Microcebus_murinus Locus GLTSCR2
snOPY snoRNA Orthological Gene Database
Microcebus_murinus GLTSCR2
Microcebus_murinus
GLTSCR2
GeneScaffold_140
SNORD23
10513..10623
12621
TTATTTGTCAGTAGCCACGACTCGAGGAGTCCGAGATGAAAGCTCTCGGGGCCAGGCGG
TGACGGTAGCTTAGCGTTCGGGTGCCGGGCTCGGCCTCGTCCCCTCGCTTCATCTTCCGA
ATAATCTGTGAGGCAGATGTGCCACTATCATCCTTATGTCGCAGATGGGGAAACTGAGGC
ACAGCGAAGCAGCCTTGCCCAAGACGAAAGATTCTCAGTCTGCGCTCGCAAGGCCCTAAC
AGTGTATGTTTTTAGCGTCCCTCAAATGCAACCTTCTGTGCTTCCAACTGCGACATCCCT
AAGCTTCTTTGAGTCCTGAGATTCCAGGGTTGGAACATTGAGAGGACAAACGCTCTCAGA
CTGGAACTCGTCCTGGGCAGAATCTGCCTGCGCTTACAGTTCTGATTGTTTCTTTTAAGA
AAACGAGATTCTGGGAGGGCGAGGCAAGGGGATCGCTTGAGGTCAGGAGTTCGAGACCAG
CCTGAGCAAGAGCGAGGAACCCCCCCCCCCCCTAAAAAAACTAGAAATATTAGCCGGGCA
TGGTGGCACACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGGATCGCTTGAG
CCCAGGAGTTTGAAGTTGCAGTGAGCTATGAGGACGCCACTACACTCCAGTCCCGGGGAC
AGAGCAAGACTCTATCTCAAAAAAAACAAAACAGAGATTTAAATATATAACCAGCTTGAG
CAAAGACTCGGGGCAGCCGAGGAAAGTGTTTTGCGTAGGACGAGAGCCTGGAACTTGTAA
CCTCTGCCCCGCCCCCGCCGCTAGGAATCTACAGATCTCATAGCAAAGAACGAAGGAGGG
AGGAGCTAGTTGTCCTTAACCAAGATGGCAGCCTCCCCGCCCCTTTGCACTCTACCAAGA
TGGCTCCACAGGAAGTACGTCAGGAATGGGGTGGGGCATCTGCGCGCGCACGCCAGAACG
GGATTTTGGGGCACCGGCGGCTGAATTCTTCCTTTGGCAACATGGCGACGGCAAGCAGTG
TCGGCGGTGGCAGGCCCCGCTCGAAAACCAATGCCGATTCTGGTTTCCTGGGACTGCGGC
CCACTTCGGTGGACCCGGCGCTAAGGCGGCGACGGCAAGGCCCGAGAAATAAGAAGCGGG
GCTGGCGGCGGCTCGCTCAGGAGCCGCTGGGGCTGGAGGTTGATCAGTTCCTGGAGGACG
TGCGGTTGCAGGAGCGCACGAGCGGGTACGTGGGGCGGGACTTCCGGGAGCTGGGCCACG
TTCTGCGCGGCCAGGTGCGAGGCAGAGCGTGCTTTTGGGGGGCGGGGGCCCTCCCGGGAA
GCTGAGAGCCACCTGTCCCCAGGTACCTCAGGTACCTGGTGGGGATACTCCCCTGCCGTG
GGAGTCAACAGGATGGGCTGCGGCCTCAGGGTGGGAAGCTGGCGAACATGATAGAGTTAC
CAGATTTAGCGAAGCTTGGTGTGTTTCAAATATTAAGTATTGTAAACTGAGGGGCGAGGC
GTTAGCCTAGATGGCGGGAAGAGGGTGCTCGAGTGAGCGTAAGAGGAAGACTGGACCCCG
TGAGATTAAACCTGTACCCTCCCCAACATCTTGGGCTGACGTCTGCGTTTCCATCTCCCA
GAGGCTTGGTTTCGGAGGCCCCTGATGAAAAACTCTTCTTCGTGGACACTGGCTCCAAGG
AAAAAGGTGAGGAGGGGCTTTTGTGGCCTGCAGCCTCTGAGATCTGTGTTACAGACGTGG
CTTGGAAGACAAATAACCTGCTAAAAGGGTCAGCTTTTTTTTTTTTTTGAGACAGGAGCC
CAGGCTAGAGTGAGTGCCGTGGCATCAGCCTAGCTCACAGCAACCTCAAACTCCTGGGCT
CAAGCAGTCCTCCTGCCTCAGCCTCCCGAGTAGCTGGGACTACAGGCATGCACCACCATG
CCCGGCTAATTTTTTCTATATATATTAGTTGGCCGATTAATTTCTTTCTATTTATAGTAG
AGACGGGGTCTTGCTCTTGCTCAGGCTGGTTTCGAACTCCTGACCTCGAGTAATCCGCCC
GCCTCGGCCTCCCGGAGTGCTAGGATTACAGGCGTGAGCCACCGCGCTGCCAAAGGGTCA
GCTTTGATGTAAACAAGAAGACCTTCAGTGGACAGAAAGCAATATACAAACTAAACTTTT
TTTTTTTTTTTTTTTTGAGACAGAGTTTCACTCTGTTGCCCGGGCTAGAGTGCCGTGGCG
TCAGCCTAGCTCACAGCAACCTCAAACTCCTGGGCCCAAGTGATCCTCCTGTCTCAGCCT
CCCGAGTACCTGGGATTACAGGCATGTGCCACCATGGCCGGCTAATTTTTTTTTTTTTGA
GACAGAGTCTCACTTTGTTGCCCAGGCTAGAGTGAGTGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCCCGAGTACCTGGGATTACAGGCATGTGCCACCATGGCCCGG
CTAATTTTTTTTTTTTGAGACAGAGTCTCACTTTGTAGCCCAGGCTAGAGTGAGTGCCGT
GGCGTCAGCCTAGCTCACAGCAACCTCAAACTCCTGGGCTCGAATGATCCTTCTGCCTCA
GCCTCCCGGGTAGCTGGGACTACAGGCATGCGCCACCATGCCCGGCTAATTTTTTATATA
TATATCAATTGGCCAATTAATTTCTTTCTATTTATAGTAGAGACGGGGTCTCCCTCTTGC
TCAGGCTGGTTTTGAACTCCTGACCTTGAGCAATCCGCCCGCCTCGGCCTCCCAAGAGCT
AGGATTACAGGCGTGAGCCACAGCGCCCGGCCGCCGGCTAATTTTTTCTATGTATTTTTA
GTAGGCCAATTAATTTGTTTTTATTTTAGTAGAGACGGGTCTCCCTCTTGCTCAGGCTGG
TTTTGAACTCCTGACCTTGAGCAATCCTTCTGCGTTGGCCTCCCAGAGTGCTAGGATTAC
AGACGTGAGCCACCGTGCTCGGCCTACAAACTAACTTTAAAAAGGTAGTTTTTTTGGTTT
TTATTTTATTTTATATTTTTGAGACAGAGTCTCACTCTGTTGCCTGGGCTAAAGTGCCAT
GATCGTGAGCCCTCACAGGTGATCCTTGTGTTTTGTGCTTCTGAAATAATTACGTGTTCA
CAACAGCCTAGCTCACAGCAACCTCAAACTCCTGGGCTCAAGCAATCCTCCTGTCTCATC
CTCCCGAGTAGGTGGAACTACAGGCATGTGCCATCATGCCTGGCTAATTTTTTGTATATA
TTTTTAGTTGGCCAATTAATTTCCCTCTATTTTTAGTAGAGATGGGGTCTCGCTCAGGCT
GGTTTTGAACTCCTGACCTTGAGCGATCCTCCCACCTTGCCCTCAGAGTGCTAGGATTAC
AGGTGGGAGCCACTACATCTGGCCAGGTGTTTTTCTTTGTTGTTTCTTAAGGTCTCAGTG
ATCTCCATGCACAGATAAGCCTGCCTTGATGAATAGGTTAGAAATAAGTTAGAGGGTCTC
CTGTTGGCATACAGAAAAGTAAGTCAAGGACTTGCTTGAAGGAATCAGACCGATTTTAGT
TGGTAAGAGCAAGAGAGCCTGTGTTACTGAGCAGGTAAGAAACGAATCTTAACCTGCTTG
CTTTAATTTGCCAGAATTCAGGGTCAGGACCTGCTGAAACAAGTGGAGGACCGAGTTAGT
GGTTACTTTGAGTAATAGGGTTGACGTCAATACATAGAAAAACAAACTAAGAATAGATCA
TTTGCTTTAATGAGGGGACTGAAAACAAGCTGAAAGTCTTTCTATTGAGCTTGTATGACA
AAATCAGTTGATGGGTCTGTTTTAATAAAGATGGGAGGATCTGTTTCAATGAGCAGACAG
AGTGGAAGGACCGTTTGAGGCATAGAAGACTCGATGAGCAGGTAAATAGAGGTTAATTAG
ATCAGCTTTCACGGAAGTGAGTGGATCTGCTGTATGAACAGAAAAGAAAAAGTCAGGGAC
CTGCCATTGACAGGTGAGGTAGTGTTAATAGTTAAGGGCTTGCTTTAGCCAGGGGCTGAT
CTCTTTAGGGAGTAGAGAAGAGGCATCTTATGGGTTCAGTTTTAGTAAGACAAGTGTTGT
GGGCAGGCCGGGCGAGGTGGCTCACGCCTGTAATTCTAGCACTCTGGGAGGCTGAGGCAG
GCAGATTGCTCCAGGTCAGGAGTTCGAAACAAGCCTGAGCAAGAGTGAGACTCTGTCTCT
ACTATAAATAGACAGAAAGTAATTGGCCAACTAATATATATAGAAAACATTAGCCGGGCA
TGGTGGCGCATGCCTGTAATCCCAGCCACTCGGGAGGCTGAGGCAGGAGGATCACTTGAG
CCCAGGAGTTTGAGGTTGCTGTGAGCTAGGCTGACGCCACGGCACTCACTCTAGCCTGGG
CAACAAAGTGAGCCTCTGTCTCAAAAAAAAAAAAAAAAGAGCGTGGGCAAAGAGAATAGT
GATCGTGAGCCCTCACAGGTTATCCTTGTGTTTTGTGCTTCTGAAATAATTCCATGTTCA
CAACAGCCCTGTGAGGGAGCTATTAACTTCCTTAGTTTGCAGGCACAGAGGAGTGAAGTC
TCTTGACTTCCCACCATACAAAGAAGGGGACAGTTCGGTCCCAGTACGTTTTGTTCTAGG
GTTCTTGCTTTTAACTGTTGGCCTTTAGAAGTAAAAAGCAAAGATCTCAAGCTATGCTGA
GAATCGGCCGTCCAGGGCTTCAGTGTCACCTGACCACCCGGTCTCTCCTTGTTTTGTGGC
TGTTTCCCTGCTATGTCTGGGAGCCCCTCATGTACAGGGTGGTGGGTGTGACTCCCTCTG
TCCCCAGGACGTGGGTGTGGTGGAGGGTGAGGGCTTGAGCACCTTGGGCCCCACCCTTGG
GGGCCTCTGCTCTCAGTTGGGAGCCTGGGGTCAGTCTGGGGACCTCCCGAGTCTGCACTG
GGATGACTTGGGATGCAGATGTCATGGCTCCGATGGAGCTGAAATTGGGGGTCGGGGGCA
GTGGCAGCAGTCCTTGGTAGTGGGGAAGCCCGAGGCCTTGACAACTCCTTTCTCCCACTC
GCAGAGCTGAAAAAGAAGAGGACCAAATTCCAGAAGAAGTCACTGCTTCTCAAGAAACCC
CTTCGTGTCGACCTCATTCTTGAGAACACATCCAAGGTCCCTGCCCCCAAAGAGTGAGCG
TCCCAACACCTCCTAGCCCTTCATTCCCACCGGACCCTGGACCTAAAGGATTTCTGGGGA
GGGGGCGATAGATGAGGGTCATTTGGAGGGGAGGGTGGGGTCAGATTTGGGTTTGGGGGA
TTGGGGGGAGTGAGACTGGGTGCCAGGGTGCTGGGGCCGAGGCAGGCAAGGAAGGGGCTG
GGCCTGGCTGGGGGCTTTGGGGACAGAGCGAAGGGGGTGGGTGGGAGCCATGTTTGGGAG
GCACATCAATAGGGGGAGAGGGTGGACAGGTGACAGCCAGCCAGGCTGCCCCTGAGATGG
GCGTAGGAGAGGAGGAGTGGGTTTTGGGGTGATGCTGAGGTTGGTTTTGACGTGGTAGGT
GTGAGGTGCTGGGGGGGGTGGCACCCAGGACAAGGCTATCACTTGGTCCGTCTGGGGCTC
AGGAGAGAGGCCTGGGCTGGGGACAGACATGGCGAGAGGGGGTCTCTGAAAGGGAGGCCA
GGCACGGCCTTCTGGGGAGGGGTCTGGGGGAAGAGCTGTCTGACCGGTGGGGGCTCAGCT
GCTTCTCCGGCTGTCACCTCACCCTCCACACTGTGCTGCTTCTCCCCGGCCAGCGTCCTT
GCTCACCAGGTCCCCAACGCCAAGAAGCTCCGGCGGAAGGAGCAGCTATGGGAGAAGCTG
GCGACGCAGGGCGAGCTGCCCCGGGAGGTGCGCAGGGCCCAGGCCCGGCTTCTCAACCCT
CCCCTGACCAAGGCCAAGCCCACGCCCCAGGACACCGTCGAGCGGCCCTTCTACGACCTC
TGGGCCCCAGACAGTGAGTGATCCTCCTGTGAACAGCCAGGGGCCTGCCACGTGCGGTTG
TGTGTGCTGTGCACCATACAAGAGCACGGTGTCTAAGGCGGTCGTCTGTGGGTATTGCTG
TGACAATCTCCCGGCAGAGTCCAACGTCTCGAAGTGGTGCCCTTTCCCCGTTCATGCTTT
TCTGAGTCCTGGGGGCTCCTGCCGTCCGCCTTGGGTCTCCTCTCCTTTCTGAACCCTGTC
CAGACGTGGTTTTGCCTGTTGTTCAAGGCCTGAGGGTCTGAGAATCAATCCTACCTTCTT
CCTGAGCTTTAGTCCCACCTTTCTGAAATCCAGAGGGTTTCGAGGGAGGGGGCCACGGGC
CTGCCGCACACTGGGAAAGCCCCCAGCAGCCGTCCTCCCCGCCTCCACAGACCCTCTGGA
CAGGCCGCTGGTGGGCCAGGATGAGTTTTTCTTGGAGCAGACCAAGAAGAAAGGAGTGAA
GGTGAGACGCGTGGGAAGGGCTGCCGGGGTGGGCGGCCTGTTCCTGCTGTACTGTAAGGT
GCGGCTGACATGGTGCTTAGCTCACGGGACGGTTGGGAACATTTTAAGGGGCGATGCGTG
AAACAGCCGCGAGCAGTGCCTGGCACGTGGTGGGCGTGTTGTGTGTTTTAGTGACGATTT
GCAGCTGTCTTCGTTCTGAGCAGCTCGACCCCAAGCATCAGGTGCTTTGGAATCTCTGGG
GTCCGGCTTCTTTCCTCTGCCCTCCAGGTGCTCGAGTGCAGCAAGCAGTAAAGGTGCTGG
GACTGGTCTCATCTGCAAGTTCGTCTAGGGTTGGTTCTTTGACAGGCGGAGGTCAGTGAG
CTGCAGGGCAGCCGGACAGCCAACGTGCTTCAGGGAGGTCTGTGAAGCCGCAGCTGGGAA
GAACACAGTACCCAGCGGCGTTAAAAACATGTCGGCGAAGCAAAGGGAGCATGTGACGCC
CAAGATAGGAAGGGCGACCCTTCTAGGTCGGGCACATCCAGGGACTGAGGCTGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCGGGGAGGCAAGGGAGCAAGTGAC
GCCCAAGATGGGAGGGGCGAGCCTCCAGGTCGGGCACAGCAAGGGCTGAGGCTGAGGGGT
GGGACTGAATGTTTCTAGAACCATCAGGAGGCCGGTGTGGTCAGCAAGGAGCAGACCTGG
GGACAGCGCTTATTCTGGGTGGGGTGATGGGGCTGGGGAGCCCCCAGAGGATGCTATGAG
AGCTATGGGGTCCAGGTGGCCACTCCCAGGTGCTTGGACTGTGGCCGGGCCGGCTAGCAG
GGCATGAGGGTAGGGCCCGTGACAGCTGTGCCGGGGCTGCAGGTGATTGGGGACAGAGTC
CTAGGACAGAAGCACCAGGACTCACCGGTGGTTGCTGTGGGAAGAGCTTGGGGGGCATCC
GGGTGACCCCCAGGCTTATGCTGGTGACCAGCAGGGCCTTTGATAAGGTGTTAATCCCAT
GCATGGGCGTAGTCCTCGTGACTGGGTCACCTCCCAAAGGACCCACCTCTTAATGTTGGC
AGTTAACTTTCAGCTTATGAGCCTGGGGTGATAGGTTCAGACCATAGCTTGGCCTTACTC
TGCCTCTGCTGTGTCCTCCCCAGCGGCCACCACGTCTGCACACCAAGCCCTCTCAGGCTC
CCGCCGTGGAGGTGACGCCTGCTGGAGCCTCCTACAACCCGTCCTTTGAAGACCACCAGG
TACTCGGCGCCCAGCCCTGTCCTCACCTGAGCTCGGCCACCCAGTCGGCGTGCCCTGGCC
AGGAGCCTGCCGGTGCTGGCATCTCAGGCGTGACCGAGGCGGCCTGGGCCTGTCCTCACA
GGCTCCCCGCCAGGTGGGGGCTGGACTGCTCCCAGTTACCAGCCATATACATCGAGCCCA
GGTGGGGGGGGACGAAGGGACAAAACCCCTTTGCTGGAGGTCAAGGTGATGGCCGCAGAG
GTGGGATGCGCATTTGAACGGCATTCGGCGCTGTTCATGCGAAGGGCTCTCGGCCACCTG
GGAGCAGCATTCGGAGTAGGCTGTCACTGTTCCAAGGGTTTGGCCCCAAGCAGAGGACAC
ACCTAACTCCAGGGTGGCCAGTGTGGACCGGACGGGAGGGTGGGCCCTACAGGACAAGGC
GTGAGGATCAGTCTTTTCTGTCTGTCTTCGTGTAACTGCTTTGCACAGCTGCGTGTTCGA
ACCGTGCAGTCACCTGCTTACAGCATGTGTGATCTGATGGCTTTTAGTGACCCGTGTGTA
ATATCTCAGTTCGTTTTAGAACATTCTCATCACCAACCCCCAGAGAAACTGCAGGCCCGT
CAGCCATGGCCCCCCAATTCCCTGTCTCCCCTAGTCTTAGGCAGCCACCAAGCGTCGTGC
CTCTGGGGACTTGCCTGTCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGAGAAGCAAACGGATGTGACGAAGCTGGT
GTCAGAAAAACAGTTGCTGGGACGGCACCCGAGCAGCTGCAATGCGACAGGGACGGGGCG
GAGAAGGCGGGAAGGCCCCAGGCTGGCTGGTGCCAGCCGGACCTGACCCCACCCTGTCCC
CGCAGCGGGCACAGCAGGCCGCGGTGCGGGCCGCCCGGCTCCGGCAGCAGGAGCTGTTCA
GGCTGCGCGGGATCAAGGCCCAGGTGGCCCGGCGGCTGGCGGAGTTGGCGCTGCGGCGGA
GGCGGCGGCAGGCCCGGCGGGTGGCCGAGGACGACAAGCCCCGCAGGCTGGGGCGGCTCA
AGTGAGGCCCGGGCTGGGGACCCCGGGGGAGGGGTCCTGCCCCCACATCCTGACACCTTC
CTGCCTTTGCTCAGGGTCCCCTCTGGAGAGCCCCCCAAAGCCCTGTGTTCTCAGGGGCCC
ACCCTTCCCCGGGAGGGGCTTTGGGCTTGGTGTCCCCGAGCCGTGCCAGGGACTGAGTCC
CCTGAGCACCTGCCTCCTGCCGTCCAGGTACCAGGCCCCCGACATCGACGTGCAGCTCAG
CTCGGAGCTGTCAGACTCGCTCAGGACGCTGAAGGTACCTGCTTGTCCGGGCAGCGTGGG
CTGTGGGGGCCTGTGCCCGGTGATGACACCCATCCTTGCTCCCCGTGCCCCCCAGGGGCT
GTGGGCGACACATGGCTGCCCCCGGGCCAGGCTGGTTGGGGCCGGTGCCCGGGGGCTGAG
GGCACAGGGTCCTGGGGTGAGGGGCCGGGTGGTTTTCGGGCCCGTGGCCCTCAGAAGGCC
AGTCCTCCAGCCGGGTCCCTGTTGCAGTCCTGTCTCCCGGCCTCCGTCTCACCCTCTTCA
GGACTAAAGGAACCTTGCTAAAGCTCCTGTCCTTCCTCAGCTCAGAACCTGCTGTGGCTC
CCCAGTGCCCCGAGGACGCCCAGCTCCTCTCCACAGGCACAAGCCCCGTGTGGCCGGCCT
GGTTTGGGGTTCCAGCCAGCTGTTTCGGGGGGCCATGCGCCATCTCCCCGGGACCTAGCC
TTGACGCTATTGTCCCTCTGGGTTCGGTACCTCCCAGCTGAGAGGCGGCCGTGGGTTGGT
GGCCGTCGTCCCCCAAGGCCCGGCACCGTGAGCACAGGGCCAGGCTGGGGAGCCAGAAGG
GCCTGAGCCCCGCCGGGAACCCCCCACCACCCCCAGTCCGAGGCCCTCGGTTTCTGCCAG
GCCCCGCTGAGGGCTCCCTCCCGCTCTGTCCCACAGCCCGAGGGCAACATCCTCCGAGAC
CGGTTCAAGAGCTTCCAGAGGAGGAATATGATTGAGCCGCGCGAGAGAGCCAAGTGAGGG
GCTGGGGCTGTCTGGGGGTGAGGGCGTCTGGAACCCACACTGGGCTTGGCGAGGTCACGG
GTCACCGAGCGCTCCTTCGTCCTTTCCGCAGGTTCAAGCGCAAGTACAAAGTGAAGCTCG
TGGAGAAGCGGGCATTCCGTGAGGTCCAGTGAGTGGCCCCCTCCTCCCTCCCTGTGGTCT
TTCCCCAACCCAGCAGCTGTGGCCAGCAGTTGAGTGCTGTGCCCCTTGGCCAGCCCCGGG
TGAGGGTGGGCCCACCCTGGGTTCAGGGCCGCCCAGGGTGGGGCCGGGAGGGTCCCCAAA
GGGAAAGTGAAGGGCAGAAGGGAGGTGCTAAGTGGGCAAGGACGTGGGACACTCTCTCCC
CCGACGCCCCCTCAGCCCCTGTCTTCTGTCCCCAGGTTATAGCTGCCCTGGCTGCGGGAG
CCCCTCCCTTCAATAAAGCTCCTTCTGACCTCTGGCCGCGTGTGCGACTTGTCTCGCTGC
CCTAGGCGGCTTCTGTCTCTGTGGGGTCTTTGTACATCCCCCTTGGTGCACAAGGATGCA
GATGCCAGAACATTCCTTTCCTCCAGTGCCCAGTGAGACTCCAGGGCGTGTGGAACAGCC
AGCTGAGTTATGGCCCATCTGATAGCAAGGCCATTGTGGGGGTGGGTGGGTAGGTCCTAA
ACGGACGGTAGGCAGGGTGTTGGGGGTGGGGTGGAGGCGAAGCTGAGACCCAGCCTGGAT
TTCTGACTCAGGGACTGGCCCACTTCCTCCTGCCACAGGTCACTGAGAGGTGGCAGCAGC
TGACATCTGCCAAGCACCTGTTATAAAATTTCTTTTTTTTGAGACAGAGTCTCGCTTTGT
TGCCCAGGCTAGAGTGAGTGCCGTGGCATCAGCCTAGCTCACAGCAACCTCAAACTCCTG
GGCTCAAACAATCCTGCCTCAGCCTCCTGAGTAGTTGAGACCACAGGCATGCGCCACCAT
GCCCGGCTCATTTTTTCTATGTATATTAGTTGACCAATTCGTTTCTTTGTATTTATAGTA
GAGACTTGGTCTCACTCTTGCTCAGGCTGGTTTCAAACTCCTGACCTAGAGCAATCCACC
TGCCTCGGCCTCCCAGAGTGCTAGGATTATAGGCGTGAGCCACCACGCCTGGTTCCTTCA
TTTTTTATGGCCACTGGGAACGTTTCTCTGGGACAAGATGTTTAAAAAGGAGAGTGAGAT
TTATAACAAATGGGTGAAGGGAGAGACGACATAGTGCTTCCCCCACTNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1224, 1621..1685, 5104..5212, 5813..6012, 6410..6480, 7703..7798, 8981..9085, 9186..9368, 10025..10200, 10407..10473, 11136..11212, 11311..11367, 11615..11621
1001..1224, 1621..1685, 5104..5212, 5813..6012, 6410..6480, 7703..7798, 8981..9085, 9186..9368, 10025..10200, 10407..10473, 11136..11212, 11311..11367, 11615..11618
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved