Microcebus_murinus Locus C6orf48
snOPY snoRNA Orthological Gene Database
Microcebus_murinus C6orf48
Microcebus_murinus
C6orf48
GeneScaffold_4633
SNORD48, SNORD52
1373..1434, 2362..2429
2910
GGCGGAGGTGGGCGGATTGCTCCAAGTCAGGAGTTCGAAACCAGCCTGAGCAAGAGCGA
CACCCTGTCTCTACTAAAAATAAAAAGAAATTAATTGACCAACTAAAACTATATATAGAA
AAAATTAGCTGGGCATGGTGGCGCATGCCTGTAGTCCCAGCTACTCCGGAGGCTGAGGCG
CGGGCGCGGGCGCGGGCGGGGGCGCGCAGGGTCCTGGGAAGGGGCGCCCAGCTCGCGCCG
GTCGGCCGGCGCTGGGGCCTTTCTCCCGCCGGCCCTGCCATATTAGCATGTTTTTTGTGT
TTCAAATTCACAAAACAGTTCCAAATATTTGTGCAGAGGAGGGTGAAACATACTTTCGCG
GCCCTCTTTTCACTTTGTTTTGTTTCTATTCGACAAACGATGGGAAAATTGCCACGCGTG
GAGCCAGGCAGGGAGAAGAAAATCCGTCCGTCAGGCCCCGCCGGGCGGGGGCCATTAAAA
AAGTCCGCCCCTGCGGGGGGCCGTTTTCTTTTCCGGCGGGGCCGGCCCTCTCTGTCCCTC
TGTGTCTCTCTCCCTCTCCCGCGCGCCCGCGCCGCCCTCTCTGTCTCCTGTCTCTCTCCT
CTCCGCGCGCCGCCCTCTCTGTCCTCTGTCTCTCTCCTCTCCGCGCGCCGCCCTCTCTGT
CTCCTGTCTCTCTCCTCTCCGCGCGCCGCCCTCTCTGTCTCCTGTCTCTCTCCTCTCCGC
GCGCCGCCCTCTCTGTCCTCTGTGTCTCTCTCCTCTCCGCGCGCCGCCCTCTCTGTCTCC
TGTCTCTCTCCTCTCCGCGCGCCGCCCTCTTGTCTTCTCTCTCCTCTCCGCGCGCCGCCC
TCCCTGTCTCCTCTCTCCTCTCCGCGCGCCGCCCTCCCTGTCTCCTCTCTCCTCTCCGCG
CGCCGCCCTCTTGTCTTCTCTCTCCTCTCCGCGCGCCGCCCTCTCTGTCTCCTGTCTGTC
TGTCTCTCCTCTCCGCGCCGGGCTGGCCGGCCGCTGGCAGCATGCGGTCGCGGGTGTCTT
CCTGGCGCCGGCAGTGGAGCCTGCTGCTGAGCCGAGGGGAGCGGCAGGCGCCTGCGGCCC
GCGCCGCCTTTGCACAGCAGTCCGTGCACGGGCACTTCCGAGCCCGGCTGGGGGACGGGT
CGGCAGGCCTCGGCTTATCTGTATGAACAACCGTTGCAAAGTAGTTCGTGATGTCTGCCT
GACGCCACTGCTTGGAACTGACGTAGGTCAGGTCGGGGAACTCAGCTGGAGTCGCTCCGA
CCTCTGCTGACTCATTGGTTTCTTCCCAAGCTTCCTATCCTCGCAGCACCATAATGGTGA
GTGGTTGTCTGTGATTGTGAGATGGACTGGCGTTCGACCTGGGGGAGGATGGGGGTGATG
ACGACTTCAGGTGACTGAGTGTCTCGCTGATGCCAACCACCGCAGCGCGCTGACCGCCCC
CCCCCAGGGCCAGGATCCTTAGATCTGGGCTTGGAAGAGGGGTCGATAGTCAGGAACCCT
TGTTAAAATTAAGCTTCTGTGCCTCATTTCCCCATTAGGAGTTTTAAGACGTCCATCGGC
GTGTTGTCCTTGAATAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
GCTCCCTGACTGCCTCTCGCCTATTTTTATTCTCCAAGTTATTCATGGGCATTATGGAGG
TCTGCCTTATTTTCTAATGAACACGTGCAGCAGTGAAAATATTTCACCTGGTGATTTTCT
AAAGACTGCTTTTTTCCCCTTTTGAGACTGTGTAGTTTTGTGGTCTAGGCTGGAGGCTGT
GTCAGGGTCACAGCTGACTGCAGTCTCCAACGCCCAGGCTCAAGCAATTCTGCCTCAGTT
TAGCCTTCCCATTAAAGAGTCCGGATCTCCCTGTATATCCCAGGCTGGTTTTGAGCTCCT
GGCATCAAGTAATCATCCTGCCTTAGCTTCCCAAAGTGCTAGGATTATGGGTGTGAACCA
CTGTGCCAGTCTTAAAAAACATTTTTTTGGTTTACATTTCGCTTGTGACTATTGTATTTT
AACATGTTGTGCATCTTTCCCCCATATTTCTACTGTAAACCTGGAGGTACACTAGTACCT
CCCAGTGGAGCTCATCTGCAGTTTTGAATTATTGCCTACTCCTCTGAAACTTCCATCCCT
GGACTCATTTGTTAGATCTTTATATACTGGAACAGTTTTTTTTTTCTTTCTTTTTCTCTC
ATCCCACCCCCCCTGGAACTGTTGTCTTGAGTGTACTGCGTCCCTTCTGAATGGCTTCCC
TTGATCCAGGTCTCCCTAAATTGGGAATGATGATTTCACAGACTAGAGTCTCTGACACAT
GGTCATGATGTCAAAACTAAGTTCTGACTCATTTAGGGAACTGGATACTTGGGTCCCTGA
GAGGATCCAAAGGGAGGGCTGTTAACTCTCTGCTTATTCTCATTGGTGGTTCCATTTCTG
TCTTTCTAGAATGAGAGTCTGGAAGCCCATCTGGGGCAGTGCCCATTCACAGATTCTACA
CTTACCTGTTGGCTAAAGACCTAAAGTTTGGAGCCTACTGCTTTGGGGACTTGGCTTTGG
GAAGGCTGTGATGCCTAGATGATGGTTCCTAATTCCTGACCTGCAGGCTGTGCCGAGTGG
AGAGCCACGCCCTTTCCCCCTGTTTGCTGTGGTGAGTGTCCTATTATTGGTTTCCAGCCC
CAGAGTAGTAATGATGACCTGGTTGGACTAGAGTCTCTGAGCTTGTCTCTGAGGATCTCT
GAAACCATCTGATCCACTCTTCACCTCCCCTTCATCCTGTCCGGCACCCCTTCTACCTGT
CATCTTCATATACTGCCAATTGCTTACATGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1006, 1015..1025, 1039..1108, 1111..1179, 1184..1195, 1207..1233, 1235..1273, 1287..1290, 1312..1313, 2530..2533, 2535..2554, 2557..2571, 2573..2639, 2641..2657
1001..1006, 1015..1025, 1039..1108, 1111..1179, 1184..1195, 1207..1233, 1235..1273, 1287..1290, 1312..1313, 2530..2533, 2535..2554, 2557..2571, 2573..2639, 2641..2654
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved