Microcebus_murinus Locus PTCD3
snOPY snoRNA Orthological Gene Database
Microcebus_murinus PTCD3
Microcebus_murinus
PTCD3
GeneScaffold_328
SNORD94
26351..26487
29330
CCAGCAAAGAAAAGTTGAAAAGTTATGGCCTGAACTGACACTTTGAAGGATAATCATTT
TACAGATTAGCCGCCTCAAGGGCAATATGGTAATTCCACAAACGCTTGTTAATTAACGAG
GAGACTGGCAGATGATAAAGCTGCAAACCGGGATACCTCCCTCTCCCCAGCCCCATCGGA
TTCTAGGCAGTGCACTTCGCCACAGGAACATTCCCCGAACTACGGATCCCAGCAGGACAC
GCGCCAGACAATCACAGACGCAGAAGACAGGCCAGGCCCAGCAGCCTCTGGGAACGGTAG
TTTATGGCGCCGACCTCAGCATCCAGGCTGTGCAATGCTTCCCACCAACTCCTCACCTGA
GCTCTTCAGCCGAATACATCCCGAAGGAAATGCCCTGCAGTCGCCGCCAGGGCATGTTCT
TGGAGCCCAACATCCTGCAGGTCAGTTTAGAGTTCCGACACCCAGAGAGACGTTCTAGTT
ATCACCGGCAAACTCTCAACTCAGCCACAAGCCCGGAGCCACCATGTGATTCAAACTGCG
CATGCCCGCGGGAATCGCTAGCTGGAATGAGATTTACGCGGACGAGATCATTTTTGTTGT
AGGGGGAAAGGAAAATAGTTGTACTACTCTCTACTCGTCCTCTTATTTTGAAAACAATCA
GAGACATATAATACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATAG
TAGTGCAGGAAAATTTCTTCGAGGCTTCTGAAGCATATTGAGCCTTTACCTTCCGTGGTA
AAGTCTTTCCAACCACGAGTTTGCAACCTCCAATTTCACGATTGCTCTGGTCTTGTTCCG
TGTCCGCCAATAGCTGAGCTCTTCCCGCCCACTTCCCGGCCCCCCGCCTTCCCGAGGGTC
GGAGGCATGCTTTCCCAGCATGCTCTGCGAGGAAGCGAAAGATGGCGGCGGCTGCTTCAG
GTACCTTGTGGAAAGTCCGCTGCAGGCTTGGCCTGCGGCTGAAGGGTCAGCGGGCAGGAA
TGTGTGAACGGATATCCAATTTCAGGTAAGAGAAGCTTGAAGGATCCACGAATAAGACCG
CGGAGTCAACTTAGTCCTGTGTTTCCCTGAGAACTGTTGAACTAGGTACAATGGAGTGGT
TTGCGCATGCGCGCTCTCGGGGCCTTGTGCGCCGAAGCCCAGGCACGCGGAGCTGGTGCT
TTGAAATAGAATTTGAAACGCATTTATTCGTTAGGGAGATTATTTATTGTTTGCAGTACT
CTGGAGTTAGAACTGTCCGCAAAACTAGGACTTTGCTTTCGTGAAACTCACTTTTCAGTG
AGGGTGGCTGTTAGCAACTCTGCCTCTAATTAAAAAAAAAATATCTACACACACACACAC
ACACACACACACATACACATATATATCTGTCCTAATCATTTTAACCCAACCAGAAAGAAC
GGGGAGAACTCCTAAGATTTTCCCAAATAAAAGACAGCCTATGATCGCCACTATGTGCAG
GGTGTTGTGGAGACTTTTGGCCTAGGAAGTTAGCAGGTTTTCATAAAAGCAGAAAAGTCT
AAAAGATCTGACCACACCCTTTGAATCACCCTTTGAATCTGTGATTGTTACAGCTTGGAA
CTTGTATCACTCACCCATTTATGTAATTTTTCATTTGGTGCAAATCGTGGCATTGTGGAA
ATATGAGAAGCAGTAACATGTAGTGAAAACTTGAGACAAACCTGATCTTACATTTAGTGT
TAGCCAGTCCTTCAGTTGGGTGATAGTAGACATTTTCTCATTTGTAGACTGGAGCTGTTA
ATAACCATGGGAAAAATGTATGAGGAATAAGTGAGATATGTAACTTACAATATTTTTTTA
ATGTATACTCCACCTGGTATTGGAGAAGCCTTTATGCTGCCATTCAGTCCCAGTGCACCT
TTTCCTGCTAGTGTCCATTGTTGACATTTTTCTACTCATTTTCTTTGCTTCACAGCAACA
TTTCTCTCAGCATTCATCCTCAAGACAATGACTATCTCTGTTCTAATGTCGTGAGAAACA
AATAGCATGATTTGAAAGAGTTGATTTCTGTGAGTCTGGAAGGTGGTACATGCCTGTGAT
CCCATCTACTGATGGGGTTGAGGTGGGAGGATCCCTTGAGCCCAGGAGTCAAGACTAGCT
AGCCTGAGCAAATAGTGAGACCATGTCTTCAAAAGCAAAACAAAAAAAGAGTTGATTTCT
TTCTGAAATATCTTTAGCAGAGAGAGGTATTCTTATTTTAAAAGGATGCCTGACCAGATA
CTAGTGGAAAAAGTATTTTTCTATGTAATCACACCTCAATAATTTTTTTGAATAGTACTG
ATGCCATTCAGGATGGGGAAATATGCAAAATAGTATTAGTCGTGCACATTATCTGTGTGG
TGTGGAAACTGTATTTTTAGTGTGATTAGAACATTTTAAAACTCAGTTGAGGCTGCACAG
TGGCTCAGCCTGTAATCCTAGCACTTTGGGAGGCCAAGGTGGGAGGATTGCCTGAGACCA
GCCTGAGCAAGAGCAAATCTCTATCTCTACAAAAAATAGAAAAGTAGCCACACGTGGTGG
TGTGTGCCTGTAGTCCCAGCTACTCTGGAGGCTGAGTTAGGAGGATCACTGGAGCCCAAC
AGTTTGAGGTTACAGTGAGCTATGATGACACCAGGGCATTCTAGCCCTAGCAACAGAGTG
AGACCCTGTCTCAAAAAAAAAACCCAAAAAACCTCAGTTGTGACCTGGCTCTGCGACACA
ATGGATAGCATATTAGACCTCAGTTGTGGACCAGTGATTCTGTATTTTTGGTGAAAAATA
GTTTCCTACTTGAGCCTCTGAAAATGGAAAATATCAGCGGTTCCAAATCTAAATTACGCA
CTATGTATTTGGTGCATTCCTTATGGTTGAAGGAAGTGGAAGGCAACATGGGTCAAGCTT
CTTCATAGTTACTTTAAGTGAGGTAAGCCTTTACTACCAGTGTGTTATCCATATGAAAGC
AGGAGCTCATTGAATTGTTCTTAACCACAAAGTGTTTTACCTTTCCACTGTTGAAAGTCC
CTTGCATTTCAAACCAGCTGTTAAAATTGTTGAACTGCCTTTACAAATTTCATTTTCTTC
TGAGTCTATGTAAAGATTGCTTCAAAAATTTTTTTACCATCTCATGTCCATATTTCATAT
CCATTGAACGTGCTACATAGGCCACATCTTAGCATGCAGTGACATGAGTTATCCAGTCAG
TTTAATCCATAACAATTGGAAAATTTGGTCTCAAAATGCACAGAGGTGGAGGTGAACTGG
GAACCTCATTAATGAGTTTAGCTTTAGTGCTTTTATTTTTTGCAGATTTTATTCTGAAAG
TGCAACCCTCCCAAAGGTTGAAGGAAGTGATGTAACAGGTATGTAAAAAAACCTATTGAA
ATAACTTCATTTTTATATCAACACATTGTATTCCATAGTAGTTGCAGTATTAGAAGGAAA
CTGATTCATGTTTTTTATTTTTCACATTAAGGGATCGAAGAAGTAGTCATTCCAAAAAAG
AAAACTTGGTAAGTATTCTATCAGTGTTCATTCAGTAAGTGGTTGAGTGCTAATTATGAG
GGAAGCGTTCAGGGGGAAGATGGGGAGTTTAAAGGAAAAAAAAGGAAGAAGGCAGAGAGT
GATCAGTGAATAAGGAATGAGATTTACTTAAAAGAACAGTTAAAAGACTTTCTGGGCCAG
CGCAGTGGCTCAAGTCTGTAATCCTAGCACTCTGGGAGGCCAAGGCGGGCAGATTGCTTG
AGGTCAGGAGTTCGAAACCAGCCTGAGCAAGAGCAAGACCCCCGTGTCTACTATAAATAG
AAAGAAATTAATTGACCAACTAATGTATATAGAAAAAATTAGCTGGGCATGGTGGCACAT
GCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGCAGGATTGCTTGAGACCAGGAGTTT
GAGGTTGCTGTGAGCTAGGCTGAGGCTGATGCCATGGCACTCACTCTATCCTGGGCAACA
AAGCAAGACTCTGTCTCAAAAAAAAAAAAAAAAAGACTTTCTGAACTGTGTGTTAACATA
ATATTAGTTAAACATGAATATCATCATTAGAATAATTTCTTAAAGGAAGTTCTCTCTCAC
ATGGTTGGGAGACCAGATAAAAATCATTTTCTTTATGATCCCTAGTGAGTTAGGGTAATA
TTAATGTGGATTGCAAAATTTAGCTTTTTTATTCACTGGATAGATCCTTGAACAAATTGC
CTTATCTCATTTATCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNGAAAAAAAAAGGTTAGGTTCTAAGAATTTCCTAGT
ATTGCCTTGGAAAACATTGGTTCCATTGTAAAAACGGTCTTTAAAGGAACAAATGCCTTA
ATGTTGAACTGGGGTAATTAATTTGCGAGGCAAGGCACTGGAGCTCCACTTAAGGTCCAA
TGTCATGCGTTAAATTGCCACTTAAAGGCTTTTGAAGGTGGAGAGATAGGTGCTGGAATA
CATATGTTGATAGGGCAGTAAATTGGATTACCTCTTTGTAGGGAAATTTGGCAGAATCAA
AATTTAAAATATACATGCTCGCTGCCTAGCCACTTTGAAGGAACACTTGCATATATACCA
AAGAGACATGGATGAGAATGTTCTTTATAACTTGGGAATAGTAACAAGCCGAAATAGCCT
AAATGCCCATTCAGAAGTGAATGGATGATAAAAAATGGTTATCACACATAAGTTAACATT
TAAAGGAATTAATTAGCTCTATATGTAATGACACGGATAGTACAGTCAAACTTATGTAAA
CATATCAGGCAGAATGACAGTATATGAGGGCTATCCGGAAAGTATCCAGCCATGTAACAT
GAAAAATATTATTGACAATGGCTGGATACTTTCCAGACAGCCCTCGTATGTGTTACACAC
ATTTTTTAGAGAAAGATGTGTGTAAAAGTACCTTAAAAAGTTCTGAAAATATAAATGCCA
TACTCATGGTAGGTAGGATCACAAGATGACACCAGACACTTTTAGCTTAACCTATAATGT
TCTGATTTATTTTTTAGAGATAATATATAATATATTTGTTGTGATTACTTTTTAAAATAA
CCCTTTTTAAAAAAGGAGCTAGTGAGTAATCCGAATGTCATAAATTTTTCACTGGTGTTT
GTCAAATATGTTAGTAAGATTTGTTAACTTGCCGAGGCTTAAATATGCTAATATAAGATC
TGGTTAGGGAATACCAAGAGATGAGAGAATGTTTATCACACATGCTGAAATTCAGTGTGA
CTTAAAATTCAATGTATCTTAACAATGGTTTGAAAAATCCAATGGATATTATACCTCAGG
GAATAAATCAGTTTTGATATAATATACGTGTTTTGTATGTTCTTTTGTCTTAGATGACTT
ATGTTCTTATGTTATACTTAGTTGAGAAAAACACTCTTGGTTTATTAAATTTACTGTAAT
TCCCTACTGGAAATGAAACACATTAAATCTAATGTGGGAGTAAAAACACATTTGAAACTG
AATTTTCTTGTTTGCCATTATTTCCAGTGAAACATTTTCTAGTAGTTCAGCGAAGGTCTC
TATCCAAAGGTGCAGTGGAAAACTGGCCTGCAATACTTATCATAAATTTATATATGGTTG
AGAGGTTTAAACCAGAGGACTGCATCAGAATCATCTGGAAGTTCAGTAAGGATGCATGTG
AACAGTCCCCTGTGGATCTTAGAAGCTCTGATGCACCAGGTCCAGAGTGTAGCCTTTCAT
TTATTCTCATATAACTGGATTAAGAGCCACCAATTTTAGAAAGTAAAGGCAAGAGTAGTC
CAGAAAGCTGTAGTAAGAATCCTTAGAAAAGTGGATATGAGAAGTGAGCAAGATAGTGGT
GTGAGGTGAGGATGGCAATCACTAGCCTTAGGTGATGGTGTTTCTGGCCTAGGGACCAGA
TCAGAAAGGGCAGACAAAGCAAAGAGAGGAACATGTACTACCTATAGGCAAAAGAACTAG
ACAGTTTTCTCATTTTTTAACTTACTCTAATGACTTTGAGACATAAGAACCGACTCTAGA
TGAAACCTGAAGTTTTGTTATTGGCTAATGCACTGAGTAAAATCATTTGTTTACTTTGTG
ACTATGAAGAGCTCTGATGAAGGTTAACTTGTCATTCTTATTCTTAGGGATAAAGTGGCT
GTTCTTCAGGCACTTGCATCCACAGTAAACAGGGTAAGTAGGATTTTTTTAAGTTTTTAA
TTTGGCTGATAACACATTTAATGTTCATACCTCTTTAATATTCAGAATCAAACTGTTGTG
GATCTAGAAATTCCCTTTAAAATTATCTAATCCAATCCCTTCATTTTGACAAATGAGGAA
TGTAAGGATTTCAAAGTGACTAGCTCAGGGCTGGTTAGGGTGTTAAAACAACTTAGTTCC
ATGTCTTACGTCTCCAAATACAGTGGCTTTATTTTTACCATACCAGTGATGCAATCTCTA
ATCACTGAAAGAGCTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCTGACCTCATATACCGGTAAGGAGAGGTAGTTGGATTTGTTT
TACTTAATACCATATACATGTAAATTAAATCCGCCTTTCATGGCTAATATTTAAGTAGCC
TTTTGAACCCTCAATATTTGGATGAACAGCCTTTCAAAGTGTGGAGTGGTCTTTGCTTAC
ACTAACCTTTTACAATGCCTTTTGACTGTCTTTGCCCTTCTGTTTATGTTTTCCATATTT
ACTTTTTGGGACACCATGTTGTTGGATCTTTATCTCTGACTATTCCTTTTTAGTTTCCTT
CACTAGCTTTCTATTCACTTAAGCATTGATATCTTTCTTAGGTTTCCATGTTCATTTTCT
CTATTTATTGTTTATATTCTTATTTCAATGACCCTTATACTCCATTTGGCATTCTTGTAT
ATCTAACTTAGATCCCTCTACTTTGAACACCCAGCTGTATTTCCAACTACTTCTTTGTTC
TGTAGTCATGCAGTGAGCACATATGCAGTGCCTGCTTTCTGGTAGGCATTGTGCTTAGTG
CTGTTAGTACAGTGGTGAGCAAAACAGATGTGCCTCTACCCTCCTGAGTTTATTAGTGGA
AATACTAACCTCATACTCACCATGTCTAAAACTATTCCCTTACCATCCTATCTCCCTTCT
TCTGAAAACTCACACCCAAATACACCCTTCTTATTCTCATGTTGCATCTCCTACTTATGG
GTTAGAAAGCCAGCTCTGTTGTATACATTAAAAAAAAAAAAACAAAAAACTAAAATCCTA
AACTAAGACAGTGGTAGTGATGGAATAATCATTTATTAGCCCACGCTTTCCCCTTTATGT
TTTTGACTAACAGTTACTTTTCTGTGCATAGCTCCAAGGTTGCTCTGCTTGAAGCCGTCC
AAGAGTCCCCAGTATCCAGTGGGCAGCACTGTTCACACTGTCTTATAATGATTTCCTTAT
CTGCTTTCTCCATTAGATTGTGAGCACCCCTAGTGTAGAGAATGCCTGTCATCTCTGTAT
CCTCTGTGCCGAGCTTAGGTGCCTGGTGTAAAGTAGTAGGCGTTCAAAAAGTATTTGAAT
GAATTAGTGAAGGAGGTAAAATACCTTGAGTAGTATTAGATGTTTAGAGGAAAAGCAGCG
TTAAGGATGAAGTATTTCTCCTTTTAGAAACTGGGTGCCCTCTGACACCTTTTGCCAAGA
TTGTATAAAGGAGGAAGAATGGTTTTAGAAGGGGAAAAAATAATAAGTTCAGCTTGAAGT
TGGGAAATTTAGTTGGAAGTAGGGATGTTCAGATATGGGTTAAATATTTATGTCGGGTGC
TTTTATATTCTTATCAAGGTAGGAGATAGTCAAATAATCTTCTTGTTTCAAAGACTGGGG
AAATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTTTAGTGAAGGTCTGGATCCAAATGAAATCATTCTACTTACGTTTGTCCAAA
TGGACCTGGGCCAAGGGAACTAAGTGGGGATATTTTACAGAGAGTTCAGTTTGACGGTGA
TAATTAAAAACCATGAGATAGTTTCTCTGAGGATATGATCACATAAATTAAGTGTTCACA
GGGTCAGACTTCATCTTGTATTTTAATCTTCTGTGTCAAACCGCACAGTTAATAGGGATT
GTGTCCCTGTGTGCATCATTCCAGGTGTTCTATGTTGATGTTGAGTACATATTCCTCAAT
TGAAAAAGTGGTAGATGATACTAAGTATGTAATCATCAAAGCCACAGATAATAGAAAAAG
CAAAGGATTTTACTCTAACAGGCTTTAGTTCTTGAGTGTTTCAAGGTTTCTTTTCTCCTT
TCACTCACCCACAGGAACCACTGTGTCTCTTGAAACAATGAATAATCTCTTGGATTTATT
GTGTTACTTTGGTGACCAAGAGCCCTCAACTAATTATCAGTTTCAGCAGACTGAACAGTC
AGAAGAATTGGTAACTACTTTTGGCATTGTTTTTTTGTTTGTTTGTTTGTTTAAGTTTCT
TTTAGAAGTAATACTTTGAAAATAAGATGGGTTCTTGTGCCATGTGTTAAGGCAGTAGTA
AGAGATTTGTACTGAGATGTAGTGTGGTATGATAGCCTTGATAAAAATTTGGTGCAGAAG
CAAGAGAAAGATTTTTTTTTGAAACAGAGTCTTGCTCTGTTGCCCTGGCTTGAGTGCTGT
GGTGTCACCCTAGCTCACAACAACTTCAAACTCCTGGGATCAAGCAATCCTTCTGCCTCA
GCCTCCCAAGTAGCTGGGACTGCTGGCATGTGCCACCATGCCTGGTTAAGTTTTTATATA
TATTTTTAGTTGTCCAGCAATTTCTTTCTGTTTTTAGTAGAGATGGGGTCTCACTCTTGC
TCAGGCTGGTCTTGAACTCCTGACCTTGAGCCATCCTCCCACCTCGGCCTCCCAGAGTGC
TAGGTTTACAGGCGTGAGCCACCATACCTGGCCAAGAGAAAGATTTTTAATAATTAAATT
AACCCTAGTTTCTTTTAGGAAATATCTTGTCTTCACCTACCTCTTATTCAGGAAATGCTT
TGATTAGAAATGTTTGAGGCTGCCTCTCTGTCACTTACAGTGACAACATGATTTGTAATG
GCCAGGGAACGACTCCATTGCCTGGGCCCCATCAAAAATTCATACATACGTAAGCAGAGA
GGAGGGAGCATGCTAGGCTGGGGGAACAGAAAAGTGTTGTGCCAGGAATCACCTATAGGT
TGAGTCATAGCCTCTCTCTCAACTGTAGAGTTTACTTCTTGAAGTAAGGTCCCAAGGAAT
CCTTTGCATCAGATGAATAGAAACAGAAAGAAGTATTTACACTTATAAATGGCAAAAATA
TTGAAAGCAGTCTAGATTTTCAATAGTAGATGATCAAATTATGGTAAAAGAGTGTCTTGT
AGCTATTGAGTGCATTAGTGTAGATGTATTTGGGTGTGCAAAGATTCAGCATATATAAGT
GGGGAAAAGATTATACATTGATAAATATTTTTTGTTGTAAAAATGTTTTCATATGCGTAA
GAAAATAACATTTTAAAAGTGTTTATCTCTAGGTAATGGGATTATTATGGGTGGTTTTTC
TTTCTATCTTTTCTAATTTTTCTCCACTAAATTTGGATTTTTTATGTATAGGAAACCTTA
AGTCTTTTAATTAAAGTGCACAGGGAGTGGTTTGCAGTCACACCTTGTTTTCCAGAGCAT
CTTCTGAAGCCCTGGTCTGGCTGACCCTCAGCCTCTCCAGCCCCAGTTCTTGAGGCAGTA
GGCTGTGGAGCCAACACTGACCTCTGCAGTGCCAACCAACCTTGTCTCTCTCTACAGCAG
CTTGGTTTATAATTAAAGGACAAGACTTAAGTCGTTTAGAAAGTTGTGGTTTGTTCCAAT
CAGTGTTAGACATTAGCTGTAGGTTATCTTCTCTTGCTTCCACCCTAATAATGAACAGTA
TTTCTTTTTGGATCAGGCCAGGTGTAGGCTTTGAAGAAGCAAGCTGTGTTTGGTTTTCCA
GTTTATATCTGTGGGCCAGGCTTTACAGGGCACTGGCTTCATCTCACCTCTAGGTTGTCA
CTATTGCTTTAAGAGCCAACTTTGCTTTTCATCTGTGACTTCACTGGTGTATACTTAAGA
AATTAAATATAAATGTGTAAGTATTTACTGGGCTTCCTCTTTGTCTTTTGATGGATGTAT
ATTTTCTTTATTTTTTTACAGAGTCTCACTTTGTTGTCCAGGCTAGAGTGAGTGCCGTGG
CGTCAGCCTAGCTCACAGCAACCTCAAACTCCTGGGCTCAAGCGATCCTCCTGCCTCAGC
CTCCCGAGTAGCTGGGACTACAGGCATGCGCCACCATGCCCGGCTAATTTTTTTATATAT
ATATCAGTTGGCCAATTAATTTCTTTCTATTTATAGTAGAGACGGGGTCTCGCTCTTGCT
CAGGCTGGTTTTGAACTCCTGACCTTGAGCAATCCGCCCGCCTCGGCCTCCCAAGAGCTA
GGATTACAGGCGTGAGCCACAGCGCCCGGCCCCTCTTTCTGTCTTTTGATGGATCTATAT
TTTCTTTATTTTTTTCTGAGTTCCCCTTACCTCTCTGATTTGGAGTAGTCTAACTGGGAG
AATGCCCCAACATGGTCTTAACTTTTATTTCTCTTCATGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CTTTGGAATATACACTGCTAATTCTGAAAGATTTGCTATTTTTGATTGTTAAACATACAC
TAGAGTGTAGTACTAAATTAAGACTACTGACCAACAGGCAGAAATATTCAGCAGTTCTCA
ATAAAAGATGAATAACATTTTAACTATATTAGGAAATTTAAATTATCTGAGTGTCTAAAA
GAAAGATATTTCACATGACTGACTAGGGATGGAAAGCTACCATTAATACCTAAAATTGTT
TTAGAAGTGATGAGTTTAATAAAATGAAAGATTAAATATCTTGGGATAGATTTTAGTAAT
TTTTCATAGTATTTAAGATCATGGACTTCAGAGTGTGATCTTGGTTCAAATCCTGATTCT
GTCTGATTTCCACAGCATATTGTTAAGGGGAGAATCGAGGTACAGGCTAGTTTGTATAAC
ATGACACCATTTAATTTTCTTTAGAAAAGGGAGAAGTAGTAAATGTACGTATGCCAGAAC
AGCAGTGGAGCTCAGGCAGTGATACGCAGCCCCATTTTCCTAATAGGCCTCAGACCAGTA
CCAGGCCACAGCCCAGGGGTTGGGAACCGCAGTACTAGAATATGGCAGAGAATTTGAAAG
AAACCAATTGTTGGTGGTTGCCTGGAGAGTTGCATCTGGGGATTTAAGAAGGGTAGAGAA
ACTTACTATGTATTCTGTCAAATGATTAGTTTTTGTTTTTTGAGACAGGGTTTCAGTCTG
TTCCCTGGGCTACTAGATAATGCAGTGGTGTCATCATAGCTCAGTGCAACCTCAAACTCC
TGGGCTGAAGCCATCTTCCTACCTCAGCCTCCTGAGTAGCTGGCACTACTGGGCGCATGT
CACCACACCCAGATAGTATTTACATTTTTTGGAGAGACAGAGTCTTACAATTGCCCAGGC
TGGTCTTGAACTCCTGGGTTCAAGTGATCCTCCTGCCTCAACATCCCAAAGTGCTATGAT
AACAGGCATGAGCTACCTCCCTGCCCTACAGTTTGCTTTTTGTTTTAATACCGTGGGTAT
TTGTTACTTGTGCATAAATGTTTCCTTTTCAATTCTGTCATATAACTGCAAAGCCCTGGT
CTTTGAAACTCAATTTTTTTTCCCATTTTCAAAATAATGATAACCATATCTCCCTTTCTG
GATAGTAAGAATTGTTTGAGATATACATAAAGTGCTTAGCACATTGTCTGGAACATTATG
TGGTGTTAGTGATTGTGGTAGCATATTATTGCTTTTTCCTGTTTCCCTGACTCAGGTTTG
CTCTCTTGTGTGAATAGCAAAAAACAATGCTGAGAGAATCTTTGCTCTGATGCCAGAGAA
AAATGCACATTCCTACTGCACGATGATCCGAGGAATGGTGAAGGTACCTTTGTTTTACTT
ATTTTTATCTTCAATTTCCACTAAGTCAGGGTTTTTCAGCCTCAGAACTGCTAACATTTT
GGGTCAGATAATTTGTTGTAGGGGGTTGTCCTCTGTATTGGAGGATCTTTAGGAGTTCCC
TGGCCTCTATCTATTGGACATGAATAGTATACTCTCCCCCACCCTCAGTGTGACAACTAA
AAATATTACCCAATGTCCCCTTAGTAGAAAACCACTGCACTAGAGTATAAGCTTCTCAAG
AAAAGGGCCTGGTCTATTTTATTTACTGCTCTATTTCCAAACCCTAGAACAGTAGTAGAT
GTGCAAATACTTGAATGAATTTGATGATGCTTAATTTTTCCTTTTCTAGCACCGAGCTTA
TGAGCAGGCGCTAAACTTGTACACTGAATTATTAAACAATAGACTCCATGGTGAGTTTGT
TTTGAGAACTCCCCTCCATCCCTCTTTCCTTTTCTTTCTTTCTCTGAATAATTTGTAAAA
TTTTTGGATCTTTCCTCAATCATTGGCCTACATTTTACCTTTTCCTGTGATGTTGGTGAT
TAAAGTAGGAGGAAAGATTCAGACAGGAGAGTTGTTTTACAGTTTTATAGAATGTGGTGA
TTAGCCAAGAGACATACAGCAATGACCACGTTGCCTTAAACTCAGCCATTTAGGGGTTAA
TCTTCACCCTTAAATTTTGTTATTTTACTCTTTTACAGCTGATGTATACACATTCAATGC
ATTAATTGAAGCAACAATATTGGGGATAGATGAGAATTTTGATGAAAAATGGAATAGTAC
ACTGGTAAGGAGAAACTCTCAGTTTATCTTTTAATAGGCCTTAAATATTCTTTACCAGAA
ATACAGTGGGGGTGGAGGAAGACAGCATTCATTGAGTATCTATCTATATGACAGTCACTG
CATAGCAATTACCTGTTAACCACCCTTTCAGCAGCCCTGTAGGTTAGGTAGCTGTGTCTG
ACACCTGAGAAGAAAAAGTTACTTGACCCAGAACATAATAGGTAGAATTCTGGAAGACTT
GGGCCACTTTATTCATGTATTTCTCATAATAGTTTTTCTGTTACAAAAGTCACACATATT
TATTGTGAAGTTCTTATGAAGTTCAAAAAATTGAAATTGCTGGATGGACTCTTGTCTAGT
AACTTAGGAATAGAAACATGTTTTATATCCTGATCTAATGTTTCGCTTGAGTCTTTTCTT
GGAAAACTCTCATAGGTAGAGGACTGAAGAAAGTTGGACACCTTCGTGAAGTCGGGTGGA
TGATTGAATTAGGGGCTTCTCTAAAGGCAGAATAACTGGTCCTGATTAATAAGTAATTCT
TAAAATAAGGATATAGTTATTAACCTGCTTTAGACATAGCAAGAAAGCTAAATTATCTTT
TTGTATGAAATATAGATTGTTGGGCAAATTATCTATCCAGGCATAAAAAATACTGCTTGC
TCTTGATTTAACTAGGAGCTACTGAAACAAATGGTTGCACAGAAGGTAAAACCAAATCTA
CAGACTTTTAATACCATTCTGAAATGTCTCCGAAAATTTTACGTACTTGCGAGAGTGCCA
GCCTTACGGACTTTACGTGAAATGAAAGCCATCGGAATAGGTGAGGGTGCATCTTGGAGT
CCTCACTGAAGACCCTTCTGACCAGACACTTCAGGGCCACATAAGCAGATGAGACGTGTA
AATTCTTTTGCTGTTTACATGTGTTAGGAATTTCCTTTCGACATTTGGCAGACTTAATTA
CATCAACTTAATTGTGGAGTGCCTTTATCATCTTCATGTTCATTACAGAAAATTAGAGTG
TTCTTTTAGTATTTTAGGTACATTTTAATGGGTCTTTTGTTATGAGAATTGATCACTTTG
AGTTACTTAGTTTTAAAGTCCTTGACACTTTTCTAGCTTTATTAGGTATTTGAACCCAAG
TGTGTGCACTTGTATGTATGTTGTGTATTTTTAGCCCATCACTACAAAAAAAAGTAGAAA
AATTAGCTGGGCATGGTGGTGCTCTCCTGTAGCCCCCCAGCTGCTTGGGAGGCTGAGGCA
GGAAGATCCCTTGAGCCCAGGAGTTTGAGGGTTGCAGTGAGCTATGATGACACTGCTACA
CTCTTGCCCTGAGAACAGAGGGAGACTGTCTCAAACAAAAAGAGAGGAAGTGAACTGTTG
TATATTTTTCATTGAAACTAGATGGTTGCTTTGGAAGTCAGTTCACTTCAATATGCTTTA
CTCTTCTCAATGAAGAATCTTATTGGCAATAAGTATTTGGACTTTCTGAAAGTGATATAA
TCTTTATGATAATTTTTCACCTTTAATTAGATGAGCTAAAAAATGTTTTATTCAAAGGAA
TAGAAATGCATCTTTTGCTTAAGTAACATTAGTAGATTTTTAATTCAGTGTGCCTCACTA
AACTGTATTTTGGATTGCTGAGTTTTTACTTTATTTCTTTTTTTTTTTGCCCCTCCCTTT
ACTTTATTTCTTATTTTTTCCATCTACCTGCTAATTTGAGAACCCTCGCTTGCAACATAC
CACCACATTATTCAGCTGTTTTATCCACATGGTATGTATGGCCTTAAATTGTATTAATTT
ATGTAGAAAATTGACCACTTCCTTGAATTTATGTGATTACTTGTTGCAAGTTACCTTCTC
TGCATATGATTTTAAAAAAGAGAATTCATAAATTAACATATACAGCCTGAGCAAAAAGCT
ATATTTGAGAGTAGTAGTCTTGTTTTTGATATAAAACTTGAGCTGGAGAGGAGGAGGTTA
TAAAATGTACTGGCAATTTTGGTGTACAAATAGGAATGGACAGAAGATATTTTACTTTGA
AGTTCCTTTTGTTCTCCAGAGCTGTGCTGTCCAGTGCAGTAGCCATTAGCCATAAGTGGC
TAATGAAATTAAGTAAAATAGGCCAGGCACGGCTCATGCCTATAATCCCAGCACTTTGGG
AGGCCAAGGTGGGAGAATGGCTTGAGCCAGGAGTTTGAGGTTACAGTGAACTATGATTGC
ACCACTGCACACTAGTCTGTGTGATAGAATGAGACTGTCTCTAAAAAAAATTAAGTAAAA
TAAAAATTTCTTTTTTTGGCATTGGTGCTTAGTAACCACATGTGGCTAGTGGCTCCTGTA
CTGAATGATCCAAATATAGGACATTTCCATCTTCTCAGAAATTTAGTGGACAGTACCACT
CCAGAGGAACGTTGAACTAATTTTGAAGCCTTTTGGGAGGACTTTGAGGCTCCATTCGTC
ACCCAACTGACATTGTAGAATGGACATTGGAACAAGGCACACCTGAGCTGAATTTCAGCT
GACATACATTTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGACTGT
AAGAACTGTGGATAGAAACTTGATTCTCTGAAGGGCTAATTTTGCAGAATCTACCTATAT
AGACAAGTTGTTTTGTTTTGTTTTGTTTTTAATTATCTTTTTAGTGAAAAAAAACAAACA
GGTGACTGATTTTATCTTGGAAACCGATAAGCAGTTTCCATGATAACTAGATCCTTTAAA
ACTTTATGAGTTTGTGGTGAAACTAGTATATTTGACCTCAAATTCTGTTCCTTTCTTCAT
ACTATCATGTATCACTTTGGTTCGGTGCCAACCAAAGTCAAAGGTACTTGTATTTCCTAA
GTAGTAGCTATGACCATGTGGACTGGGGTGGGGGGAGGAGTCTGGGTTTGTCTTACGTAT
ATAAATAAGCTGTCTGCCATAATAATTTCTAGGAATTTACCTATGGGGAGAACTTAAAAT
AACATAGAAATAACACATATAAACTAGAATATTATATAACTAATAAAATCATTAGGAAGG
TTAGCAAATGAAAACATGCTTTAGGAAATTGTAAAAATAAATCTGTGCTATCATTATGAC
TATGTTATCACTTACATGTACAAAAGGTCGGATAGGGAGTATAGATAAGTATTTGACTAG
GAATAATGTAGGTGGATTTTCTGACCTATTAGTGTTCAGCTCATGTGGTTTTTAAGAATT
GCTCCCATCAATTCTCTAGTTTCCTTTCTCTTGGCCTTCTCATTCTGATTACACTTAAAG
GAACACAAGTGATTACTAGCAGAAAACATGTTTTTTTCTCTAAGTATGATGATTTGGTGA
AGGAGGGGGTGTGTGTGTTGGTGTCTGCCTCCCACTCCAGTGAGAGTCAGGCTTGTGAAG
AAATTAAGAAGGAGGAGACTGAGCACCTGCTCAGAGACCTATGATTGTCACAGATGTAAC
AGAGAATTGCATTCTGCAGGGTGCAAGTGATTCCTTTGGCAAACATTGGCCCACTGCCTA
GCTCTATGCCAGGCCTTAGGCTGGAGATGGAAGGAGGAGAAATGTGTCCCTTTGTACTAC
GTGCTGCAAGTTTGGTGGTAGTACAGGAAGTAAGTAGATTCATGATAAAACACATATACT
TTCTTGTTCTGTAGAAAACCTTTCAAAAGGATCATCCCTGATCATCTATGATATAATGAA
TGAATTAATGGGAAAGCAATTTTCTCCAAAGGACTTGGATGATGGTATGTTCAGAAATTG
TTTGTGTTTTCCTCCTCTAAAGACAGCTGGTTTCCCTGAGTACCAGTTATTTAGAGACCT
TGTGATGAGGGCAGGGTTTCCTTTTAGCTTAGTAATATTTGGGGTGATCATTCTGAGAAA
GCCAAAATGTCTTTCACATTGGTGTATACTTCCTCTGTTGAATGTTAATTCCTTTAGCTT
TATCTTACACCTTAGCAGTTTTGTTGGAAAGATTTTTATTAATGTTACTGACTAGAAAAT
ATATTTTATCCATAGTAACCAAAAGTCTTGTGAACTTTGATTTTCAGATTTGTTTTTTCA
GTCAGCCATGAAAGTTGTAAGTACCATCTCTTACTTAACTTCGTTTTCCGTTTTTAGAAG
AAGCTTACTATCCATTTCCTAAATTCATCTGTAATTGGAGAGTTCTCCCTCGTTCTTTCA
CTTCTTCTTAGTGTTCTGTTCATGTCTTTGAACAGAAGACATGTTTTTCATCTTTCCCTA
AAATCTATACTTTTTAATCATATAACATTCCTGCCCTGTGTTTACTGTATATGTTGCCTT
TTTTCATGCCTCTGTTGAAATAAGCTTTTGGAGTGTTTCACATTAGAAATTTTTAAAATT
AATAGTGGTTTTTATTTCAGTTTTTTGTTTTATGCTCATTGTAGGAAAAATTTCAAGCAA
TTTTAAGGTGAAAAAGTCCATCCTACACCCAGGTTTTTTTCTCTGGCTTCTCAAATGTGT
GTATACCCAGACACACTTCCATGGTGTTTTATTTGTTGATAGCAACCAGTATTTCACAGG
AGGAAGAAACTATAACTTAACTCTTCTGTGAGTGGTTTTTAGTTACTTTATGGAGTTTTT
GCTAGTATAGTGGTGGTAGACTGAGCATTGTGTGTGTCTGTTGTGCACTTGACCAGGTGT
TTTTGTACAATTACTTTCAAAAGGTACAATTGCTAAATCAAAATCATTTCGTTAAAAATT
TCAGAAAACCTGGTGTTTGTTGCCCCCCACCACCAATTTCTTATAACTTATTTGCTGTCA
ACCAGTAGTAAATTAAGTCAGCATTTTCACAAGGAACTTTATGTCTTTTCTTTATGTAAT
GAACAGCTGTTTGGCTGATAAGGATATCACTGTGATACTTAATGCTTGCAAATTTTCAGT
GCTCATCTCTCAGAGATCTAGACCTTGCTTACCAAGTACATGGCCTTTTAAATACTGGAG
ACAACTGGAAATTGATTCGACCTGATCATCGTCGTAATTTCTATTAGTAAGTGTGTTGGA
AATGTATCCTTTCGCATTAATTAGTAGAGTCTACTAGTGGGAGGCTGTTGGTGGCCCTTC
ATGTCTCACGTCTGGATTCAGGCAGCATGCCCATGATTTAATAGTTAACAGGTTAATTGA
GCACTTAGAAATTAAAGCAGTGGTAAAACTGCCAGATTTGGAAGTCTAGTTTGTATCCTT
TAAGATATTTTTCTTTGTAACACTTTAAAAATGCACATATCTTTTTCCTTTAAGCCCCTC
TTATATTTTCAAATGGTTATAGCAGGGTGAGTCCCTAAAGATTTCATCCCAGTCCCTTGC
TTTTATATTCAAAGATCAAAATACTAGAACCTAGAGAGATTCCCTTAATGGGTTTGCTTT
TAGGCAGATATAAACATGAACTTAAGGAGGTAGTCTGTTAATAGGTGTGTGAGGATTGCT
TTCTGTCTTTCCAAATCTTTGGTTCACATTGAATGTTTTTTAAATGAATACGGTATTCAG
TATCTGCTCACCATGACCTAGGAGTGTACTGAGGAGGCAGTCATAATTGACCAGTTGCGA
GATAAAATGGTGTTAATTGGGAATTTGAACACAAGTTAGCAACTTCTGGTTTGAGCACTG
GCCCATGAAACTGGAATCGTTTGTAAATATTTTAAATTTCTTTGTAACATATAACACTGC
TGCAATTTCACTAATTATTTCTCCTCTTATTATACCTAGAGATTTTAGACTAACTGTACT
TTTTCTCTCCATGACAGCTGTAAGTTCTTCACTTTAATTTGTCTAATGGAACAAATTGAT
GTCACCTTGAAGTGGTATAAGGACCTGATACCTTCAGTAAGATGGTTCATTACTTGTCAT
GTATCATTGTAGATGAATTTGTGGGTATCTTTGCTGGTTAATGCTTTAAAATGTATTTCT
CTTAATCAGGCCTTCTTTCCCCACTCCCAAACATTGATAGATCTTCTCCAAGCATTGGAT
GTGGCCAATCGGCTAGAAATGATTCCCCAAATTTGGAAAGGTTAGATTGTTTCTTTTTCT
CTTTTTTGCTTCCATTGTGCAACAGACTAGGGCACAGAGTCCAGGCAATGGTTCAGGGTC
AGAGTTTGCTGAGGATGGGCCTGTCATAAATCCAGATTCATGCATTGCAGAATCTAAATC
TGAATTAAGGTCTTATACCTCAAAGCCTGCACTGTTCCTCTATGCCAGTGTTGCATCACT
TTGCTAAGCATAGTCAGTGATGATTATCTTTCTGAAAAACCGTCATGATCATGGCCATGT
GTGGGTCTGTCTTACATGTATAAATTGGCTGCAAAATGAAACAGATATTCTGTATCTCTT
CCACTAGGTGACTATGGTATTATCATAAAGTTAGTTTTTATCTGCCTCAGTTTCCATGTC
TGAGAAACCGAGGCAATAGTTCTGCCCTACTACTTCACAAGACTGCTCTAATGGCTGTTT
AAAAAAACATTGAAGGCTGGGCACCATGGCTCACCCCATCCTAGCACTTGGGGAGACTGA
GCTGGGACGATTACTTGAGACCAGGAGTTTGAGACCACCCTGGGCCATAGCAAGACCCTA
TCTCTACAAAAAGCCAGGTATGGTGGCACGCCCTATAGTCCTAGCTACTAGGGAGGCTGA
GACAAGAGGATCACCTGAGTCCCAGGAGTTTGAGGTTGCAGTGAGCTGTGATTACACCAC
TGCACTCTAGCCCAAGCAACAGAGCAAGACCCTGTTTCAAAAAAACAATCATAACCACAT
TGAAAACTTCCAAGTACTTTAAAACAGCATGTAACCATATGGAACAGTGTTTAATACTTG
ACTAGGAACCACTTACTGGCATTGGCTTTCACTACTCTTACTGTTCTTACTCTGAATCAT
CCTGCTAGTTTTCTGGAATTGTGGATAAACCTGGAATAAATAATTTCAGCAACTTATTTT
TTACCCACCAAAAAATAAGGTTGACAGCTGACATTGGACAAAAGCCAGCCAAAAAGAGTA
TTGGTATTACATGATAATGATCACTCCTGTATTCCTTTTTGTTTCAAGATAGTAAAGAAT
ATGGTCATACTTTTCGCAGTGAACTGAGGGAAGAGATCTTAATTCTCATGGCAAGGGATA
AACACCCACCAGAGGTAGGTCTGTATTGAAACTGAAGTTTTGTTATCGATATTAGATATA
TGCTAATCCATATATCCTCTAATACTGAGGTGTCTTAAGATTAGTTTCCTGTGTTTCATC
TATCACTGTGGAGAGTTCTGCCACCCAAAACCAGATTTAAGTTATGAAACATCTAAACAT
ATCTTGCTGTTAGCAGAATACCATTCCTAAAGTCACCCTCATTCCTGTAGTCCAAAGCAA
GGAACACGAAATTAGCTTCTGTCTTCAGCTTGCTTTCATAAACAATTTCCAGCTCAAAAG
AAAACCCACAGTTGAATTTGAGAGATGTGGCTAATCAAATTATTTATCCCAGGAAAGGGT
CCTTTTTTCTTTTTACCGTGTTACCTGTATGCTATACATGTGATATATTCAAATGGTAAA
ATAGATGGCTCAAAAATTTTAATGGTCTTATGGTAGGTAGTCTCCTGAACTGAAATTCTC
ATTATGCCAATTAGGCAGTTTTACTGACTCTCAAACCTTCTCAGCTTCAGGTGGAGTTTG
CTGACTGTGCTGCTGATATCAAATCCACATATGAAATTCAAGATGCCAGACAGACTGCCC
TGGATTGGCCAGCCATCCCTCTCAACTGTATAGCTATCCTCTTTTTAAGAGCTGGGAGAA
CTCAGGAAGCCTGGTGAGTACCATACCAGAAGTGTAAATTAGAAGTATTTGTACTTGGAT
CTAAAACATTTATGCAGGTCAGTAGAGGCTTTCTAATTTGGCTATAATGACATGTAGTTA
GTTTATCGGGAGTCAAACTAGAATATGTAACAGATATTTGATGGGAAATGCTAAAAAGCA
AACTTTTAGAAGAAGACCAATATGCATAACGTACTTGAGAGGTGTGGTTCCAATGAGCTG
AGAATTCTCTTTCCATTTCTGGCCATTCTGCTTCCTGTGGGCAGTTAAGTCACTTAACCT
CATTTGTCCACTTACATGGAACAATGTGATAAAAAAAACATTTTGAAATGTTTTGGTCTT
TTGGGTTATTGAATCATCATTTTTGGGTGCTCCTCCTACCCCACCCCCTCAGCTTAAAAT
GTGGGCTCTGTACTTGGCCTTCTGGAAGCCGGCATTTAAGTGCATTTATTAAACACGGCC
TTGACTAGCCCCCATCTTTGATTTGTGCCACTATATCCTGCTTGTTTTTGTCAGCACTTT
TTTCACATGCTACTTTGTAGTGTTTTAGAATGAAGATCTTATGCATATTGATGTTTCCAG
ACGTCAACAATAGGATACCTTGTAGGGGTAGTCACAGGTGGTTCTGCTGTATTCTGTGTT
ATATATGTGTGGGCTGAGTCAGTAAGTTGGGGGTACTTGTGCATGGCTCCTTGTATGAGA
AACTATATGTGGCTATTAACTATTTCAAACAAAAGATGAAGGCTTTATGCCTTAGCTTGT
CTTACAGGTGTGGCTTACACAACATGAACTGTTAAGAACTGTGCTGCTGTTGGTGACAGA
AACATTTGACATTTGCCCTTATTAGCTTAGTTAAGCAAAGTGTATGTTAGTTGGCACACA
CTTCCTATAATCAGGCTGTGATGATTGGCGCAGGGGTACGGACCTCAGCTGAGTCATGGG
AGCTGAATGTATGTGTTTCTCCTTTGTCCTGCATGTGGCAGGCTGATGGTGAGCACTTAC
ATGAGACTGTTGCCTCAATCTGAGCCTGCTCGTCATAACGTAATTATGAGAGGGAAACGG
ACTATGCTCTGTTCCATGCCTCTCCCAGCTGTGCATAGGATATATTCCCTCCTCGGGAGG
ACAGAGGTGATCCTTTCTAAGAGGACAAATACAGGTTTGAGTATCCCTAGTCCAGAAATC
TGGAATTGTGAAATTTTGAGCATCATGTTAATATTTAAAAAGTTTCAGGTTTGGGAGCAT
TTCAGATTAGAGATACTCAGCCAGTACCAGTAATTCTCAACATTGGCAGCATATCAGATT
TACCTGTGAAACTTGTAATATAGATATATGGAGTTTGTGGAGGGTGATTTAAAGCACCTG
AGGTGATTCTCATGTACACAGTTGGGAGCCAATGAGGCCACAGATGTGTGTCTTCAGTAG
CTTACAGGGCTAGGACAGCTAGTTACCTGATTGCTTTGTTTTTCTGTTAGTATTCATAAT
CTTTCTCCTGTCTCATCTTCAACAGGAAAATGTTGGGGCTTTTCAGAAAGCATAATAAGA
TCCCTAGGTAAGTTGAAATTAACAAACTCCCCCCTGCCCCAGTGCAGCCTGGAAGTAGCT
GCCACGTGTTTGACTCATTGTGGGTGATTAGAATTTCTTCACATACTTCAGCTACCGGGT
TTGGGCACTTTTGTTTGTTAGGCAAACAAACTGTCGGTCTCCCCTACCATCCAGGGCATC
CTGAGGTAAGCACTGTTTTTTATCAGTGCTCAATTATCAACACATAGGAGATATGTTGAG
TAGATCCTCAGTGAAGTCGTACTGAATGAATGTTCATAATCTCTTTGGCCCTTTAAAGTT
AGACTTCATGTCTAACTTCATGCCTCCAAAGCTACCATGGGGAATTTTATTAATGAACTT
ATATTGGATCTTGCCTTTAAATCTTTGACTGAAGAGGTTTCGGGGCTTAGTTGGAGAATG
TTCACATTTTGCCCTTCTTTTACAGAAATGAATTGCTGAATGAGTGTATGGACAGTGCAA
AAGTGTCCAACAATCCTGCGCAGGCTATTGAGGTGGTAAAGCTGGCAAGTGCTTTCAGCT
TACCGGTTTGTGAGGGCCTCACCCAGAGAGTAATGACTGACTTTGCTATCAACCAGGAAC
AAAAGTAAGTGGGTCTTTGTGTCTTCACCATAAGGGAAAGGTCATAAAATAGTGCAGACC
ATTTGTCCATCTGCCCATTCATATGTTTATAGCCCATATTTCCTAACAAAAAGTCAGAAT
GTAGTAGTTGAATGATGATTTCATTTGTCGTACAAGTCAGGGAAGCCGATTTGGCTGTTA
GAACCTTTTCCTTTGTTGTTGTTGTTGGTTTTTTATTTGAGACAGTCTCACTCTGTCACC
GTGGCTAGAATACAGTGGCATCCTCATAGCTTACTGCAACCTCAAACTCCTGGGCTGAAG
GAATCCTCCTGTCTCAGCTTTCCAAGTAGCTGGGACTACAGGCACATGCCATGACACCTG
GCTGATTTTTCTATTTTTAATAGAGATGGGGTTTTACTCTTGCTCAGGCTGGTCTTGAAA
CTCCTGAGCTCAAGGCATCCTCCTGCCTCAGCCTCCCAGAGTGCTAGGATTATAGGCATG
AGCTATTATTACACCTGGGCTTCCTTTGTCCTTGATACAGTTTCATGCTGCTGCAGGGTC
CCTTTTTCTATCTCAAAATGGATAGATTAGAGGGGAGTGTCATATACCAAGAACCCCAGC
TCCCGAATAATTTTCAGTGTAACCCTCCCGTTTCTTTTCCTTACAGGGAAGCCCTGGGCA
ACCTGACTGCATTGACCAGCGACAGCGATAGTGACAGTGACAGCGACAGTGACATCGATG
AAGGCAAATGAAAGTGGGAAATTCAAGAATGGTAATAGGCTCACCATAGCTGCTGGAATC
ACCTCAAGAACTGAGATGTTAATATTGTTACTATGAAGTACACAGTTAATACAACACTAG
TTTATTTAGAGTAAGCTCCTAACTTGCTACTTGCTAAACCATCTATTAACTGTAACATTC
AAGGCTTACCATTTAAGCAACAGCACTGCCCTTTTCATTTCTCAGACACATAGGTCTGTA
GCTCTTGTGGTCAGGAAGAGCTCTGTATACCTCAGGTGGTGTTGGGTGACCTCACTGCCA
TTATCAGCATGCAGTTGCCCTCTCCCTGCTGCTGAACTAAGATTTTGTTGGCCTGATGTG
CTGCTACGTTGGTGGTCCTTCCTTCATCTGAAGAGATAGTCTCTAATTATAATTACATCA
CAATTGCTATTGGGTCAATAGTATCCAATTTTTGGGATATTTATATGTGAAATTATGCAT
CTTAGAATTGATTAAACAGGAAAATGGCAGTTAGGCTGCGCAACTCATAAAATGAAGACT
GTAAATAAAATTTGTAGTTAATGTACATGTGTGTTATTTCCATTACTTGAATATAGCCTT
AGTGTTTAGAACACTGCTCCCTCTTTTGTCTGTATGCCAGCCCCTTCTTTAGTGGTCAAA
ATGAGGGCTAGTGATGACAAAACCATATGGACAGCCTGGACATCGTGTATTGCTGGGCAT
CAAGTTGGTCAAGAACTTCTACGTTTAGCATGTCTCTTACTACCAAATAGTAGTACTAAA
TAGTGCTGGAAGCCAGTAAGAACTTTTGAGGTCTACAGGGGCATCCCCACCTTCATAAGG
GTTTCCCCCCACAGACTACTCTGCACATACTTGACTCCCAGATTTACTTAGGCACCCTGT
GAGTTCTCCAAATGAGCAATTTCATCTTTACCCTGCCAGAGTTGACATTTATGAGATGCT
GTAGTAACTGATACTTGTTAATGTGTGTTCCCATCTGTGTTTACCATTGTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1104, 3405..3457, 3571..3607, 6527..6572, 7677..7745, 8566..8658, 8662..8673, 11105..11228, 12734..12849, 15199..15260, 16695..16782, 17149..17209, 17498..17583, 18255..18399, 19300..19350, 21314..21407, 21618..21621, 21712..21735, 22559..22665, 23417..23495, 23589..23679, 24708..24793, 25304..25452, 26965..27006, 27445..27603, 28246..28330
1001..1104, 3405..3457, 3571..3607, 6527..6572, 7677..7745, 8566..8658, 8662..8673, 11105..11228, 12734..12849, 15199..15260, 16695..16782, 17149..17209, 17498..17583, 18255..18399, 19300..19350, 21314..21407, 21618..21621, 21712..21735, 22559..22665, 23417..23495, 23589..23679, 24708..24793, 25304..25452, 26965..27006, 27445..27603, 28246..28327
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved