Microcebus_murinus Locus RPS12
snOPY snoRNA Orthological Gene Database
Microcebus_murinus RPS12
Microcebus_murinus
RPS12
GeneScaffold_1190
SNORD101, SNORD100, SNORA33
1509..1581, 2716..2791, 3128..3257
4441
ATTTTTCATTTCTGTAGTCCCAGACCCTATCCCTGTGTCAGGCACGTGTTAAGTGTTTA
AAATGCACCTAAAAAAATCCTCATTTGCGCGGGACTACGAATCTCGGGCACAATCAAGTA
TTCAACACAAAACAAGAACAAAAATAGTTCGTTTAGAACGTACTCCCCGACTATATGTAG
AAACCAGAACCGACCGTACGCTGGAGGGTCCACTTTACCAACACAGGCTAGGAGAGTGGG
ATTTGGGAAGTGCTTGGAAATAGTGAAAACGTGTTGGCTCTCCTCTTAGGAAAAAAAGAT
GAGATCACCCACACAACGACACATTCACGGACACTCCAAGTGACTTAGAAGCGAAGGAAC
AAAGTGTGCTTCTCAGGAAGGTTCAATCTAGTGGAGTCGAATGCAAATCACCACGTGGGT
TAAATAAACTAGCGTGCTGAAGGAGCTAGGGCTTCGGGACTTAGGAGACCACGCGGACAC
CCAAATTTGCCCCTCTCGCGCTCCGTAGAAAGAGCTTTCTGGGCCTCCACAGGCCACGCC
CCCGGCAAGGAAGGAGGACACGAGGCTGCCCGCGTGATGCCTGTTGCGCACGCCAAGGAC
TGGAGGAGCGCAGAGACAGAAGATTGGTAGTCATCTTGCCTCAGAACTGCCTCAAGCCGG
AAACAGAAACTCCGAAGCCCGGCACGGCGAGAGCCACCTCTTTCGAGGGAAGGAGTGCAC
ATGCGCACAGGGGGCCTAAAAGCCCTTAAATACCGTCATGCGGGCTCTTGCGGCCTCTTT
CCCTGCCGCCGCCGAGTCGTGCGGAGGCGGAGGCTTGGGGTGAGTTGGACGATTTTGCGG
GGAGTCTATTGGTGGTGGTTCGTGGCTCGGCGTGCCCTGGCCGGGATTGTTGGTGGGTAT
CTGAGTCAAAGCTGAGTTACTTGATAAGTTATTGTTTTTTTTTATTTTTCGCCTTTTTTT
CCAGTGCTTCCAAGATTCGGCTTCACCCGTAACCCACCGCCATGGCCGAGGAAGGGTGAG
CCCAAGGGCTGGGGTTGGCGTGCAGTGAGGCGTGGGCCGAGTCGCCGTAGGCGCGCCGGC
CGTACGTCGCCTCTGCCTCTGCAGAAGCTAAGGCGTTAAATGGTGCGAGGATTTTAACCG
GTCGTTCTGATTTGTCGCGTTTCAGCATGCTGCTGAGTGTAATGACGTTACACTGCTTAC
AGAGTGCTGAAGACGCCCTCATCACGATGCTGCACGTGAATTCGCGAAGCTGCCAAAGCC
TTAGACAAGTACGTGTATCAGTCTCAATACTGTGGGTTGTTGCAACCGGAGCAAAACTGC
AACCGAGGGAAGAAAGCGTGAAGTTCATGGTGTTAGCACAAAAGTTCTGAGTGGCATCCG
TATCCGTCCTACAGGAAACCTAGGAAAAGGTATCGGAACTCAGATCTATATAGCCCACTT
AAAATGTGTGGTTTGTCGTTTGGAGTGGGGATAAGCGCTTCGTTTTTAGCCAAAGTTAAA
AACTACAGTGTTTGAATGATGACTTAAATTGTCGGATACCCCTTCACTCCCCTTATGAGT
GAAACATAACAGTCTGACAAACCTGTAGGTTGTGGGGTTAGTTTTACATTTTTTGGAGCA
TAATTGGGGAACCTCGTTTAATTTAGTAAGTTTGCAAAATATTTGGTTAAACTAAAGGAG
TTTTGTGCTGATATTTGTTGTAGAAGCATTTGGTCCTAGATGAATTCAGTAAGTATAGTA
GCTGTGAAAATTTGTTTGAATCTAGAATACTTGTAAAAATATTTGGGTTAGGCTGGTTCG
AATACTGTTTAGGCTGACTACATTGGCAAACCAACTTTATATTTGAGCTGAGTTTAAATG
CATTTTAAGGGTTTTCACCAGTTGCTTTGGTACAGGGTAGCCAGTTGTATCTCGTGGAAA
CAATACTTTAGTTTGATGTAGTAGGTCTTGGTGTGAATATTGTGTAGTATTTACAACTTG
GCGGTGCTGCACAGTATTCAATGTTTGGATCAGTAACATCACAGCTCTTGGTAGTTGATA
TAACAGGTCCCTTATGGGATATGAGACTGGTTTATTACCGTGGTTTTGTTTTGGCCACAA
GTTTTTAAACTAACTTCCTCTACAAACCTGGTATATTGGGGGAAATCTTACTGAAGATTT
AGTGTTTCTGTAGATAAAACAAGTGAAGTGACTAATATTTATGCTGTAACAGATTGATCA
GGCTTAAGCAGTTGTGTATAAGATTTTTGATGTATTCTCCAATAAGTTGCAAGAGTGATG
GATTTAGAACTGGATTTTAACTTCATTTTAATTACATTTTGAATTTCAGGCGCCAAGCCC
ATCTTTGTGTGCTTGCATCCAACTGTGATGAGCCCATGTATGTCAAGTTGGTGGAGGCCC
TTTGTGCTGAACATCAAATCAATCTAATTAAGGTAAGTTACTAATCTAATTTGATGTGTC
CTGGACTGTTAGTAGATGCTTTAGTGTTGTGAGAATTGGACTGGTTAAGGGTTGTAATGA
TACTTCATACCAGTGTAAGTTCTGCCAATTCTCACGCTATTACTTTATGCAGATGTGAAC
GTATAATCAATTTCACTTGTGGATCATGTTAAGGCTAATTGTAGAAGCATTTTATACCTG
CAGAACTAAATGCTTATTTGAGTGTTGATAATAGTCAAAAGTGAGGGTAGAGTGTGTGTC
TACGTGATGTTTTGGTGCTGTACATGATGACAACTGGCTCCCTCTACTGAACTGCTGTGA
GGAAAATGCCATGTCACCCTTCTGACTACAGCCACCTTTTGGGTTTAATTATTGTCAGTA
GCATAAATAAATGCCTACTAATGTGATTTTTTTTTTCTAATTCTCCCAATAGGTTGATGA
CAACAAGAAACTAGGGGAATGGGTAGGCCTTTGTAAAATTGACAGAGAAGGGAAACCCCG
TAAGGTGGTTGGTTGCAGTTGTGTAGTAGTTAAGGTAAGTAACTTTATCTTTGGGGTGAA
GCTTGTGCTGGGTAACTGCACAACCCTGTATTGTAATAAGTTTGAGGACCTTTTAAAGGA
AAAAATAATCTCAAAGGGTTTAAAAATACTTCCTGTATTTTACAAAAGATTCATAGCTAA
TGATTTAGAAGCCAGTCAATTAATCTGCTTACCTGAATGTGTTTTTGCAGAAATTTTAAC
AAAGCTGGCAATAGTAAAGCCATGGTACGAGCCTTACGGACATTGAAGTCGTTAAGGTCC
CTAAAAATGGCTATAACAGATTTAATGATGGGACACATTTTCATAAGACAAAGTTATTAT
AGGGTCCACTGTGAGTAGTGCTATGAACTTAGTGAAATTTATAAATGTTAATAAGAGATT
GCATGTAATTTTTTTAAAGGACTATGGCAAAGAATCTCAGGCCAAGGATGTCATCGAAGA
GTACTTCAAATGCAAGAAGTGAACAAATAAAAACTTTGGCTCATGTTTCTTATCTCTGAC
TTTTTATTTGCAGTAGTAATGTGTTAGTGAAGGGAAAGGTAATTGTAAAATGATTAGTAC
AGATTAAGTGGGAACATTCTATAAGAAACAAATGCCTATTTGACCCTTCTGAATGAAAGA
AAGGCTGATCAGTGACTGTTGGGGCAATTAAAACATGGACAGCCTAAGCAAAGATAGACC
TGCTGTGTGAGGTACCTGGTAACAGCCAGATGTACTTGGATATGGGCATTTATCACTCAC
TAGACCAGGCATCCTCAAACTACGGCCCGCAGGCCACATGCAGGTGTTTTGGCCCGTTTT
TTTTAGTGTGCATAGGAATTTGTTCATAGTTTTTTTTAAACTATAGTCTGGTCCTCCAAC
TGCCTGAGGGACAATGAACTGGCCCCCTGTTTAAAGCGTTTGAGGACCCCTGCACTAGAC
CAACCTAGAGCCTGGGGAAAGGCTGAAGTTAGGTAAGTGGGTGTTAATAGATTATAATCC
TATGTTGGGACAGTGAGCAGCAGTTGGGAAGGTACAAAGGTGGGCAGGATCAAATTTAGG
CTGTGGGATATTAGCAGTGCATGGTATCCAGGAATGCTTTTGGATGTTCCTATAGGGAGG
GTCATTACCACCATAGATTTCACTGACATCAGTATTTTGCAGAGAAGCAAGTGATGTTTT
GATGGCATACCCAGTCCTAGGAACCGTTCCACAGGGAGAGAAATGGTACCCANNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1014, 1165..1165, 1168..1173, 1178..1183, 1186..1188, 1191..1211, 1214..1222, 1225..1236, 1239..1267, 2329..2431, 2872..2973, 3379..3441
1001..1014, 1165..1165, 1168..1173, 1178..1183, 1186..1188, 1191..1211, 1214..1222, 1225..1236, 1239..1267, 2329..2431, 2872..2973, 3379..3438
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved