Microcebus_murinus Locus C14orf45
snOPY snoRNA Orthological Gene Database
Microcebus_murinus C14orf45
Microcebus_murinus
C14orf45
GeneScaffold_1428
SNORA16
3922..4056
15363
CCCAGAGTGCTGGGATTACAGGTGTGAGCCACTGCACCTGGCCTTGTTTCTCCCTTTAG
AGGTCTTCCTGAAAGTATTATACACATTTCCACTTCCATCTTATTAACCAGAAAACAGCT
ATGCTGAACTTCATGGGAGGCTGGGAATTTTTAGCTGGGCTTACTGCCTTTCTGAATAAA
ACTGGGGTTTTATTACAAAAAAGGAAAGGGAAAATGGGTATTGGGATAGGGAACTAGGAC
ACTGCCACAGTTTCCCGTATATAGTTGTTAATGTTTTACTGATTTTGATAATATAAAATA
TTTAACCTTTCCAAATTTGAGAGGAAGGAAAGTTTCTTTTTTTTTTGTTTGTTTGAGACA
GAGTCTCACTCTGTTTCCTCGGACTAGAGTGCTGTGGTGTCAGCCTAGCTCACAGCAACC
TCAAACTCCTGGGCTCAAGCAATCCTTCTGCCTCAGCCTCCCCAGTAGCTGGGACTACAG
GCATGCACCACCATGCCCAGCTAATTTTTTCTATATATTTTTAGTTGGCCAATTAATTTG
TTTCTATTTTCAGTAGAGACAGGATCTCGCTCTTGTTCAGGCTGGTTTTGAACTCCTGAG
CTTGAGAAATCTGCCCGCCTCAGCCTCCCAGGGTGCTAGGATTACAGGCATGAGCCACCA
CGCCTAGACAGGAAAGTTTCTTAATTAGCAAAATTAGTGGATTTCCTTCACTAGTCCAGG
TAAGGACCCTAGGATGTTTGTTATTTTCTGTACACAGAATAGCAAAGTATCACCTTCTTA
GCCTATCAGCAAACTCAAGTCATATGAAATAATAGATTAGTGAGGAACTTCTACGTTCTG
GAGTGATTAAAGAAAAAAATCTCTCACCTCTCTCATCTTTCTGTTTTAAGGAGATCAATG
ACCTGTTGGTTAAGGAAAAGATTATACAACTTACCCAGCAGAGATCACAAATCCAAATCC
TTCAGAAGAAGGTGGTAAGCTTGGAGACTGCTCTGAATTGCATGACCAGAGAGTTTGAGA
CTGAAGTTTTAAAACTGCAGCAACAGGCAACAATAGAGAATCAAGCAGGTCGGGTAGAAA
TTGATAAGCTGCAGCATCTTCTTCAGCTGAAGGACAAGGAAATAAATCGAATGAAGAAGT
TGGCCAAGAACATACTGGATGAGAGAACAGAAGTGGAAAGATTCTTTTTAGATGCTCTGC
ACCAAGTGAAACAGCAGATCCTGGTTAGCAGGAAGCATTATAAGCAGATAGCACAAGCGG
CTTTCAATTTAAAAATGAGAGCAGCATGTGCAGGAAAAACCGAATATCCCCCAATCAGAA
CATTTGATGGTAGAGAGCACAGTACCAATAGTGTGAATCAGGATCTTATGGAGGCTGAGA
AATGGTACTAGTAATATTTTAATATGTTATCTTTTGTGCTGCTATTTTTCTGCCCTTTAT
AAAAATAAGAACTCTGGAAAATTTAGTTTAATAATGTTGAATAATTAATCTATTGGATTT
AATTGAATAGATTGCTCAGTAAGTTACTTGAGGCCAGGAACGGACTGACTCATATTTGTA
ATCCATCCTATGCTTAGCATAGTGGCTTAGTATGTATCTTAGTGGGTGCCTCCCTTTTTC
TCTTGATAGAGACTTGTCTAGTCAATCCCGGAAGATGTCACTGTAATATATTTTAACTTG
TGTTTTCTTTTTTGGGGGGAGGGGGCGTCTCACTCTGTGGCCCAGGCTAGAGTGCTGTGG
TGTTAGCCTAGCTCACAGCAACCTCAAACTCCTGGGCTCAAGTGATCCTTCTGCCTCTGC
CTCCCAAGTAGCTAGAACTACAGGCATGTGCCACCATGCCCCGCTAATTTTTTCTATATA
TATTTTTAGTTGTCCAGCTAATTTCTTTCTATTTTTTTAGTAGAGACAGGTCTCGCTCTT
ACTTACATTGGACTCGAACTCCTGAGCTCAAATGATCCTCCCGCCTCAGCTTTCCAGAGT
GTTAGGATTACAGGCCTGAGCCACCGTGCCTGCCCTTAACTTGTTTCTTTATCTTACATC
CTGTAAATTGGAAATTAATTATAAAGGTTTGATTAGATTTAGTTTGATGATATGCTAAAT
GGTAAGCAAAAAGAAAAAAATAACAAAATAGATTCAGGTTAAACATTTTTGATAAGCATA
CTTTCAGAAGTATTTTGTACTGTTCCATTTACTATCTTGAGATAAAATTCATAGGTAATA
ATATCTAACCATATAATTTAAAAAAATCAATGTAACAACTCTTTGTAACAATTCTTTGTT
GTGCAGAACTGTCCCACGGATTGGAGGACATTCAGTAGTGCCCCCGTGACTGCATTAACC
AAAAGTCCCCCCAAATTATACAAAATTTTAGAGATCTACTGCTACTATAATAAAGTAGCA
GAATATTTGAGATAGTTGCAGACTGTATACAATAATTAATTTTGTTTTCTGTTAACACTT
TTGTTTCTTAGAGCAATTGTTGCCCTTATAAACTGTGGATTAAATTACAGTCCACTTTGA
AGATTATTCTGAAAAAAATTATTTCATATTCCAATGCAGTTAGGTTCTTCAAAGGCCCTA
ACTAAAGAAACTTAAAAGGACTCCACACTTCTGTGTGTGTAACATTTTATTAAGAGTGCT
TCCTCAGGGCTGGGCACGGTGATTCATGCCTGTAATCCTAGCATTCTGGGAGGCTGAGGT
GGGTGGATTGCTTGAGGTCAGGAGTTTGAAACCAGCCTGAGCAAGAGCGAGACCTGTCTC
TACTATAAATAGAAAGAAATTAATTGGCCAACTAAAAAAACATATAGAAAAAAATTAGCC
GGGCATGGTGGTACATGCCTGTAGTCCCAGCAACTTGGGAGGCTGAGGCAGGAGTATTGC
TTAAACCCAGGAGTTTGAGGTTGCTATGAGCTCGGCTGACTCTGGCACTCACTCTAGCCT
GGGCAACAAAGCAAGATTCTGTCTCAAAAAAAAAAAAAAAGAGTGCTTCCGTATGTGTTT
TCTGCTTTAAATTATTTTTTTTTCTGAGATCATGCAGTGAGATGCTTTAAATTATTTTTA
AGAGACTAATTTCTAAGTTCTTTTGAATCACATAGCTGTTGGGGAGGCTGAGTAGCCCTT
GAAAATTTTTGAGATAAGATTCTTCAAAAATGCCCATACTATAATTTTTTACCTTCTTGC
CATTTTAGAAGTCTGTAATACCATTTCTATTACCAAGAGATTTCCTAGAATTTCCTCCTT
TTTATTTAATAAGTCAAGTAAGTTGAGTACCTACCACACATAAAGGCAGTTTCCTTTACA
TCCTTTTGTCTACTGTATATTAAGTATTATACATTTTCTAAAGTTAAATAAAATAGTTCT
CTATCTACATTGTTATTGCAGAAACTGGACTCTTCCTGCTCTGCCTTCTGTGTGACATTT
TTGCTACTGGCCAACTTATCACCTTAATCTGAGTGTCCTATTGCCTTTATCAGCAAGGCA
GAAATGATGGTTTAAATATCACATCATTTATTTAAGTGGTAGATTGGGAAAGGACAATTG
AAGTATGTGGTAATCATAACACAAAACCTGAACTTTAAACAAAACTAACCCAATTGACCT
ATGTCCAAAATATGTTTTACAATATACAACATCAACACTCCATGTTAGCTTTAGTAAATG
GCAAGTAGACCATGAATCCTCTGGGAAGTTATAGTATATATAAAGATCTGCCTGAAAAGC
TTACCTTCAGCCTTATTTGAAGGTAAGAAAATAGACTAGATAAGTTACATGTTATTTTTC
TCTTTTTTTTTTTCTCTTTCTCTGTCAGGTCCAAGGTTGTGCTCAAATAGTTTATGGCCA
GCCCTACTTTGGGCCCCACCTGTGGGCCTCCCTGCAGGCTGCTTATGTTGTTTTCTAAAT
TTACTTTCTGTTCCTCTGTTTTCATAGTACATATGAAATGTACTATTTAATATAAAAAAG
AAATGTTATCAAAAAGAAGCCCAGAGTGACAGTTTTCCTCGATGTTTGCCAATCTGTTTG
CTGTAAAAGATCTGTAACATTTTAGGAATATATCAAATCAATTTCTCAGGGTCAAAAATA
AAAACAAAACAAAATAAAACAAACATTTTGGGAAAATACAGTTTCATTGTAACAAAAAAA
GAAAAGTTAAAAGAAAAACACCTATCAACAACCTCACCAAACAATTCTTTTTCCTTGTTC
CCTTAGTCTTTGTGCTGTATCTGTACATATAATGTTAACTTTACACCTTTCCATTTTGTT
TATTTGCTTAATGTTTGACCACAAATTTTTTTATGTTGTAGTTTTTGTCATTTTCACCTT
AATGACTACATAACATTTTGGATTGGCTAGTATATTGATATCCTTTTCGACTTTATGATT
TTGTAATGGACACAATTTCCTTTGTAATTGTTATATAATATTCAGTTATGGTATGGAATT
TGTATTATGTTTACATATTTTACATTTTTTTTTAAAAGATTAGAAGCTTACTTTGACCAT
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNTAATCTTAGATGTTTAAGGTAATGCTTATTAAGAAGTTACAC
ACTGCTTAGCTGAATAAGTGGCAACTGAAAAGAAGCATAACTGCTAAGATATTATTGGTC
TGCAAAGATAAGTAAATGATGTTTTTATTTTGAGACAGAATCTCACTCTGTTGCCTGGGC
TAGAGTGCCATGGCGTCAACCTAGCTCACAGCAACTCTAACTCCTGGGCTCAAGTAATCC
TCCTGCCTTAGCCTCCAGAGTAGCTAGGACTACAGGCATGTGCCACCATGCCTGGCTAAT
TTTTTCTATATATATTTTAGTTGGCCAATTAATTCCTTTGTATTTTTAGTAGAGACGGAC
GGGGTCTCGCTCTTGCTCAGGTTGGTCTCGAACTCCTGACCTTGAATGATCCACCCACCT
CAGCCTCCCAGAGTGCTACGATTACAGGCGTGAGCCACTGTGCCCAGCCTCAGTAAATGA
TGTTTTATTAATCTAGGGACTCTCTAATACAAGAAAGAGACCTAGAAAGGAAAACAGAAA
TCCATAGATATTCTAAATTCATTTTTTTGTTTTCTTGAGACAGGGTGTGTGTCTCTCTCT
CTCCCCTCTGGGCTAGAGTGCAGTAGCATCTTCATAGCTCACTGCAGCCCAAAATCCTGG
GCTCAAATGATCCTCTAGCATCAGCCTCCGGAGTAGCTGAGACGATAGGCATGTCCCACC
ACAGCTGGCTAATTTTTCTATTTTTCGTAGAGATGGTGTCTCTCTTACTCAGGCTGGTCT
TGAACACCTGGACTCAAGCAATCTTCCTGCCTCAACTTTCCAAAGTACTAGGATTAAAGG
TGTGAGCCACTGTGCCCAACCCCAAATAATCCCTTTTAATGATTAGTTTTACTCACTTTA
TCCATTTTGTTTTATTTATGACACTAAACCCTGGTATTGAACAATAATTAGGCTAAAATT
TAATAATTGCTTGATATGTGTTTGGCACTATATTAGCTACTATCAGAGATTCAAAAGAAT
GAAGAGATACTGCCCTTGAACTCAGAGAGCTTACAATCTAGTTGCTCAAACAAAACCAAA
CATAACAAGGAAAAAAAATAGGTGGTACAGTAAAGTATAATAGGATTTTAGACAATTGTC
AATGGCTAGAGTAGTCAGGGAAGACATTCCTGAAAGAGTATGACACTGTGGGGTGCCTTG
TGGGATAATGGAATAGTAGAGAGAAGAGAAAGCACATTAGGCAAGTGGCTTAGTAGACAG
CTTAAGCAAAAGCCCAGGGGTAGAAGTGGATGTGGGGTGTTTACAGAACATTGAGGAAAA
ACTGCCTGGCTTGAGGAAATTTGGTGATATGAGAGAGTAATTAGAAATAAGGTTTAATCT
ATAGATGAAATTATGATGAGCCTTAAAAACCACACAGAAAAGCCTGGAGTTATGCTATTG
TAGATTCTGGAGTACTTTATGCCCTAAATTTCTTCTCTGCCTTGAAGGAATACAAACACA
ACTGTATTCGTAAGCTGTATTCTCATGGTCTTTCACTGGAAGGAGGGTGCACAGGTTAAG
GGCAGTGTTCTCAAAGTTGACATTAACTTAACAGAGTGACATGCATGATGGACAAAAATA
GAGTTGGGGAACAGTAGAGGCTACTGTACTACTGGGCATGCATTGGTGAATGGTTTCAGC
AAGATAGGAGCAGTCCGGAAAAAAAGGGGAGGGAAAAGAAAGATAAACAAGACTTGGTGA
TAAAGGACAAAAGGAATAAGGAAAAGAGGAATAAGGAAAAGTAAATGTTTAAGTTTCTAG
CTTAAGAAATGAAAGAATGGTCAGGCGTGGTGGCTTATGCCGCAATCTCAGCATTTTAGG
AAGCCAAGGTGGCAGGATCGCTTGAGCCCAGGAATTTGAGGTTGTAGGAATTTGAGCTAT
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGCATGAACTTGAACCACAATAGAATCATGTCTAAGCCTGTTGGAATTTCATGCCAGAAT
TGGATAAAGGAAAAATAAGGAATAGAATGGTGAAATGTTGATATGAAGATGAGATTAAAT
GAGAAAGTTCAGACTGGGGAGAAACTAGATGATAAAAGGCTTACCAAGGCAAGTACCCTG
GTTCAACCTTGCCTTTCACCATTAATAGCTGTTGTGTGTCATCATCATGATCATCTCCAT
ACATATATTTCTGTTTCTTGAGTTCAACACGTCTCAACTTTAATATATTAACTTGCCTAA
CATTTTATCACATCTATGTTTATAAAAGCTCATTTTGAAAATAAAAAGCCCATCCAAGGG
AAGCATTTCACGTAACACTTTAAAAGTGTAGTTGAAGCCTGGTGTGGTGGCTCATACCTG
TATTGCCAGCACTTTGGGAGGCTGTTGCAGGAGAACCGTTTGAGGCCCGGAGTTCAAGAC
CAGCCTGGACAATATAGCCTGTCTCTATAAAAACATTTTAAAAATTAGCTGGGTGTGATG
GCGTGCACCTGTAATCCCAGCTACTTGGAAGGCTGAGGCAGGAGAATGGCTTGAGTCCAG
GAGTTCAAGGCTGCAGTGAGCTATGACCACACCACTGTACTCGAGTGTAGGTGACAGAGC
AAGACACTGTCTGTAAATAAAAGTGTAGTTGATATATGAAGACATGAGGAGACACTACCT
CATTTTGTTGACTTTTACCTACCACAGGAAATACAGCCAGAGTTGTAGGCCTTCAGTTCC
AGACTATGTTGTTACTGGCAGGGGGTTTTACAAAAGGAATTTGGGTAAGATCTTTCTTGC
TAAAGTAATAAACATGAGCCTCGTCACAGTGGTTCTTGAGTGCATCTTAGATGTGCTAGA
GTTGAGTGAGAGTAATAAGACAAGTCTGTTATTCTGAACCAAGTTTCATGTGTGTATAGT
TGTTGACAGCCCTATTTTATCATTATTGCAGGGAGGAAAGTAAGCTTCAAGATGAAACCT
TCATCACCCAGCAGGTTCCAATATCAGGCTTTTCTGGTGAAATGGTGCTACCCGGTATTC
CAAAAGAATCACAGTAGTCTGACATAGTAAGTATGTAACCAAACACTGTACATAACTGTT
ACCCTTCCCCATGCAGCTTTCTACCCAAATTACAGTTCTTTCTCTGCTAGCTAAGAGCCC
TCAGGGATCATGGAATGAGTAATAGAAAGCACTAATATGAGATTGTGGAAATTTTTATAA
AAATATCCATACTGAAGGCATATTATACTTAATGGAAAACCTATAGATTGCCTTTTGAAA
TAAGCAGCCTAGCCAAAATGTGTACTATCTTTTATGTAAGAGTAAATATAATGACCTTGT
AAGTCTTGGCTGCGGACATAGGTGGGAAGCTGAGAATCACTACAATCTAGGGGACAAAGG
CATTATAAGGAAGTATGGCATCATTAAAAAAAAAAAGCCATGCTTTTCCTTTTTAGAGTT
TTTTACTTACAATTTATTATTTATAATCAATTAGCAAAATGTAGAATCTGAGAAATTTAT
AATGAGGCCACATCAGAGCAAAAAGAAAATAAAATAGTGAATTTTTTAGCTGCCATAGCA
TGAATATAACTGATTTTTTTCCATCTAAGAAATAAGAAAATCTGAGCAAGTAGCTGGCTA
AGTGAATTGATTCTAACTAGAGCAACATAATTCTGATTAGTTAGGGTTTGTTTTGTTTTG
AGATAGGGTCTCACTCTGTTGCCTGGGCTCCAGTGCAGTGATGCAAGCATAGGTCACTGC
AACCTCAGACTCCTGGCCTGAAGCGATGCTCCTGCCTTTGCCTTCCAAAATGTTAGGATT
ATAGGCATGAGCCACCACTCAGCCAGTCGGTATTTTTTTTAAGTGTGATTTCCTTTAAAT
GTAAAGAAATATTAAGAGGCTCTGTGATTATATTTAATCCCTCTTAGAAATTAGATAACA
ATGATCTTTTATACAACCCAGCCTATAGCTGTTATTGTATTAAATTAAATTGTATTAAAT
AAATATCACCACTAGTTGTCAGCTGTGATAACAAGGAGCACTGTATTCAAATTATAAATT
TCTATTGCCTCACTTTTAGGAAAGTAGAATTAAAAAAAAAAAAAGACCCAGTAGGATCAT
AAGTATATTTTATTAAAGTCCCAGTTACCTTAAATGATTGAAGATTCTGACATTCTACAG
CCAACTGGTAGTAACAAGCCTAAAGTCCACAGAGCGCACAACATTTTCAAGGTTTTTCAC
CATCCTTTGGTATAGCAAAAAGAGAGAATCCATTCAATTGAGCACATCAATTTCAGTTCT
GACTTAAAGTTTAGATATATCAAAGAAACAAAAACCATGAGGGGGGTGATAGATAAAAAT
CTACTTATCTTGTAATCCTAGCACTCTGGGAGGCCAAGGCTGGCGGATCGTTTGAGCTCA
GGAGTTTGAGACTAGCCTAAGCAAGAGCAAGAGCCTGTCTCTACTAAAAATAGAAAGAAA
TTAGCTGGACAACTAAAAATATATAAAAAAATTAGCCGGGCATGGTGGCGCATGCCTGTA
GTCCCAGCTACCCGGGAGGCTGAGGCAGAAGGATCACTTGAGCCCAGGAGTTTGAGGTTG
CTGTGAGCTAGGCTGACGCCATGGCACTCACTCTAGCCTGGGCAACAAAGCGAGACTCTG
TCTCAAAAAAAAAAAAAAAAAAAATTGAAAAGTATATCACTAATAAGAAATGCAGAAAAG
AGCAAAGAACATATAAAATTCAGCAAGTACTATCAGGTTAGACTTGCTTAAGGCAAGAGT
TCTCACCCACTTTCATGTTTGGAACACTCCTTGATTTCCGAGCTTAAAAAAACTTGAAAT
AATTTTCTAAGAAAATAATTTGCATCTGAATTAATGGCTGGAGCATTAATTAAAGATTGC
TGAAGCAAACCCCAAAACTTAACACTTGGCACACATAACAAAAAGTTGATTTATTCATTG
TTTACTGAGGTATCACTGAGGTGATCTTCAGAAGCAGGCACAGTAACAATGATAGAATTA
AATGGTGGTCATGAATTACTAGGACAACAAAGTGGTACTGAGCAGAAAAGAAGTGGTTGT
CACAGTTTTGGGATAAATAGAAATGTATAATATCTTATGTAGTGTAGGGTAAAAGACAGG
CTCAGGAAAAATTTGCAGAGGGACTCCCCCGCTGGCATTTATGTAGGGCTGTGTCTGAGG
ATCAACCAGAGGAGGGTGAATTATTTCTATCCTGCTTTCTCATCAAAGAGTTCATCTTCC
AATTATTGGAAGACCTTCTTTACATATAGTCACCTTCCCCTCCTTTAAGTCATCAGAAAA
GGGAAGAATTTTTAGAAAACACGTTTAAGCTCTTATTCCCAGATAAGCATTTCACAGTCA
CAATTACCTCAAAAATGTTAAGTATGAAGAGCAAGTGAAAAATCTGGTTTCAATGTTACA
CTAATAGTCTGCCTATAGCAACTTTGTAGGGACTGATAGTTCTGAGAAAGATTTTGGTTA
CAATGTATTCCAATTCCAGGGATCCAATCTGAGCAAAGTTGGCAAATCAAGCTGGTCAAA
AATAAAGGCAGATTATTCAGGACGGACTGAGTCTTAAACAAACTTGTTTCTAACGGCCCA
TGGTAGGCATGGCTACAGCAGGTGAGGAAAGAGTAGCATCATCTTCTTTCCACTGAGAAG
TGATGGTCTTTAACTGAGTGTAGAAATGGATGCCCTAGGGAAAACAAAGGGAAAAAAGGA
GTTAGCATATATTTCTGGGGATTTCATGATTCTTTTTGTTGGCTTTTGAAGGAGGTGCTA
TGAAGTGCTACTCACATTCCTATTTGAGGAATGCAACCAAAATCTAATATGTTGTTCATG
AGATAATTTATCTAAATGAGACATTTAGCATAGTACCTGGCACATAGTAAACGGTCAAAT
CTTAGCCATTGTTATTATGCCGAAACTAATACTTTAAGCCAAGAGCACCTCAATGGAAAA
CTTGAACAATATAATCTGTTAAACTTGCACGTCATTCTGCAAGAGTTGAATATCATGTGC
CCTGAAGTCAACAGATTTGGCTCAAATCCTGCCTTCTCCTCCTTATTGACTGCAATTTAA
CCTTGAGCCTTATCTGTGTGACATAATGCCCACCTCACAGCAATGTTTTGAGGAGAAAAA
TGAAATGACATGCAAAAACATCCTAGCAAAGTGACTGCTTTTCAACAGTTGTTAGTTTTC
ATCTCCTTCCCATGAAGAAGAAAAAGGAATAAAGGAGTGAAATATATGATAGGCAGTTTC
TGATAAGCATTGATGATAATGAGCTCTATACCTGAAGTGGCAAACCCAAAATATCTTACA
AATCCAAAGTAAAATGTCTGATATTACACAAATGCACTTTTTTTTTTAAGGCAAGCTTTT
GCTCTGTTGTCCAGGCTGGAGTGCAGTGGTACTCATTGCTCACTGCAGCCTTTGAACTCC
TGGGCTCCAGTGAACCTCCAGCCTGAGCCACTGCACCCAGCCAAATTCACTTCTAAATTA
CCTATAACATGTGAGCCAAAAAATTCAGCACATTTAAGGCTTTAAGTGTGTGGGTGATAC
ATACATACATACACACACAGTTTATTATTTTATAAGAATAGGCTTGAACAAAAGAGAACC
CATTGTGTAGATCTGACACATAAAATTATTAGCAAACTAGAATGATGATTTTTCAGTTTA
CTTATTTTTTTAATTTTTGAGATAGGGTTTTGCTATGCCACCCAAGCTAGAATGTAGTAG
CACAACCATAGCTCACTGCAGCCTCAAACTCCTGATCTCAAGTGTTCCTCCTTCCTCAGC
CTCCAAAGTAGCCGGGACTACAGGTGTGAGCCACTGCACTCGTACACCCAACTAATTTTT
TTTTTCCTTGTAGAGAAGGGGTCTCACTAGGTTGCCTAGTCTGGCCTTGGAAGTCCTGGG
CTCAAGAGGTCTTCCCAAAGTCCTAAGATTATAGGCATATGCCACCTCACCTGGCTAGGA
CAATGTTTTTAGAAAAACCACTACTGTGATTAAAATACTCTTCTAGAATTATTTGACAAA
ATTTGGACCATTTTAATGTATTAAAACAATTTTAGAGGGAGGCCGAGGCAAGTGGATCGC
CCAAGGTCAGGAGTTCAAAACCAGCCTGAGCAAGAGCAAGACCCCATCTCTACTAAAAAT
AGAAGAAATTAATTGGCCAACTAAAAAATATATAGAAAAAATTAGCTGGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTTTTTTTCTTGAGACAGGATCTGCTCTGACACCAGGCTGGAATGCAGTGGTGA
CATCATAGCTCACAGCAACCTCAAACTCCTGGCCTCAAGCAATCCTTCCTGCCTTTGCCT
CCCAGAATGCTAAGATTATAAGAATGAGCCACCATGCCTGGCTCAAAGTGTTGACTTCTT
AACACTTTGGCCATACTGTCATCTATACTATGCAATACCATTGTTAATTTTTTATTAGCC
TATAAAAGGGGAGACTTGTATAGAAAATAGGTACTTTATCAATGATAGTTCCAAAATGGC
CATATTCCTTTAGGCCTACAAAGAATTTCCACTAGCCTGTTTGTTCAACAAATGTTCAGT
CAACCTGCTCTGTGCAAGGTATTGTAGATAAGTAATAATTACAGTGTGATGAGGGCTTCT
TAAGCTGGCTTCAAGAGCCCTATGTGACTTGGCCCCTGCCTACTTGTCTAACCTCATCTC
TTCCCATTGTCTTCCTCATTCACTCAATGTGCTCCAGCCCATTTCTGCTGCTTGAACATG
CCATGCCTCTTCCTGCTTTAGGACATATGGTCCTGCTGATGGAAGTGGCAATAATTCAAT
CTTCATAACTTTAAGTTTGAGGCATAAAGAGGGTGTCCCCCAAAGTCACACAGCTAATAA
CTGGCTGAGCTGGGATTTGAACCCAGGCAATTCAGTTGTAGATCTGGTTTATTTTTCTTG
TTCACTGTTGTATTTGTAGTGCCTAGCATAGTATTTGGTACAAAAAAAGGTGCTCAATAA
GATTTTTTGTAAACGAATTAACTATTATAGGAGAAATATGTGCAGTGGGAGCACATGGGG
CATACCACTGAGGGAATAGGTCTTGGTCAGGGCTGATTTTCTAGGAGTCCTTTCTTTAAA
CTCCAACATGAGAGATGATGAGGAGTTAGACAGATGAAAGGGGAGAGATGAGGAAGAGGA
TCATAGGCAGAGGAAATGGCATATACAAAGGCTTGGACTTCCCCATGCCCTTTCCGCAAA
ACTTTGTTTCCTTGAGTTATTCAGGAGGAAGCAGCTTTGGCAAAATTTTGTTGACCTTTA
AATCTTTTTTAGGGGATCTTGTGAGGAGCACTGATAAACATATGACCCCACAGAAGCTGC
TGGACGGCCCTTCCTTGGAGAATTCTTGCTCCCGAATATGTTCAAGTTTCTTAAAGGGAA
AAACAAATTTTAACTCAAAAAGTTACCTGTTTGCCATAGAAATTGTGTCTCCCTGAAGGA
AGATCGAGAGCCAGTGAATGAAGAACATTGGCAAAGGCACTGGAATGGGGACATTCACTC
CCACCTAAAGCAGAAACAAATCACATCAAATACTAAGTGAAAGACTCAAAAAGGAACTTT
CCATTTACAAGCACAAAGACGTCACAGACCAGCTTTAAATACCCACCTTCCCACCCCACC
CCTCTACTCATGAATTTTTATTCGTAAGGAAGATATAGAGCACTGCCGGAGATTGGAGGG
GCAATCTTTAAACAAGTTGCAGTGACTGATCACTGTTTACTGTTTCCTCTTCGAAAATAG
TAAATGGCTATGAAAATAGCCTAAAAATTCTCTTCACAAACCTGTCCAACATCCACCAGG
TGAGAATATTTCCGAGCAGTGGCTCCACTAGTGGTGAAGATGGCAGTTCCATTTCCATAT
GGGTTATCATTTACAATTTTGATGGCTTCATCCAATGTTTCTGTCTCTAGAACCACAAGA
ACTGGACCAAAAATCTCCTCTTTGTAACAGGTCATATTTGGCTGCCAGGAGGGATGCATC
CAGAAAAGAAGTCGACTTTTTAGATTCTGAGTGTTTTATGCTTATTTGGTACTTTCACTT
AATACACATAATTTACATGGACAGCTTTCCTTTTAACAATTTTCATTTTAAACCACCTAT
AAAAAAGTCTTGTCTTACTGTGTTCCATCCTCCAACCTACCAATCATATAAACAATTTGA
AAGTCCTATTAACTATAACTACACTCCTTATCTTTAAGCACTGTTTCTTTAGTTCATGAC
CCATTACTAGCTTCTTTGTTAATACCTGAACAACTTGTTTCATACAGTTATGTTACCAAT
TACA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1383, 4789..4890, 8607..8666, 8669..8683, 8851..8953, 8957..8965, 14352..14363
1001..1383, 4789..4890, 8607..8666, 8669..8683, 8851..8953, 8957..8965, 14352..14360
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved