Microcebus_murinus Locus SNX5
snOPY snoRNA Orthological Gene Database
Microcebus_murinus SNX5
Microcebus_murinus
SNX5
GeneScaffold_599
SNORD17
21413..21649
43905
GGAGGCCTGTGCGTGAGACACAGAACAAAACCAAGGAGTGGGTCCTATAGCTGCCATGG
CAGTCACAGTTAACAACCGATCGGTAAACAGCAGGTTCTTTGCTAAATATTCTGTATAGA
TATTTCTCATTGATCCTCACACTCTTTAATGTAGGCACTATTATAACCCCGTTTTACAGA
CGGAGCTGGCAAGAGGCGGTCAGCAGGACCCACCTTCGCGATCCCCACAAAGTTGCCTCC
CGCTCCGCGTTAGTGTGGGACCCCTGGTCCTTCAAGGACCGGCCTGGGCCCCTTACAGAG
CGGGAGTTAGGATTTGGGAAAAGGCGGCTTTAATTAAAGCCTAGGCCTAAGCAGGGGTCG
GTTCCTTCAAGAAACCCCCAAAACTTCGCTTAACTCCCAGCGTATGAATCACTCTCGGGA
CCCGTACTTTCATCCGTCCCGCGCTTTGGGCTTGAGTAACACAAGGCGTCCCGGCATGCA
CTGCGGCGCTCAGGCTGGAGGCCCTTGCTTGTTCCCCTGTGGGTTTGCGCGATGGGTAGG
GAGTCCCTCAGCGGAAGCGCGGACGCCTCCAAATCTCGCGCCTTGGTTTCCACGAGATCT
GAGTCACCGCTCATCGCATCTTGACCCGTGATAATAAATATCCGGCTGGAGCCGGTCTCT
CGAGAGCGCCTCATCAAGATAGTGTCGTGCTTTGCGTCCCGTAGCGTCTGCTATCGGCGT
CTCCGCATGTGCGGAGCAAGGGTAGGCCCCCCGTGCATCTTGCCGGCTCAGATGACGCAG
CGGGGACGGGGAGGCGCCTCTGGGGAGCACCGTGCGCCCTGCTCGCAGCTCCCGGGGCTG
CTGGGATGGTGGGCGGGAGTCCGAGGCTCCTGCGCCGTCGGGCAGGGAGGCCAGCGGAGG
GCGGGGGCTGTGGCCCCCCTGTAGAGGGGGCCCTGGCGGCCGGCGGTGCCGCCTCTTCTT
TCCTCGCACAGCCAGGCGGCCCTGCTCGAGTCCGCGTCGCCATGGCCGCGGTTCCCGAGT
TGCTGCAGCAGCAGGAGGAGGATCGCAACAAGGTGAGCTCCGTCCTCCCCGCCTCAGGCT
CCAGGACTGGAGGCCCCGCCAAGCTCCTGGACCCCTACATTCTCCTGCCCTTGTGCAGGG
CCCTGGCTGCTCGCGGGCTCCTCAACGCGGGAAGCACCCGCGAGACCCCGAGCATCCTGC
GGGATTACATCCTTCCCGAAAGGCTGCCTTAGGCAGCCCCTGCGCACCCTCCTATTTTGC
TAAGGTGGGAACCAGGGACCGAGGGTTTACTCAGAAGCCTTCACCCCGGTGCCCAGTACC
GAGCGGACGCTCGGCCAGTCTCAGGCTAATCCCTGGGGAAACCAGAATGTGTTATATTAA
ACCCTCTTAAAACTTACTTTGGCATCGTGGTGTCTGGTAGGCGAAAGTGAAATCCGCTTA
ACATGCAATAATCGACAGAGTTTGGGTTTTTGCCTCCAAAATTTCCTGCTCCCTTCCCCG
CTTTGAGAAAACGATCTTTTTGGCCCAAACAACTGGGGAAATTCCACCAAGTCATCTACT
TGAAGCATTTTTCTTAGAACTTCATAAATGTTAAACGCGTCTTTGTAGGAGTTGTGTAAT
TTTTAGTAGGTGGTCAAATACTTACTTAACTTGGTATTTATTTTTAAATCTTGTCTATTT
ATGTAAGTTATCCTGAGGCCACATATATCTAAAAGTTTATTGTGCAGTAAACCGTGGTTA
CGATTGGGCGTGTTGGTTCAGGCCTGTAATCGTAGCACTCTGGGAGGCCAAGATGGGCAG
ATCGCTCAAGGTCAGGAGTTCGAAACTAGTCAGAGCAAGAGGGAGATCCCCGTCTCTACT
AAAAATGGAAATTAAGTGGCCAACTAAAAATATATAGAAAAAATTGGTCGGGCATGGTTG
GGCATGCCTGTAGTCCCAGCTGCTTGGGAGGCTGAGGCAGGATTGCTTGAGCCAAGGAGT
TCAGGGCACTCTAGCCCTGGCAACAGAGTGAGACTCTGTCTCAGAAAAATAAATAAATAA
ATAAATAAATAAACTGTGGTTACCATAGTCGATTAAAAATTTAGTGACAAGTCTTCGTTC
TTTTATTGGTCCTTTAAATTTAAAGTCTTGTTAGTTTTGCTATGATACAATTTGTGAGCC
ACAACCCTGTGTGCAGAATCATCAACATGAAAGTCATTTTTTTGACAGAAAAATTAAAAT
CTAAAAGTACAGGGCTGTCTCAAATTTAAGTAACTTGGAACCATCTTAAAAATTTACATC
TTTTTCAAAGTCAAAAGCACCATGATAGAAACTTCATCTAGTGGGTAAAAACCGAAGTTC
CAAAGTGGCTAGACTATTCCAACAAGAAAATCATTGTTTTGTTAGTTGCTGAAATAGTTT
TGTACATGGGCGATCTTGGTTGGGATATCTCTTCAAAAGTTGGACATTTTTTACTAAAAC
TGAAGGTGAGAACTTGAGACTACTATTCTTTAGGTAGTTTTTTTTTAATAATTCTTTTTT
TTCCAGACCTGACAGTTGAGTACATCTTTAGGTAGTTTTCTCCATAAAGTGTAGATACTG
ATAGGAATTTAATAGCAATTTGTTTTTCTTATTTTCTGGTGTATTCTTCCTTCTAGCTCT
CTTATTCCAGAATCAGCTACATACAAGCACTTGATTTTTCTCAACCTGCCTCCTTATTTA
TTTATTATATTTATTTTTTATTTTTTTGAGACAGAGTCTCACTTTGTTGTCCAGGCTAGA
GTGAGTGCCATGGCGTCAGCCTGGCTCACAGCAACCTCAGACTCCTGGGCTCAGCAATCC
TACTGCCTCAGCCTCCCAGATAGCTGGGACTACAGGCATGCGCCACCATGCCCGGCTAAT
TTTTTATATATATATTTTTAGTTGGTCAATTAATTTCTTTCTATTTTTGGTAGAGACGGG
GTCTCGCTCAGGCTGGTTTTGAACTCCTGACCTTGAGCAACCTGCCCGCCTCGGCCTCCC
AAAGTGCTAAGATTACAGGCATGAGCCACCGTACCCGGCCTTCCTTATTTATTATATTGG
GTTTTTTTGTTTGTTTGTTTTTGTGTGTGTTTTTTTGACACAGAGTCTCACTCTTTTGCC
TGGGCTTATGATTTGGAACAGAACTCACAGATCTGTTATGACCAGAAGCTTAATTAAAAT
CAGAGTCACTGAAATTCATTCTGCTCACCACTTGCCCCCTGTGTAGGGGCTTCACAGTTC
CTAGAGGAGAGGAAGAAGAGCCACCAGTCAAATAGTTACCAGCACCTCCACCCAGGACAT
TTTCAGAGGTGGGTGGAGGTCAGGATCCTGGAACTGGAAGGATGAGCCTGTAAAAGCTTT
CATTTTTGCTGTTGTTTGGATGGTTTTCCTGTCCAAATTGTAACCCAACATCATGCCAGT
ACTTTCTCTCTGTAGAATAAATTATTGTCCTTGTTCAAATGGAGAAACTGAGGCAGAGAA
CGCTAACATGGATGGGCATTGTGTGCCTCCATATGTGATACCCCGAGAAGGACACCACAT
CGCCTGGATAGTATTTCCATCGAGAATGGATAACTTGGATCTAATCGTGAAGAGATTCCA
GACAAATGCCAAAAGAGGTATGTTCGATTAAAAGAAAAGTTTGGTTGTATTCTTCAAAAA
TTTCAATGTCCTAAAAGACAAAGGATATTACCAAGTGAATTGATAAAATGGAATACTCAG
GGTAAAATAGCTAAAAGTATATTTTATCAAAGTTGATTTTAATGAAGTTGGTAACTTTAG
TATGATCATGTAAGATAATTCCCCAATTAAGAAATACTCATTGGCTGGGTGCGGTGGCTC
ACTCCTATAATCTTAGCACTCCGGTAGGCTGAGGCGGGCAGGTCTTTTTTGAGCTCAGGA
GTTTGAGACTGGCCTGAGCAAGAGTAAGCCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTGGTACCTAAGAAACTGCCCTCT
CTCATGTTGACAGGATGAGAGTTCTCATATGTCTGGGATTTTTAGTGGGTAGGCAGAAAT
CATTGGGGATTAGGCAGAAAGAACCTTGTTCTAAAAATAAGTTACCTCTATCTCCAGTCA
TCTTTTACTTTCTGGGTTCTACAGGCCGCCTCTTTCCCAAAAGTCATTAAATAGTTGGGC
ACTGTATTTAGGTACCCACTCACAAATTTACTGTGTGTCTTGGGGGTCTTTCTCTGGGGT
TGAGTCATGTTCCCTTTAGTCTAACAAAACCTGTGGCGAATTGAGCACAACAGCATTGTT
TGTAGGTGTTGGAGACCTGACTGCCTCCTGGGACTTTTCTTTGATTCTAAAGATTCTTTA
GATTCCTCTGCTTTATGACTGTAAATGGACTGAAGTAAATTGAGCACATGGAAGGGAAAA
GTCCTGCAAGGAGGTTGAAACCTGTTCTTACCTTTCCCAGCACTTGAAAAGGCTAGGTGG
TAATCCTTCCCAGCATAGTGCAATTTTTTTTTTTTTTTTTTTTGAGACAGAGTCTCACTT
TGTTGCCTAGGCTAGAATGAGTGCCGTGGCTGTCAGCCTAGCTCACAGCAACCTCAAACT
CCTGGGCTCAAGCAATCCTTCTGCCTCAGCCTCCCAAGTGGCTGGGACTACAGGCATGGG
CCACCATGCGCGGCTAATTTTTTCTATATATATTATTTTGCCAATTAATTTCTTTCTATT
TGTAGTAGAGACGGGGTCTCGCTCTTGCTCAGGCTGGTTTCGAACTCCTGACCTCGAGCA
ATCCGCCCGGCTCGGCCTCCCAGAGAGCTAGGATTACAGGCGTGAGCCACAGCGCCCGGC
CATAGTGCAATTTTTAATGAGGGGTTCTTCCTTGACAATAACAACCTGGCCTTAACTTTT
ACTAGTTGGTTACATGGGTTTTGTTAGATGGTGTCTGTCCTTCTCATACCCAGTCATTAA
CGTTATCACTTAAATGCTGCTGCTCTGTTTTGCAGGTAAAAAGATTTTTGTGGGTTTTTA
TGCTGATGGAAGCTGCCTCAAGGGGCACTGGTGTCTCTATCAGCTAGGATGAAAGAGTGT
CCTGCAGTTTGTTAGCAAATCCAAATAACCAAATATCGTAGACTGAAGTTTTATGCTATA
CTCGTGATTTTTTTCTTTTTTAAAATAAGGAAGTATAACTTACCAAAGCTGCCCACACCT
TGGTTCTGGTTCAGTAACTTGCACACAGTGTCTTAAGGTCCCCATTTGTGGAAACTACTT
TAGCAGGTCGTGATCTGCTCACATTTTTTGGCTGTAGGTAGAAATGGCCAAGAGGCTATA
AGGATTTTCTAGATTTTACTTTTAAGATCTAAATTCGTATTTGGTGAGATCTAGTGTTGA
CTAACTAATCTAGAGCTGTAGTTTAAAAGAGGGTTTCCCAATCTAAGCACTGTTGACATT
TTGGGCCTGACCATTTTTTCTTCTTGGGGATTATCCTGTGCAATGTAGGGTGTTTAGCAA
CATTCCTGACCTCTATCAGCTGACCATCTCCTCCCTTCCTGTTGTTGGAATAGTCAAAAA
TATCTGCAGAGATTGTCAGAAATGTCCTGGGGGGCTGGTGGAGAGACTATGGTCCCTGTT
TGAAAATCACTGGTTGACTTGTAATCCTAGCACTCTGGAAGGCCAAGGCAGGTGGATCGC
TCAAGGTCAGCAGTTAGTTCGAAACCAGCCTGAGCAAGAGCAGAGACCCTGTCTCTACTA
AAAATAGAAACAAATTAATTGGCCAGCCAAAAATATATAGAAAAAATTAGCCGGGCATAG
TGGCTGTAGTCCAGGTACTCGGGAGGCTGAGGCAGAAGGATCACTTGAACCCAGAAGTTG
GAGGTTGCTGTGGGCTAGGCTGACTCCATGGCACTCTAGCCAGGGCAACAGAGTGAGACT
CTGTCTCAAAAAAAAAAAAAAAGAAAGAAAATCACTGGTTGAAACTGACTTCTTTCTAAA
ATGGTGTGGTATGGGTGGGGTCAAGTTGTGGTATTATGCCAGTTACAAATTTTTCCAGGT
CTGTGATCAATAATTTCTTGCCTAAAGAAATGCCACATGAAATAAGCATTGTTGAATATT
TTACACCAATATTGAGGAACCTTATCAAGAGGAGATAAAAGGGTTTTCTTCAGGGAGTTC
TGGGCAGTCAGGGTTTTAAGGGGCAGCTGTGTACTTACTGTGCTTGTGAGTGAAGTCCCA
GCTTTGGACATAAGAAACCTGAGCTGCTTGTGCCACAGTACTTGAAAAGCATGGGGGGCT
AGAATTGAAGTTCACTGAGAAAACATGCTATTGAGAGGAACTTGATTTAAAATTCTGTTT
TTATTATCAGAGCTTTGTTGCTTTAGAAAATTAGGGGGAGAACAATTGTGTAGGCCAGGC
CCCTTGATTTCTCAAATGGCCAGGGGCCAAAAAAAGGGTGCAGTAAAATTAGTTTTTAGG
GAAACATTGTAACTTAAATGATCCCAATTTTTAGAAAGAGATTTATTTTCAGAGGTTTGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNCTGGAGTAGTAGCTGGGATTACAGGTGTGTGCCACTACTCC
CAGTTTAAAAGAACATCATGATCCTGTCTCCTCAAATACTCAACTCTTAGATCAGCCCCC
ATTTAATCAAGCTCTATTTTTTAACATTCTAAGTATCTTTTTAAAAACATGCTTAGTAGT
AACCATCCTCCAAAGTAGAATGAGAGAAGTATGGAAACCCACATTTACTATAATAAGTAT
ATACTGCTACTTTGTTTTTTTTTTTTTCATAAACAAGTTTTTTAACTTAAAGTAGAAACA
TTTTATGGGATTAAAAAATTCTTTGCAATTTCCACAAGTAATATGCAGCCTTCTGAGTGC
TACACCTGAATGATCTGGAACATTTGCTATTTGCGGTACCTCAGACTCAAAACAAATGTC
CAACCACAAAACAGCCTTCTCTCCATACTGCCATTTGTGCCTCAAACTGAGATGACCAGC
AAGTTTAATTTCAGATAACTCTACCAATGTTGCAAAACCTCTTTCCATCTCAGGTTGATG
ATAAAGGGCAGGCCATGAATCTTCTTAAGTACCCTCATCCACATGAGTAATAAGGAACAT
GTCAGCTTTGTGGAGAACAGCTTGTCTGGTTGATATAGGAGGGAACTTTTGGGAGGGGCC
TTCATGGAGTTCGATAGTGGGTGAAGGGCTTCAGTGCTAAATGAGGGTGATTGATGTTTC
TGGTTTTCATCATGTGTTGGTGCTCTTTCCCTGTAGCAGTGGTGTGTTGATTCCCAATGG
GATTTCTCTGCTAGGAGGTCTTTACAGATCATAGACAGCTTAACCTTTTTGCTTTATGAA
TTCATTTGAAAATAATTTAGGTGCCTAGTAATGAGATGAATTTAAGGCAGTAATTCAACT
TAATCTCTCTGGTTCCTTGTTGAGATTCCACCAGTGCATGGACCTGCAGCCTTGTGAAAT
GATGATTCAGTTTATCCATTCGCTGAGTGCGCTGCACTGACCTCCTTCCAAGCCTCAGTT
CCTGTTCTAGAAACTTGGGGCTACATAGCCTCCAAATGCCCTGCTCTCTGCAGTGTTCTA
CTGTCGACTGCTTGGGTCTTGGTAGACTATTGGTAAGGATGGTTGGTGTCAGCAGGGATA
GGTCCCTCTGGGTCCCATCTCACAAAGATGAGTGGTGCAAATCTGATCACTTGCTGCAGC
CCTTTGCCTAGCATTTTATTAAGCTTGTACCTGTGTGACTTTTATAGCTATTATCTATGA
TAGTAGACTGAGATCTTTTGGAAGTCCTTAGTTCTGTTGAGGACTGAGATATGATATTGC
TGCCTGGATGAAAAGAAAGGGAGAACCAGGGGGGGAAGGGTGGTTGAGAGGGTATACCTG
TAAAAGCAGAAATAATATATTGCTTATAAGTTAGTTCAGCTGTTTTTCTGGACCCATGCC
ACAATGAAAAGCTGGGATTGAATACAGATACTGGTTTGGTTATCTTCAGGATGGAAGAAA
ACAGTAGCAATTGAGAGCATCAGTCCCTAACGTTTTTGGCACCAGGGACTGGTTTCATGG
AAGACAGTTTTTCCATGGACTAGGGTTGGAGTGTCGGTGGGATGGAGAGCTCAGGCAGTG
ATGCGTGGCCCATTTACTAACAGGCCATGGACTGGTGCTGGGCCTCAGGATTGGGGGCTG
CAGATTTAGAGTACCAATACTAGAACCATAAAAGCAGGGTTTGGGGAAGGATGCGGTATT
AGAATTTCCTAGAGCACTTTTTCCTGTGAGTTAAAACAGTAACCAAGTAATACATGTAAA
TATGTATCCTGTAGGTCTTTAATATTTGCAAAAATTAATGCAAATCTTGAGTGTAGTGTA
ACATTTTTTTATTTCCTTGCTAATGAGTATTTAACCTAGCAAGGTGTGAATACCTTGCCA
GCAGAAATTGTTTTGCTGTAATCAAAGTGAAAATCTGATCAAGGAGGCAGGGTTCTTGGC
TCCATGCTGTGAACAGACCATTCATGGATGATTTGTTATATTGGCCCTCTCCCTGGGAGA
AGTTTTCATTCCCTAGGCGGTAGGATGAAGGATAACAAAGCAAAAATCCTTAGAGGGGAG
AGTAACAGTTTGAAGGAAGACATACTGTTGTAGCTTACTGGCTGAGTACATGTCTTCTGC
TTCTGGAATGGCAACTAGAAGATTTTTAAATATATATAAGGTTACTGGGGAGGCTGGAGT
AGGAGGATCCTTTGAGGTTGGGAGTTTGAGACCAGCCAATATATCAAGACCCTGTCTCTT
AAAAATGTGTATGAGTAATCTTTTTTATCTGTAGTAGTTCCTTTGTGATATGTGAATAAA
CATGGAAATATAGGGGCAGGGCTAGTATCTTGTATTGCATAAACTTCTTACATCTTGAAA
TAGTTTTGTATTAACTGATTAAATAGATTTAAATAGTTATTCAACTAGCTCCCATCCTGG
CAGATCGGAGTGACTGGAATTTTTTTTTTCCCTGTGTCTTGTCATTTTGGCTGCTGTCAC
CATAACAACTCAACATTAATTGCATTTTTGTATGCATTTTTTTTGTTCCCCTTATGGTTT
TCAAATTTCAGAGAGTCTTGCCTTTTGTGTTGTGTAGTCACTAGGTGCCCTTTGCCATGT
GAGCCATTAACCCTTTTGAAGAGGGAGCTTTGCTGGTGGTATTAAGTTTTGTGCCAAAGT
GAAGCTGATGAACAGGTGAGAAAATGCATAGGGATCTCGTAACAGTTTTTCTCCTTTCAA
GGAAGTGCCTTAGTTCTTTTGCCAAAAGCATTCAGATTTCTTAAAGCAGTTAAAAATGTG
TCTTCTAAATGAAGCAATGCATGTTTGCCCCTTATTTCTTCTTACTGCAACAAGAGTAAT
TGTACTCTTTATTATAGGGATTGATTTGGTAGGACAAAAGTATGTTGGGAGCTGAACCTC
CATCTAAAACTTTGGATATGTGATGCAGTGGTTTCTAGGGAAATCTGTAAAAGTCAGTTT
TAAAACTTAAATCCATTCTGTGGCCCAAGTCAGAGACTCAGTGTTGACCATCAGGGCTAA
GCAGTACTCTGTGCTTCAAGATTAGGGGATAGCGGTGGGTGAAAGGGGAAGAGTGCCACC
TACTCCTTATATACTTTGGAGCCTGGGGTTTTATTTAGCAAGTACTATGGCATGGGACTG
TGGGGTGTTGGTTTTGTTGTCAAAGCATAAAGAGGACTGCTGAACTTTTAATCATGCTTG
GTGCTTCCGGAGTGGGGACACAAATGCTGACATAGGAGCTCTAAGCATTTCACAACTTTT
TTTTTTTTATATATATATATCAGTTGGCCAATTAATTTCTTTTCTATTTATAGTAGAGAC
GAGGTCTCGCTCTTGCTCAGGCTGGTTTTGAACTCCTGACCTTGAGCAATCCGCCCGCCT
CGGCCTCCCAAGAGCTAGGATTACAGGCGTGAGCCACAGCGCCCGGCCTAGCATTTCACA
ACTTTTTGCCAGTATTCTCTCAGATAATTCTTAAAGGCCAAAATACAGACTGTTGTGTGT
TACTTGCTTATTTGGTGGTTAAGACTGTCATGTCAAGTGGTTGGATTTTTGTTTGAATCC
CTTTGTAGGGTGAAATGTCCAGGCAAAAATGGCTGCTAGAGAAGCTGGGATGCTTGATAC
CCTGCTATAGAAGTAGTCTTTCAAAACCTAGTTGTTTTCTTTATTCCTTTGTGTCTTCAT
CACTCTCTTTTACTACAAAAATATTGCTATGCAGACCAGAAAGGAAGACAGATACAGTCT
CGGGTATTATGTCTGCGTGATTGGGAATATGGGAAAAGAGACAAAACCAGAAGATTCAGT
GGAATGAAAAGCGGCTAAAGCAGCTGGTAGTGTCCATTGTAGCGCTTACATGAACCTCAT
TTAACTGATTACATCTCCCTTGGGACCTCCCACCCTAATTCCAAAGGTAGCCCATGTGGA
GTTTCAGGCTCATAGTTTGCTCAGCTTGCAGTGAGCTGAAGTGGAATTGTCAGCACATTA
AGTTGGGAAGTACTAGAAACTGGGATTTCTGACTTTAGGAAATGGAATCTAAGGAATTGT
GAAATACACCTTAGACTCATCCTATGAGTTGTCCCATCTCTNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTGAAGCTTTATCTTTCTTTGCAGAGATCTC
ATAAATGAACATGTAAAAATTAAGCCAAACAAGCAGATATTTCATAGGAGTCATCAATTC
AGTTGGAAGGAAAAGTACTTAGTTGAGATGTCAGGACTATTGTTAAGCATAATGTAATCC
TACTAAATAGCTGATATTTTTAATAAAACCAAGTTCTGGTGACAATTTGAAGCTTATTTC
TTAGAAGAAAGCCATTGTTACAGGGCTACTTCGGTTCTCATAATTATTATTTTTTACTGA
TAGTGCTTACAGAAAAAGGGAAGTACTTAAAAACTTGTAAGATACAATGGGAGAGAGAAG
TAATACTTGCATTTTTAATGAATATATTTAGTCTTTCTGTAGCTGATTGGGCTGTTTTGC
AAGTTTTAGAGGTTGAATTCAACACTTTTTTTTTTTTTTTTTCCTCACTTTGTTGCCCAG
GGTAGAGTGAGTGCCGTGGTGTCAGCTTAGCTCACAGCAACCTCAAACTCTTGGGCTCAA
GGGATCCTACTGCCTCAGCCTCCCAAGTAGCTGGGACTATAGGCATATGCCACCATGCCC
GGCTAATTTTTTCTATATATATTAGTTGGCCAATTAATTTCTTTCTATTTATAGTAGAGA
TGGGGTCTCGCTCTTGCTCAGGTTAGTTTTGAACTCCTGGACTCAAACGATCTGCCTGCC
TCGGCCTCCCAGAGAGCTAGGATTACAGGCGTGAGCCACTGCGCCCAGCCTGAATTCAAC
ACTTCTTAAGCTTTATTTTGCTTTTCTTTTTCGCTTTGTTTAGTTTCCTCCTTTTCTGCA
CTTAAACTTTATTTTGAAGAAAATAATACACAGGGAAATTTAAAAAATTTTTTTAGAGAC
AGGGTCTTGCTCTGGCCCAGGGTGGAGTGCAGTGGCATGATCATAGCTCACTTGTGACCT
CGACCTTCTGGCCTCAAATATATTTCCTGCCTCAGCCACCCAAAATGCCAGAATTATAGG
CGTGAACCACTGTGCCCAGCCTAGAAATTTAGTTATAGGGAAATACTTCATCCTCTTAAC
TCTAATCTTCACTTGAAATTTTCCCTGTGTTGAGTAATCTAGAGTTTATGACAATTTTAC
TTTAGTGCTGGTTACAGTATGAGGAGGAATGGAGAAACTACATGCTTCTTCATGAGTCCC
TCATGCCTCTTGTGTCAGGCTTTAAAATAGGCCACCAACTTGTCTGCTTTAAGAATTAAG
GACTTTACCTTGTTTTAAATTCAGTAGGAAAACCATTTTAACCAGTTTTCCCTGATAGCC
CAGTTCCTATTGGTGCTTTCACTGTGTTCTTTCCATATACTTTAAAAGGATTTGTTTTGT
TTTTGGGTTTTTTGGACTGGCAAAAATGGAGTTGGACATCTTTCCCTCTGAATTTCCAGC
TCACAAAATCAGTTAATTTTCTTTCCAGGGCTGAGCTCACATTTGTCACTCATATGTAAC
CATAGTGAGATTAAAGCCATGTTTAGTTTTTGTAATTCACCCATCCTATCTAGATTTCTT
AGCTTTTTGAAACAGTACCTGAACATAAATAGATCCACTCTTATTTATCACCCAGGATCT
TACACTATGCATGATTGTTCTCTGTGCCACCTCCCCAGGTTTTTCCTTTCAGATATTTGT
GTGGTCTGGTTAATGCTTCTTAAATGTTCTTTGTATTATGACATTTATGTTAAAAATTCT
GGATTTTATTCTGTCTAGTTCAAGCCTTAGTACTTGGCGAAATCTGTTTTTCATGTAGAC
GTAAAAATGCGCAGTGTATACATGACATTAGAATTAGAACAGTTGCTTTGTTCAGATTAT
AGGAATACTTCGGGTACACCTATGCATTTGAAGATCAGTTTTCTCTCAGTTTCAGATAAG
CTTAGAGATGTCTCATGACTTTGTTCTGTATGTAAGCTTTATCTGTAGACTTTATATATA
AACTTCTTTTCAGTAACTACTTCCTATTTTTGGAAGGATAATTTTTAGGGCCAAGTGAAT
TTGAGACTAATACTCAAAAATGTATTTCAGCTGAGATCTGTGTCTGTGGACCTGAACATT
GATCCTTCGCTTCAGATCGACATACCTGATGCTCTCAGTGAGAGAGATAAGGTTAAATTT
ACAGTACACACCAAGGTAAGTGACAGAATGACTTTGCAATACAAACAGTGCTAGGTTGTA
TTAGCCTTATTAGTTACAGTGGATGAGAGAAGAGATTCCCTGAGCTGAAATGGTTGCTAT
TTATTTATAATGTAGCACTGTTGCTAACTGGGGGACCTCACTTATCAGTCTTACTTGCAT
AAGACAAGGGCTTCAGCATTTCTACTGTGGCAGAGCCCTAGGGCTGTAGGTATTGCAGAT
CTTATGTGTCTTGTACTTTGTTCCATGGGAAAGTGTAGCAGGCAAGGTGAGGCAGTAGGT
GGACCATCTACCTAGGCAGCTCACATCTTCCATCTTTGTTTTTAATTTGCATCTAAGGGA
AATACCTGTCTGTGGCCTGTTTTTCATATTTACTAAGTTGGAAGGACCTCCCCCCACAGT
TTTTTCCTTAATGCCTTGGTGGCTTGGTTAGCATACCTCAGTTATACAGGAGACTGTGTA
AAGACTGTCCACATGATTCTCTGCCTGGGTTAATCTGATCAAAGAAGGTGAAATAAGCAT
TCACTGGAATAAAAGGGAAGGCAAGGACAATTTCCAGAGCAGTAGTAAACTGTGGCTAAG
ATTTTTTTTAAACTGTAATATACTTTCTTTTTTGCTATAACTGGGGTAAGTTCAGACTTT
TTCAGAAATAAAATTAGGGTTAACTTCCTGGAACTTAACTTTTTCTGATAGTCTCTTGCC
TCTTTGGATGTTCATTGCAAGCTTCAGAAAGGTGAAGCTTTGTGAAAAGAATGCCTTAGA
GACTAGGTTGAATCTTAGTTGAGGCTTTAATAGTAGCAAGGAGAGATCCTGTATTATTGC
ATTGTTCTTTATTGGATCTTATTGTGATGTTTTATTGAGAATTTTTCCGTTGTTCAGCCC
AGGAAACCCGAGCCACCTAATCTAAAAGTAATGGTAACCAGTTAATTTCTCCCTCCTTTC
TTTACAGACCACACTGCCCGCGTTTCAGAGCCCAGAGTTTTCTGTTACAAGGCAACATGA
GGACTTTGTGTGGCTACATGACACTCTGATTGAAACAACAGACTATGCTGGCTTTATTGT
GAGTACACTTTAGAAAAATCAAATAATTACCCTAGTTTTCTTCTACCTTGCTATTCATTT
TGTTTAAAGAGACTTCTGCCCGCACCATAATGGATTATGAAAAGTCTGATTTCATCTGCC
TACTAGGGTATTTGCTAACTCGGTTACTGGTAAAGTCTAAAATATGTGAAGAATATATTA
TAGCTATGAATTGAAACATAGTTCTGTACATCGTAAGAGGGTAAATAGTTTAATGATTTA
AGTTATACCTACCCATAGGTTTGTTTTTTTTCCTCTGGTGTTTTCTTCCCGGTATGGTAG
AATTGATTTCCAGGACACCTCAGTATTGGTGGTAGANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNATGTCTTTATTGTCCTGCCAGGCATACTGAGGAGTCTGCCCAAA
TGATGATTGCTTAATAATTAAACAAAATTAGTACTGAAGCTTGTGTTTAGGAATGTTCTG
TTCATTCATAATTAAAATCTTGATTATCCTTTGGAATTAGGAAATTCCTTTTGAAGCCTG
GAAACTTCATAATCTTGATGGTTAATCATTAGTTTTTAGCATTGATGATACTAGTTTTGG
GCCAATATTGAAGCAGTATAGACACTGCTGTGATCTACCACTTGTCTGTAACAGGTAAAG
TGAGCAGGTGATTACAGTCAAAATGAGTGCCCGACTCTGAGGGGGACGCTTCTTTTAAAT
GGCTAGAAGGAATAAGGTTAAGAGAAAAATAGTATTTAGACAGCTCCGCTTGCATAGCTG
CCTCCTGTGCACCAAAACTTACAGGAGTTGCATATGGCACAAACTAGAACATCGCTGCTG
GGCCTGGAGGCTTATGAGTTGCCTGCCTCTGCTGCAGATTCCACCTGCTCCTACAAAGCC
TGACTTTGACAGCCCTCGAGAGAAGATGCAGAAATTGGGAGAGGGTGAAGGGTCTATGAC
CAAAGAAGAATTTGCCAAGATGAAACAAGAACTGGAAGCGTAAGTGCATTTTCTTAGTGG
GCTTTATCTTTCAGTTATTTTTTGAGATGTGATTTTGCTATGTTGCTGAGGCTGGTCTTG
AACTTCGGGGCCCAAGTGATCCTCCCACCTCAGCTTCCTGAGTAGCGGGGATCACAGGGC
TATGTGTGCCACTGTGCCCACCCAGCCCTGTCTTTTGGAAAGTAGAATAATGGTGCTGTG
TACAGAAATAAGTACAAGAACCTAATTAAAAGTATAGCTGTTAATTAGTTGCCTACTGTG
TTTTATAAAACTACATTTTGCAGAGGTTAGGTGGGACATGGTCTTTATCTTTGTATATTG
AGTTCAGAGGCCATTGACACTACTAGATAGACCTTTTTTACCCTAAAAAACTAGTCCATA
CTCACTAGGGAATGCTGGTCTGGCATAGTGAAGAAATAAACCTTTGTGTCTTTAGAAATT
ACTTTTTAAGCTGCTCATGATATACAGATTTTCTTTTGAAGTTTGGTTACTAGAATAGGA
GAAACTAGATTGTAGCGAGTACAGTTACAAAGCAGCATTCTGAATAACCACATGGATGGC
TTGAAAGAGGAAGTCTTACTAGCCTGAGCAAGAGTGGAACCTCACCTCTACAGAAAATAG
GAAAATTAGCTGGGCGTGGTGGTGTGCACCTGTACTCCCACCTACTTGGGAGGCTGAGGC
AGGAGGATCGCTTGAGCCCAGGAGTTGAGGCTGCAGTAAGCTATGATGACACCACTGTAC
TCCAGCCTTGGTGACGGAGGGAGAAGGCCCTGTCTCAAAAAGAAGTCCAGCTCTATAGGC
AGCATATTAAAATCTGGTTGTCACTTAATTATTTCAAACAAAATTGGATTTTTAAAAAGT
TTTTTGTTAAACCATCCTTGAACTTTTCTTTTCTTGGTTCAAAAACATTCACCCCTCCCC
TCTTCCATCATCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNACACCCAAGTTTCTACAGTTGGGAGGTTTAAAGTGATCTTTAAATGTCTAA
ATTGAGATACAGCTGCTTTATAATTTCTGCTAATTACCAAACTTTGTTAGAGTCACGCTG
CACACATGGCGGCAGAATTAAAGGGATTTCATTGTTCTATAGAAACGAATGTTTTGTGGC
TGCTAAATAATAGCAGTAATTGCATGGAGTTTTAGGGGCTCTCAAACTTGATCCATTAAA
TCCAGCTGTAACATCACTTTTCCTCCATTGGTTCATTCCACAGATTCCAAAATGGCAACT
GCCTTATGCCTAACTAGATACCAGGTTATACCAAAATAGTTTTGATCTAGTTGCGTATTT
CATGTAGTAGTGGCACCAGCAGAACCGTAGGGTTAGTGAGAGTGGTATTGGTCAGGTATT
GAGCCATGCCAACTGAATGCTGTGTGTGTCTCTTTTCAGTGAATATCTCGCTGTCTTTAA
GAAGACTGTATCCTCCCATGAAGTCTTTCTTCAGCGGCTTTCTTCTCACCCTGTTCTCAG
TAAAGATCGCAACTTTCATGTTTTCCTAGAATATGATCAGGATGTAAGACATTTTAATTT
CATTTCCATGATATAGTTAAAAATGTTTTAAGACTTTAACAAAATACTTTATACTTTTTG
AAAAATAGTCTATAAGTTCTAAATTTCTTATACAGTGGAACCTCTTTAGATGCTCTTCCC
CCCAGCCAATAGATTTATCATGTGCCATTTTTGTGAAACTCTGCTTAAAGAAAATTTTGA
CTTTTTTACCCTTCCAAAGATTAGTTTTCTCACTCAGTTCTGTTGGGGTTTGTTAGAGTG
AACGTAAATTGATCTTTTTTTATTTTATTTTTTTCTTTAAGAGAAAAGGGTATTTGCTCT
CTCATCCAGGCTAGGGTGCAATGGTGTAATCAGCACTCTGCAGCCTTAAAATCTGGGCTC
AAGCAATCTTCCCAAGTAGCTGGGATTACAGAGGTGTGCCACTGTCCCTAACTAATTTTT
AAACTTTTTGTAGAGATGCGAACACGATCTGTTGCCCAGGCGGGTCTTGACCTCCTGGCT
TCTGGTGATTCTCTTGCCTCAGCTTTCTTAGTTGCTGGGCTTACAGGCTTGAGCCATGGC
ACCTGGCTGTTTTCTTCCTGGCTACTGTTTTTGTAGAAAGGAGACTTGTATGTTTGTTTG
TTTGTTTGTTTTTCTTGCTACTTAATATTATGTGAGAAAGCTCCAATTTAGAAATTTTTT
CAGTGTCTTCTGTCTGGTGAAGCTAGACAAACAGTGTGGATAGAACAGGACAATAATTCT
ACCAAGGATTTAAAAGCCACTAAGACAAAATGCCTAGACAGTTTTTCAAAATATCTCTTA
AGTTAGCCTTTTAGAATGAGGTAGCCTATGTTTAGGAGGTTTTTCCTTATGTTTTAGATT
TGGTGGTTAAGAGAGAATTAAAGGTATCTTATACATGTGCCTATACTAATAAAAAAGATT
ACTTGGAATGTTAATCATAATTTCTTTAAGAGAACCTGGGAAAATATGATAAAATGTTCT
TTTGGAATTTTTTTTCCTTTAGCTCAGTGTTAGACGGAAAAATACCAAAGAGATGTTTGG
TGGTTTTTTTAAAAGTGTAGTGAAAAGTGCTGATGAAGTCCTTTTTTCTGGAGTTAAGGT
AAGTGGCTTTTGGCTGTTTGAGAAAATTCTTGATTTAGAGGAATAGGTGACCTTTTATGT
CATTGGAAGAGACTATTTGTGATACAAATGGTTAACTTTTAAGAAGTGTAAGTTTTCTTC
AAATTTTGGTCATTTTCATCTACTTACTCAGTTTTCACAAANNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNAACTCCACTATAGGTTGGGATTATGGGATGTTTGCATCCATGGCCAGTGCCTATCAGA
TGTCAGTATTGCCTCCCAGTCTAAAACCAACCAGATTGGCTGGGGGAAACACCTACACAC
AGATGCAGGTATCCAAGGCTAGGTGGCAGGTTCCCACTTACAACCACTGCACTAGTGGTA
GAAATTGCTGGGTCCTAGGGTACCAGGGTTTTATTGGCCATTGCCAATTGTCCTTCAAAA
TGGTTCCCTCTGTTGACAGTTCCTGCCAGCCCTTGATTTTTACCAGTCTTGGTTATGAAA
TAGTGTGTTATAAATTTGTGTAATTCTAATACAAAATATATATATTCACATTCTTGAATT
GTCTAGTTCTTAAATTTCTTTTTTTCCTCCGTTTAGGAGGTAGATGACTTCTTTGAGCAA
GAGAAGAACTTCCTTATTAATTATTACAATAGGATCAAGGATTCCTGTGTAAAAGCTGAC
AAAATGACCAGATCTCATAAAAGTAAGTACCATTCATTCCCTGGCTACTTAGAGCTTTGC
TAATGTGTCTGGCTTTGTTCCTCTAAAAAGGACTATCCTTGTTTCTGCAGATGTTGCTGA
TGACTATATCCACACTGCAGCCTGCTTGCATAGCCTGGCTTTGGAAGAGCCCACGGTCAT
CAAAAAGTAAGTTTTTGTTGGAAAAGCATTTGCCATGACTTAAATGAAGACTTTTGATTG
GTATACTTACAAAAATAATAAGTAATGGCTACATAGTTTCAGTTCTGCTTTGTAGATACA
AGCTCATTAAGGAAAGTCTTCAGCTCTCACATCTTATATCCTCAGTACTTAAGACACTTC
TAAGGCAGTAGGGGACTTAGAAAGCTCTTCTGAAGATGAACAAATTTGATAGCTGTTGCC
AAAGCCTTTATTTCTGTCAAACTTAAATGTCTCAGTTTTAATTTTGGACTTGTCTTTGAG
AGAAATTTACCTTTTATCTTTTGGCACTTTTGGTGCTTGTCATTTGCCTCATAGTGTCCT
GGACTTTATTGGTTTGGTTGTGGTGGTCGTGAAAATACTATAATCACCTCAGTCTGATCT
TGTACTTATTTTTATATATGTTTTTCACAGCTCTCCCTCCTGGGCATTTCTGGTGTAAGA
CAGTATTTTGCTTAATACCTAGGCTTGAAATAACAGGTGGTATTACTTCTGATTTGAAAT
TGAAAGTCAAGTTAACGGCAGAAGACAAATGAAGCAGTAGCGTATTTTATAGCTGTGATG
GCCACAGGGGTAGCTCGTTAGAACCTGACCTTGGTTAATACAGCATTGTGTCTGATAAGA
ATTATCCTGGTCACATGGCAAGATGACTAAAAGGCCACCAAGAGAGGTGCCACTGGGTGA
CACAGTAACCATTCTCTCTCTACTGTGCTAGGCCAATTGGAATGAAAGGACTATTTTAAA
GTGCTAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNATACAGTGTTTAGTTTTTTGAAATTACCTACAGTTATTGAATCAACTGGGAAAAA
ATTATTCTGTTTTTAACTCTATTGGAGTTTTCCCCTGGCCATATAAAGAATTCTGGGAAA
AGCTCTCAACAGTGCTGCCAGAGTTGCTCATCCCTATTGAAGCTGGAGATTAAATAACAG
TGGAAACGGGAGGTGTAAGGGTTGATTAGGTTCTTGCCATCTAACAATTTAGACAGTGTA
TTGGCATTGGGTACATGGTTAGACTGGTTTAGATATTTATTTAGTCCTCCAGTTCTCTGT
AGTTTATGTTGTGCCTGTTAATTTCCTTCTCAGGATCTCTTATACAGACGCACCAAAGCC
CTCATTGACTATGAGAACTCAAACAAAGCTCTGGATAAGGCCCGGTTAAAAAGCAGAGAC
GTCAAAATGGCTGAGGCACACCAGCAAGAATGCTGCCAGAAATTTGAACAGCTTTCTGAA
TCTGCAAAAGAAGGTCAAGCAGGGATATTCTTTTCTTTGGAAATAATTTCAAGCTTACAG
AGGAAAAGTTGCACAAATAGTGCAAAAAACACCCATCTTCCTTCACCTGGCATCATCCAG
TGTCAGCACTTTGCCCCCATCTACTGTATCAGTAATGTACTCCACTATAAGAACCAGTCG
AGGATTTCATCTAGTTATCTTAGCTCTTAGTCCTTTACTCTGGAACAGTTCTTATTCATT
TTATGTCTGATATGCTAATTGTGTTCATTGTTCCTGGGGTGTCTCTCTCCAGGCCCTCTG
TGGCAGATGGAGCCAGGAAATGTAGGTGTGTGTGTACACGCACAGAGTTAGTTGCACACA
TACACAGGTTTCAGGGATGCTGAGACTATACTGACTTCCAGTCCATGTCCAGGATTCTTT
CTTGCCTTCCTGTATTCCAGAGCAGGGGACTTTTAAAATTCAGGTTAACTTTATTGGGAG
GTGGTACACCATTTCCATTGAACATGAATGTAGTATGTAGTTTTTATTCTTCCTTTCTTT
CCCTTTTATTTTTTTAAAGATAGGTTCTCACTGTCACCCAGGTTGGAGTGCAGTGGCCCG
ATCATAGTTTACTGCAACCTTGACCTTAGCCTCCCAGGTAGCTAGGACTATAGGCAGGCA
CCACCATGCCTGGCTTATTGCCTAGGCTGGTCTTGAACTCCTGGCCTCAAGCAATTCTCA
TGCCTCAGCCTCCTGAAATGCTAGAATTACAGAGCTACCACACCTGGCCATAATATGTAG
TCTTTACCCTAGAGGATCTTGAGGATCTTTTGTGGGGATCGTTCTCAGAGGCCATGGAAG
GTTGTAGAGCAAATGTTCAAATGTATCTCCCAGAATGTGAATGTAATAATAGTAGGACAC
TACACTTGACTCAACCCCTACTTCCCCCTAAATAAACAAGCCTTCATGAAAGTGGAAATC
CCCATTTCATTTAGTTTTCTCAGGCATATTTTGTTTTTCCAATGATAGGAAAATCTAGGC
ATGTCTGGTAGTGTCCCTATGACACCAATGGTCTCTGTTTAGTAACATGCTTGAAAGCTA
CCTGGCGTGTCTAAACCTAGGCTTTCTGGGATTTGTCTTTAACTGTAAGGCACAGAGCTT
CTCTTTATTGGAACTTGGCAATGTCATGCAGACGCACTGGGCTGTTTTTGGGTTTTTCCA
AAGTAACCTTCATATACTGCCCCATTCTTAAATTATTATAGTTCTTTTTTTTTTTTTTTA
AGAGCTAATAAGCTTATAAGGAAAAGTATGTACTTCAGAACTCTGAGTTGAAAGGTTATT
ATATAGGCCAATTTAGTGGCTCTTGACAGTTTTAGAGGAGATAAAAGAAAAACCACAAAA
GTCAGAATGGTGCCAATTTAGGCCTAAACTACCTAAGCTATCCCCTTGTGTTGTTTGATT
ATATCCTCTATTCAAAATGTAAGCCTAGGTATACTATACTAAAAGTATAGTATTCTGTAG
AATGCTGAGATTGCTAAGTATTAGCCTGTTTGCCTTTGGTATGAGTTCTTTCTAAGGTTT
GTATCTGAGCTGACTATACGAGTTCAGTCAGTTTGAGGAACATAACACAAAAATGGTGGT
GAGGGCAGGTATCACAGGAGATGGATATTAATGTGTATCTGTCTCCTGTGGTCCTGTGTA
CAGATGGCCTGGACCTATGTGCAGGTATAGAGGAAGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCCTGGTTAGTTTGAAATATACATGCCTTTTTTTTTTTGTTTGAGACA
GAGTCTTGCTCTGTTACCTAGGCTAGAGTGCTGTGGCGTCAGCCTAGCTCATAGCAACCT
CAAATTCCTGGGCTCAAGCGATCCTCCTGCCTTAGCCTCCCGAGTAGCTGGGACTACAAG
GCATGCGCCACCATGCCCGGCTAATTTTTTCTATATATTTTTAGTTGGCTAATTAATTTC
TTTCTATTTTTAGTAGAGACGGGGTCTCGCTCTTGCTCAGGTTGGTCTCAAACTCCTGAC
CTTCAATCCTCCTGCCTCCACCTCCCAGAATGCTAGGATTATAGGCGTGAGGCACCACGC
TGGCCTGAAATATACATTACTATTGACTGTAGTCATCCTGCTGTGTAACAGATCTCAAAA
CTGTCTAGCTGAAGCTTTATATCCTTTGAGCAGCAATTCTCTCTTTCCTGTACTTCTCTC
ACCACTGCCCCGCCCTACCCCCAACTTCTGGTGACCATCATTCTTCTCTCAATTTTGCCT
TATTTTTTAGATTCCACCTATAAGTGAGATCATTCAATAGTTGTCTTTCTGTTCCTGGCT
TATTTTACTTTGCAGTGTGTAGATTTATCTGTGTTGTCCCAGATGACAGACTTTTGTTCT
TTTTAAAGGCTGAATACTATTGTGTATCTATTAATATACCACATTTTCTTTATCCATTGA
TGAACATTTACATTTATTTTAATAACTTGGCTGTTGTGAACATGGGAATGCTTTGACATA
CTGGCTTCCCCGTTCCTTTGAGTATATTCCCAGAACAGGGATTTCTGGATCATATGGTAG
TTCTGTTTTCCATAATGGCTGTGTTAACTTCATCTTATTGATAAAATCCATTCTAAAGAT
GTGAGGTTATAATCTTATTGTGGTTAATTTGCATTTCTCTAGTCCTTAGTGATGCTGAAC
ATTTTCATAGGCCTGTTAGCCACTTTTGAGAAGAGTTGTCACCCTGTTTTCAAAAACCAG
TGGTGAAGTGAAGTGTGTCTGGCTCACCACCACCCCTCCTTCAACCCTGTCCTCCGTCAT
CAGCACCTGTGCTGCTCATCACATGTTCCCCAAGTAGTCAGCTGCCATTCTCCCAGTAAC
GATGCTTGCTGATTGGGTGCTGTTGTCTACTTAAAAGCAATGACATCCACATTACCAAAG
TGAGCATAAGATATTTAGTATGTGTCGCAGTCGCAGAGATAATGTGAGAAAATAATGATT
GTACGTGAAACCTTTGGAGATTATTTGTTAGGAATATTTGAAAGTTAAAAGTGAATATAA
GACTTGTTCTTGGATTTGTAAACTTTAACTATTTCTTCCTATAGAACTGGTAAATTTCAA
ACGGAAGAGAGTGGCAGCATTTAGAAAGAATCTAATCGAGATGTCTGAACTGGAAATAAA
GCATGCCAGAGTAAGTGGGGGGGGGTTGGTTGTTAGTGGTTATTGTTGGTTTTTGTTTTT
TTTTTTTCTTAAATTAATCCAACTTGTTAGGGGTTCCCCCCTAAATTTTTATCCCAGTGT
CATCAAACAGTGGGGTTACCCCATGCTATTAATACTTGTAGAGGAAGGCAATAATGGGAG
TATTTTTGCTACAGCAAACCATAAATTCACATCTTGAAATACTTTCTTGAGAGGAGCATT
GTTAGTGGAGGCTGCCCTGCCTGACTCTTTAAGGCCTTTGCAGGCCACTCTCTGAAGAAC
CCAGTTTATCAATAAGCTCTTCAATATCTTGCTTTCTTGGAAACCGTTTTTCAAAGAAAT
TGCTTTCTGGTTTGCTAAGTGTATTCTGATAATCCTGTTGTAGCTCAGAAACAGTGGAGA
GCAAGTGTGCTCTGCTAGGGATCTCTTAGGAATGTGGTGCTTCCCACACTCAGTTTCTGG
GGGTGGTTTCAGGACTCAGCTTGGCCCTAGAGTGCAACCTCGTTCAGGGCAGCTAAGTCA
GTCCTCAGACCTGAGAGGCCACAGGAGGGAATTGTCACTGGCTTTCAGCTTTGATTAAAG
TAGGAAGACTTAAAACATTGTTACGTATTTTGGAAAATCCTTTGTTTTGACTAGAACATA
GATGTGTTTATAGTTACTTGCCTTTTGAAGTTAATGTGAGGACTTTATAAAGCAATTTTT
GCAGGTTCCTGTATGAATATTATTTATAATCTCATATGTAATCTTACCCATGACTGATTT
TTAGTAACCAGTCTTTCTAAGGCCTTCAACTTCATAGAACACTTTTTTTTTTTTTTTTTT
TTGAGACAGAGCCTTGCTCTGTCACCCAGGCTAGAGTGCTGTGGCATCAACCTAGCTCAC
AGTGACCTCAAATTTCCTGGGCTCAAGCAGTTGTCCTGCCTCAGCCTCCCAAGTAGCTGG
GGCCACAGGCGTGTGCTACAATGCCCAGCTAATTAGTAGAGATGGAGTCTCTTGCTCAGC
AACTCCTGATCTTAAGCAATCCCCCCACCTTGGCCTCTCAGAGTGCTAGGATTACAGGAA
TGAGCCACCACACCTGGCCAGAACAACTTGTTTATATAGCGTTTAGGTTAAGACTTTAAG
CAGGGCTGACATAATCACATTTGGGAGGAAACAGGTAAGGGCAAAGGTGCTGTAGCTCTT
TCGCTGGGAGCCTCTCCCAGCAACAAACAGCCCAGACCCACAGAGACAACTCTTCCAGCA
TGACCTAGGGATGAGGGGCAGGTTGCAGCCAACTGAGATTTAATGAAGGAAGAGTAGTGT
CAGCCTAGTCTGGCTGGTGACAGATCTCTGTTCAGAAAAGCCATGGCTGTGTCTGTGGAC
TTGTGTTGTATTCTTTTTTTTTTTTTTGAGACAGAGTCTCGCTTTGTTGTCCAGGCTAGA
GTGAGTGCCGTGGCGTCAGCCTAGCTCACAGCAACCTCAAACTCCTGGGCTAGAGTGATC
CTTCTCCTCAGCCTCCCAAGTAGCTGGGACTANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAC
AACTGATCTGCCTTTACTCTGAAGGAAGGAAATGAATGTGAAAGAAAGCCAAGCATCACT
TGCACTTAAATCATTACACGGAAGACTTACTAGTTTTGACTTTAGTTTAAAATTATGTGA
ATAAATATTTTGATTTCTAAAAATCTTAACACTTAACCATGTTGGTTTAAAAATTTTTAT
TGCATGCTCGTTGGACATAACTAATCTTTTCCTTATGCATTTAATACCTCAAAGTGAGCA
GAATCTAAATACTGAGTTTTTCTATAGTTTGTCTTTAGTTACTAAGGAAGGGTGTAGGAG
ACATGTGCCTTTTGGAAACAAGTAGAAGCAGTCACCTGGCCCGTGTTTGTCTCATGTTTT
GTGTGCCCATGTCCCTACTAATTGTCAGGGAGGTGCCAGTTACAACAAATAGCTACTTTG
TCACAGGTAAGACATTCCATTCCTTAATATTTTTTTTGCCCTAATACTCCCATTACCTCA
AGTGTTTGTACTATAACAACAACAAGAAAATCTCATATCTTTATACACTGTTTGCAGCTC
CATTTTTATAGTTGGGATATAAATACTGAAGGGGGGAAGAGATGTATCTAAGGCTATATA
GAGAAAAAAATAATGGGGCCTCCTTTAGAAGATAGCCACTTCACCAATAAGAAAGATGTG
AACTCCCTCCCTAATGATAGTGGGAGATACATGTGTTTGGGCTTTTGTTTTTTATAAAGC
ATATAATAAAATAATAAATCATGCTACCATTTGAGTGTTTTTATGGAAAACAAGGCCAGG
GCAGGGTGTGCCATAAATGTAGTTGCACTAAGCCTTGGCTGTGGTGAGAGGGCTTCAGTG
TCTTGCTCAGCATCCTAGGGGCCTTTGTTCTAATCTTAACATTTTTCGACACTACAGGCC
TTTTTGAGAAGTTCCCTACATCTGGGATTGTCTATTTGCTCCTGACTTGATTGAGGTTTG
TGGTTTTTGCCAGGGACTTTAACATGGGGATTCTGTGTCCTCAGGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1051, 26790..26894, 27847..27957, 28897..29018, 30639..30762, 31762..31857, 33156..33261, 33350..33425, 35113..35152, 35253..35339, 36573..36732, 40724..40809, 42855..42905
1001..1051, 26790..26894, 27847..27957, 28897..29018, 30639..30762, 31762..31857, 33156..33261, 33350..33425, 35113..35152, 35253..35339, 36573..36732, 40724..40809, 42855..42902
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved