTTGACAACAGTGACAGAGCTGCCACT
TGCTTGATAGAAAAGTGTATTTTCATTTTTTATATAATATATTTTAGGAAATGAGTATTT
TCTGAGATAAGATCTGCTATCAGCTTGCAGTTTGTCTTCGGGCAAGTTATTTAACCTTTT
TGGCCTTAAGTTTTCTTATCTGAATAATTAATAAAGTAGATTTAATGATTATTACAACTT
TAGTATTCTGATCCTATAGTATTCCTACAGTTCCTTTAAAATGTATTCACTTCCTCTTCT
AGCTCCAGACCCTTCTTTGAATTCCTTTGGCTCTTTATTTAATACTACATGGTTTATCAG
TCATGTTCCCTTATTAGCAGGTGTTGTTCTTTTGTCAAGGAAATTATAAACTCCTTTAGG
ACATGGACGGAGATCTCTGTGTCCCGTGCACATCGGTGTAATCTCTCAATCGCCACANNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCTTTTGCTTTTTTTCTCTTC
ATTTTTTTTTTTTAGAGCACCCATACTATGTTAGTGACATGCTATAAATATTTGTTGATT
CCTTTTGATAGTATCAGCCAAGTGTTCCTTATGAGCACTTTAAAGGAAAAAGGGAAAAGA
GAAGGCATGCCATTTTCTAATGTAAAAATACTATTTGTTGCTTATAACAGTTTTTATATT
AAAAGAGTATAATTGTTCACTATGAAGTTCTCTGGATTCTATAATAGTCACTTTATATTA
GTTACAAGCTTATAAATTTAAGTTTCTTACTAATTGGCTTACTTTTTTTTAAAAACCAGT
TCTCTGAGAATGTGAGTGGTACAAAATTTGAAGAAGATCATCTTTCCCATTATTCTCCCT
GGTCCTGTGGCACCATAGGTTCCTGTATAAATGCCATCGATTCAGAGCCCAAAGATGTAA
TTGCTAATTCAAATGCTGTGTTAATGGTATGATTTTGCTGGGTTTGGGACTTGGTGGGGA
GAGATAATGCATGTTGACTCAAGTTTTAGAATGAATGCTTTCATCTTTTTACTGTTGCTG
TATAACTCATCTGTAATCAGCTGCATTATATTTAGATAAGTCTGAAATATATTGCATTAA
ATATTTAAATTATTTAAGTATAGTTTAGTGGTTTAATAATAGTGTTGGATTATCATTGAC
ATTAGAGCTAGTGTTAAATTTATCAGAAAACCTAATAACATGTTTCTTGATAGCATATAC
TTACTACTGAAGTAACAGTCAACAGTCCTTTTATTGATTTTTTTTGGTTTATGCAGGACC
TGGACAGTGGAGATGTTAAGAGAAGAGTACATTTATTTGAAACTCAGAGAAGGACAAAAG
AGGAAGACCCAATAATTCCCTTTAGTGATGGACCCATCATCTCAAAGTGGGGTGCGATTT
CCAGATCTTCCCGTACAGGTTACCATACTACAGATCCTGTCCAGGCCACTGCTTCCCAAG
GAAGTGCGACTAAGCCCATCAGTGTATCAGGTAATCCGTTTCATCCCTAGTCTGATATAT
TCTAGGCACTGTGCTTTTTAATCCCCAATCTGTATAATAGAGTACTTTTCCTTCCATTTA
ACAACTCTACTAAACTCAGAATTAAATGGTTTAACCAGCATCATATGGCTAGTAGGATAA
ATTGCAGATTTTTTTTTGAAAAGTATACATGCATATCTACCTACTGGTTTTTTCACTTTT
GCAAACATTGTTTCTTTCTATGTTTCTCAAGATTACGTCCCTTACGTCAATGCTGTTGAT
TCAAGGTGGAGTTCATATGGCAGTGAGGCCACATCATCAGCACACTATATTGAACGGTAA
TGTTTTTCTTAATTCTTTAGGATTTTCCATTCTTAGACTTGTATGTATCCTCAGAGAGCA
AATCCCACCCCCATTTGTTGATGAAATGTGCTTTGCTAGTCTCAGCTGTATAACAGATTT
CTGAAAAATATTTTTATGTTTACATTTGGAATGATGACTGAAGCTTACAGGGTTGATCTG
TTACATAAAACATATAGTCATTATTGCTTTAGTTGCTTCATTTATTTTTCTTTTATTACA
ATAAATGTATTTCTCTTTAAAGGGACAGATTCATTGTTACTGATTTATCTGGTCATAGAA
AGCATTCCAGTACTGGAGACCTTTTAAGCATTGAACTTCAGCAGGTAGGTTCTAGGTAAC
TTAGCTTTTAATTTATAAAAAAATAGAATGACATTTGAAAACTATGGTAGGAAGTTTACT
TTTTTTCCCACTTTCTCGTTATATAGGCCAAGAGTAACTCATTACTTCTTCAGAGGGAGG
CCAATGCTCTGGCCATGCAACAGAAGTGGAATTCCCTGGATGAAGGCCGTCACCTTACCT
TAAATCTTCTAAGCAAGGAAATTGAACTGAGAAATGGAGAGGTAAAAAAACTGAACCTCT
CAGCTTCATGCATAATGTATTTGTTTTCTTCAAGCTGCACCTTGGTTTATACCAGTCTTT
GTGCATTTTAGTGTGCCTTTTTCTGGTGGATGATTGATCACCGTTAAAACTTACAGTAGA
AATAAAATTATAGTCTGAGATTTCCTAAATAATTCTTTAATTAAACCATTGAGGTATCCA
TTTTAACTTAAAAGGGGAAGCCCCAGATTTCACAGGTAGAAGATCAGTATTTTTGTTGTT
TACAGAGTGATTATATAGAAGATTCAACAGATACTAAGCCTGATAGGGATATTGAATTAG
AGCTTTCAGCACTTGATACTGATGAACCTGATGGACAAAGCGATCAAATCGAAGTAAGTA
CCACAATTAGATAATTAGGAAATTTTGTTCCTTTGAAAACTAAAAAAAGTATAAAATACT
TTTCATACTGAAGAATTAAAATTTTGTTTTCCTAGGAGATCCTGGACATACAACTTGGAA
TCAGTTCTCAAAATGATCAGTTGCTGAATGGAACAGCAGTGGAAAATGGGCATCCAGTCC
AACAGCACCAAAAGGAGCCACTAAAGCAGAAAAAACAGAGTTTAGGTGAAGACCATGTGA
TTCTGTGAGTGTTAGACAGAAAATTCATAACCAGTGGACTTAGGGCATGAATACTTAAAG
AGAAATAGAGGCTGTGTTAAATTCATTTTTGGCTTTGTGCTGTGAGGAAGACCTTATAGG
GCAATGATTTGGTCAGTCCAGATTTTTAGGGGGAAAGAGATAAAAGTGAACTAACAAAGT
AGTCCATTTTAGTAGCCTGAAACTTGCATTTTTTGGGGATAAAGTCTGTGCTCCAGTATC
AGGTTATACTTCTTCAGTCTGGTAGCCAAACTTAAAAGAATTACAACTTAGATTAAGGTT
TCTTTTTAACAAAAATCATGTTAAGTCTGGGCTTTAGTGGCTCGTAATCCTAGTACGTCT
AGAGGCTGAGGCAGGAGGATCATTTGAGGCCAGGAGTTCAAGACCAACTTGGGCAACACT
GTGAGACCCCATCTCTACAAAAAAAAATAATGTAAAAAATTAGGTGTGGTGGCACACATC
TTTAGTCCTAGGTTGTCAATGTTTGGCAACCTCATTTTGCCAGCTACTCAGAAGGCTAAG
GCAGGAGGATCTCTTGAGCCCAGGAGTGTGAGGCTGCGGTGAGCTGTGAATGTGCCACTG
CACTCCAGCCTGGGCAACACAGCAAAAAATAAAGCATGTGTTAAGGTTTTTTTGGCTATA
ATAATACCGTTTTGTATAATTACTGCCAAAAGTATGGGCTTAATCTTGAACTTGATAGTT
TATATGGCCATAAATGACCAGTATTTTAATTCCTTATTATAATTTTTGAAAAATGAGATT
TTTTTTAAGTGACTTGTGATGCTTTTAGTGTTTTTGCCTGGGGCTCATAAAGCTTGATAA
AATTTTCATTAAGCATGACGTATGGTTGCTCTTTAAAGTTTTCACTTAAGACTAATTTGT
TTTCAATATCATTTATTTTTTCAGGGAGGAACAAAAAACAATTCTGCCGGTAACTTCTTG
CTTTAGCCAACCACTCCCAGTGTCTATTAGCAATGCAAGTTGCCTCCCCATCACCACATC
TGTCAGTGTTGGCAACCTCATTTTGAAAACTCATGTTATGTCTGAAGATAAAAATGACTT
TTTAAAACCTGTTGCAAATGGGAAGATGGTTAACAGCTGAAAGAAGGTTCATCTTTCAAA
TTTGTGACCATACCATGGAAGCATTTACACTAGCTTTTTATATATATAATATATATTATA
TAATGTATATTTTTTTTAAAAAAAAGATATTACCGGGGGCATCCATTTCCTGTGGACTCT
TTGATACTTCAAGCCCTCTGGCATTAGCATTATGAAAAAAAAAAAGAAAATTTACTTTAC
TAGGGTAATACGTTCACTTTCCAGAAGTGATTGGAATTTGGACAACATTTAACTTAAGCT
TCAAGCAGCTTTTTATGAGTTTGTAGCAATCCGGTGCAGTAACTGAGCCATTTCCTATTT
TAAATGGCTTCTATAGAAAATTAACAACTCAGTTATTAAACTAGCAGGATCCTACAATGA
TACATCTAGTGAAAGTAGACTTAATTAACTTATTTATTTCTATTTTATGTTTCACTGAGA
GAAGTTTCCATCTCATTCCAGCTGCTTTATTTATCTTTTTCATGGGACTTTGCATGGATT
TTTTTTCTTTTTTTTCTTTTGAAGAGTGGAATTAGACATTCTTACCATAGAATTTTACAG
GGTTATATACTAGCTTTCTTTACTGCATTATATGTAGGAGTGTGGTGCAGTGCTTTTATC
TGTAGCATTTAATTTTTTTTTTTTAATTTTCCATTTTTCAAGGATAGTTTCTGCTTTGTT
AATATTTATACACAGGCTACTTGTTGAAGTAATTAATTAAAAATATAACCAAGTGCCTAA
GTCTTTCAGCTGATGTACTAGATATTAAATTCTCCTAAGTTATGCAGAATCGTTTTTACA
ATTTTGATAAATTATGCACTAATGTAATGGCAGTTTTTTAAAATGCAGATTTAAGCCTGT
ACATTATTGAATCTGATGACTTGGCAAAAGAATCAGGTGCTTTCAGCTTTCTTGAGAAAA
CCCTGTATGTAGCGTTTGCACTGACTAACAAGATGGTATTGCTGGGTTTTTAACTTAAAC
TAATTAATTTGGGTGTTCTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1231, 8238..8355, 8456..8689, 17823..17998, 21739..21939, 22404..22536, 22655..22773, 23939..23959, 23962..23977, 23979..23998, 24000..24011, 24013..24018, 24021..24029, 24031..24036, 24039..24049, 31167..31475, 34049..34263, 34945..35378, 35999..36169, 38099..38245, 38576..38789, 39031..39115, 39382..39463, 39566..39700, 39962..40072, 40175..40323, 41244..41439
1001..1231, 8238..8355, 8456..8689, 17823..17998, 21739..21939, 22404..22536, 22655..22773, 23939..23959, 23962..23977, 23979..23998, 24000..24011, 24013..24018, 24021..24029, 24031..24036, 24039..24049, 31167..31475, 34049..34263, 34945..35378, 35999..36169, 38099..38245, 38576..38789, 39031..39115, 39382..39463, 39566..39700, 39962..40072, 40175..40323, 41244..41436
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved