Microcebus_murinus Locus TOMM20
snOPY snoRNA Orthological Gene Database
Microcebus_murinus TOMM20
Microcebus_murinus
TOMM20
GeneScaffold_3662
SNORA14
1533..1667
13636
TAGGACTGATACCACCTTTATCAAAGCACCAATCCTCAAATCACATGGCAAGTCAGGCA
TGGCCAGCCCTCCTCCTGAGTCATTTTAGCATGAACTGTCAGGGTCCCCCACGAATAACA
AAGCCATCCCTATCCCTAGGGAAATTAATTCAAGGGTTTAGAGCTCCCAAGAACCAGGGA
AAAAGGCCAACTAAAATTGTTTAATAACACAAGCCTGCACTTGACTTCCGATACCCCTCA
TCAAGTTACGCTTGCCTGTTCAATGTCTGCTTTTTGCCCACGGTTTTCCTTTTGGAATAT
TTTAAACTACAGATGTAATGTTTTCAGGTGTCTTTAAAACAATTCACGTTTTCTATTTTT
TTAATTCAATTTCGTGTATAGGTTTTATCTTTTGCAAGGACAATTTTTTCCACTCATAAG
TAAAAACTATATCATAAGTCTTTTGAAATCTAACCGCTGTGTACAATGGATCGCGACTGA
ACTTGAAAAGCAAGTGCAGTTCAATTCATACAAGTCACGGGCTGCCTTGTGTTACACAGA
CTAAGCGTTCATCACCAGCGACCCTTCCATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGTTTTTGCGGGGGCCCTT
TTCCATCGGGTATTTGCATTTACTTCGCCCCCCAAAGGGCCGGGAGGGGGCCCCAAAATT
CAAGAACCGGGGTCTCGGGACCGCGAGTGGGTGTTTTCTTCCCCCCCAGGGGCTGCCCCC
CCCCTGCCCCCCGCCGCCGCCCTTCCACGGAGTGGGTGGGGGGTCCTTGCCGCCCACCCC
GCTTGCGGGCGGCACGCGGGCGGCCGCGTGGTGCGGCCGGAAGAAGAGATGGCGCTCGCT
GCGCGGCTCCCGGGCCCCCGGGGCTCTGGTGCCCCACAGGATCCCCTCCATTTTGGTGGA
AGGATTTTTCCCATTTTCTTTCCCCAAAACACTTTTGCCGTGTAAATGCACTCTACATGT
TTGTTATAATTTAGGATGTGTGTATCGGGGCGGTTGTCTTTTTTTTTTTTTCATTCACCT
TTTTAAACCTTTATTTTTAACTTCAAAAGTCGTGCATTTTGTATTTGGCGAATTTAGCCT
GAGAGTAAATCTGCATTCCCAATGCGGTATCTGTTGCATTCTTAAACCCTCTTGGTTGCT
TCGCTCTAAACGCTTCCAAGATACGAGTGAATGCTATAGAAATTGCAGGGGAGTCCAAAG
GGCTGCGCTTCTTCTGTGGCTCAGTCTTATTTCATACCTGCGACATCTTTTGCAAGAGGT
TTACCAGAGGGAAGTCATGTCACCAAAACCATTGTGATCCGCTTTGAGTCTGTATTTGCA
GCAGAAGAGGAAATTTGTTGCAATGAGAAATATTTTTGTAACTTATCTGTAAGGTTGCTC
AGCCAAAACAGGTCCTGAAAGTTAAAATTGATAAGTTATTAAAGTCCGGGAAGTACAAAG
AAGTGATTGTTTACTGAAATAGTGATTACCATTTAATTAAGCTATATTAAGTCATTTCAA
GTGTTCATTAGCCACATATGGATAGTGACTACTGTAGTGGATAGCGCTGACCTTAGCGTT
TGCAATATGACGGCTAGTTATAGCTCTCTTATGTTCTAGAAGGGAAGGGATATAGACATA
ATTTGCTTTATTTTTGGTCAGGGAGACGAATAGAAAGAATGCTGTTTTGGATTAAGACAC
TGGGTTTCCAGGCCCAGGTTGGTCACTGATTAAGGTTAGCAGAATAACCTTGGGCTTTCT
GAATCCTAAATTCCTTAGCTTTAAAATAAGGTGATGCCACCTGCTTATTGTTGGGTTTGT
AAAGATTAAGTAAGATGTTTAAAGTGCTCACCACGATTCCTGACATAAGGAATGCCCTTC
TATAAATGTTGGCAGTAAGTGTAACTATTGGAATTTAGGCCATTTTCCTGTAGTTTCAAA
TATGGGTGGCAACTTGGGGTGTTGGTGCAGATGCAAAGCTCTGTAAAGAATGGATTAACC
ACATTTTCCATTGGAAACTTTGAAATACTGTTGAACATGTTGAGAAAACTAATTTTTTTG
GTTGACAGAATCGTCCTAAGAGCTATCATTTTAGGCAAACTGAGGAATGTTATTTTGAAT
TTTTTTTTTTACATCATTTTCAATCCAAACATTTTTTCCTGGGTTTAGTAAGTGTAGAGT
TTAGTTCTGTTCCTGACACATGGTGATTGATAAACAATAGAGATTTTCTTATGAATAGGA
TTAGTTTGATATTTTCCTTAGCTTGTGTGACTTTTATTCAGAGTCATTTTGCAGTCTCTT
TAAAGGTAATTGCATAATGGGCAGATTTTAGCAATTTGAGGGTATTTTGCATTTGTGGAA
TGAAATTGATTTCAGTTCAGTTAATTTGGAGTTTTTTTAGTCTCATTTCCTGTAGAATAT
TTACATCTGCAATAAAAGGGCAATTTCTCAATTCAGTTATTTAGCTTGTTTGTTGATTTT
TTTTTTTTTTAAGGAAAGGAGACTTAACAGTGTTGAAGGTTTGAGGTTAAATCTGGGATG
CTAATATATTCAGACTTTTTTTGTCTCCTGTTAGCAAGACTAGAGATTATCAGGGCTCTT
AAAGTATAATTCTTACCCACCTAAATAATCATTAATAAATGAAATTTAACCTCCAAGTAT
AGTGTCAACCACAGGAGTGCTTTACTTATAATAGTACCAGTTAAAATGGTACATCACTTA
AAAATACATTAAGTAAGCATCCTATTTTAATGAATGCTTTAAAAATGATTTTGATTTTGG
ACTTTTGTAAGCTCATGTTTTATATGTAATTTTTCAAGTAGACATGCCCAGTAATGTTTG
GAACTGATAATCTATTGATAGCAAATATTGAATCAGGGCCTGATTTGGCTGATTGAATGT
ATAATTTTTTCTTGGCTTTTTATTTTATTTATTTATTTTAGAGATGGCATCTTGCCCTTT
CTCCCTGGCTAGAGTGCAGTGGCTCTCATCATAGCTCACCACAACCTCAAACTCCTGGGC
TCAAGTGATTCTCCTGCCTCGGCCTCCCGAGTAGCTGGGACTACAGGCGTGCACCACCGC
ATCCTGCTTATTTTTGTTTTTTGTAGAGACAAGTCTTCTTATGTTACTCAAGCTTTCCTC
CTTCCTTGGGTTCCCAAAATGCTAGGATTATAGGCATGAAGTGCCTATTTTTTTGAAATG
TCTCAACTCTGTTGTCCAGGTTAGAGTGCAGTGGCATGATCATAATTAACTGCAGCCTCT
AACTTCTAGCCTCCCTTCTCGGCCTCCCAGAGTGCTGCCATCACACTGGGCCTTGATTTT
TTTTAGTCAATTACTATCTGTCCCTATACCACAGAGATACTATATTATACTATGTCTGAA
AGCAAATTTAATATACCAAGTTAATTGTCCTATGAAACTAAAGCCAGAATTTTAATGTTA
TTGTTGAAAATGTAAAGGAACTAGATCATCTTAAAATTTGGTAACTGTATCAGTCAGTTG
TATTCAGTGACAATCATACTTCTCCCTGCCCTCTTGAATAAAATGTTTTAAGTTGGATAG
TAATGGACACTAAAGTTTCACTCTATTGGGTTAGTCATTTTTGTCATTTTCCCTAAATTC
TGGTTTACAAATTGTATTTCTTAGTGTTGATTTACAAATTTGGCTTGTTCATTTCTTAGG
TGCCTTTTATTTTGACCTCTTACTAGTTGTGACCTTGGTAAATCTTCTCATCTGTAAAAT
GGTGATAACAGTATGTGTTATTGTGAAGATTAAATAAGCATGTGTTATTGTGAAGATTAA
ATAAGCCAATTAAAAAACATTGAGAATAGTGTCTGTTGTGTAGCATCTGAAACTTGAGTG
CTTACCCCTAATATCCAGGTGTTCTTTGTCTTCATGTCCAGTTCCTCTGTGAAGTCTTCA
TTTCTCTCTTCTAGACTTACTGCTCTCCTTGTACAGGTTCCAGTCTGTACCATGATATTT
AGCAGTTAGATAATGTCATCTTGTATCATTCATTGTTTTTTGCCTAAAGAAGTGAAAACC
CTTTAGCAAATTGAAGGATAGAATTATATTCTGTGTTTTGTTTGTTACGCAGCTTGTGCA
GTGATGGACTCTTTAGGCAAGACAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNAATGAAACTCTCTAATGCCAGTGACCTGATCCTCACTCCTATTACATGTCCTGTATA
GGTTGGAAAGGGAGTTGTTCTGCTTATTGTAACTACTCAGAGGTCCAGAGTCAGGAATAT
TTTGCAAATGGAATTAATGACTTGCCACGGCAAGTAGACGTCTTTTGATTCCCATTTTGA
TAATGGCAAAATGAAAATATTACATTACATTTCTTGTAGGAAGAAAGAAACAGAAGCTTG
CCAAGGAGAGAGCTGGACTTTCCAAGGTAATAATCTTTTGTTTAGATTATGTGGTATACT
TTATAGAAATGTTTAAAAATCTACTTCAAATACATATTTGGAGAAAGCTAGTTAATAATG
GACACTGATTTTCTATCTTAAAATATAGTTAGATGTTTTTAGGAATAGGTGAATAACTTA
GTTTAACTGCAGATTGTGCAGTCCTGCATTATTTTTCCTTCCTTGGCCATAAAAGCAAAT
AGCTTTTTGTACAAGCTATATTTAAGGGACAGAAAGATGATCGTTTCCAAAAGACATTTA
TACCAAAAGGTGAAAACATTCTGAGTTGCTTCAAAAGGATAAAATAAAACATTTATGTAA
TTTTCCTTGCTCCAACTTCCTTTAAAAGAACTGCATGCTATTCGTTTGAAAAGTTATTCA
AAATTATTTATACTCACTGATCCAGAATCCCACTATCCTGAGAAATTTTTACCTTGTAGT
ATGCAAATGTAGATATAAATCTTATTATTTATTTTTTCTTTTCATAGATCCTGGGTTCAT
GATTATTTTTAATGACCACATAGGTTTATCTACTTGGTAAAAAATGTTCTGTGGCATGAG
TAAGTAAATTAAGTAAGTAAATGTTAATCATTGTGCTTATAGCTTTTCCTTTTTATTGAA
GTTAGTTTTGTTCGGATCCCTAGGACTCCAATTACTGGATCGTTAGTGGTTCTTTTTAAA
GCAAGCTGAGGCAAGGAAAAATGAATCAATAAATATTACATTTTGTTATTGTGAAAAAGT
TGAGTGATCAGGAGAGCTAATTGACTGAACATGTAATGGTAAAGTGAAACTGGGAGGGAA
CCATTTTGTTCTGATATGTTCAAACAACCTTTCTGAAATATGTAATATGTTAATTATATT
TTGGGTAGCCTTTTCTTTCTATGGGTTATAGGAAAATAGATATGTATCTGTGTATTTTTA
GATCATGAATTTAATTAAATTTTTCCTATATGTTGGGATAGTCAATGAAAGATGCTTCCA
CTTTCAGAAATTTTTTTCACCTATGTTAAATCAGCATATACAATATAATTCAAGAACCAA
AACTTTAAAGAAGTTTAGATATTAAATACTTCTTTTCTAAATGTTAAAAAATGGGACTTT
TTAACATTTTTAGGTAGGTTTACATTTTTAAATAGACAAGCCATATAGCTGGTGGCAGAA
CTATTCAACTACTGATTTGATCAATAAGTACCTTTTCTTTCTTTCATTTGAATATACATC
ATAAACTCTGATTCTTACAAGTATTAAGTGTAAATTTCTTTTTATTAGTTGTTTAGAGTG
ACCTGTTTAATTTTTTTGTTTTTATTGATTTTCTGAGTATTGTTTATATCTTCTGTCATA
ATTTTGGTATCAGTTACTAAATATTGTATTCCTAAACAGTTACCAGATCTCAAAGATGCT
GAGGCTGTTCAGAAATTCTTCCTTGAAGAAATACAGCTTGGTGAAGAGTTACTAGCTCAA
GGTAATAGTCATTAAAAGACTAAGGAACTAGATAGCATTCTTCAAAATTATATATAAATT
TATGGTGATAAGAGGTTTTCCTATGTAGTTGACTATTTTTAGGAAAAATATTCTAAATAT
TTCAAGAAAGAGTTTTAGGCACTTAATAATTTGAGATTAAGTGAGTTTTAGGTTTACTTG
CTTTTATCTTATGACATAGAAGATATTATAAGAAATTTTTACAAATGAGGTTACCCTTAC
TCTTAAGTTTTTAGAGCATAATATAGTCATGGTGTAGTATGTAAATAAGTAACAGAAGGA
ATGTGAGCTAGAAATATACTCCTCAACTCTCTCATCTAATCTTCAGATCTTTTCCAGTAT
TTATAGGAAGGAATGGCTAATATAAGTCCCAGAGAATGTTAATTTACTTAATCAAGGTCA
CACGGTGAGTTTATGACACTTCGTTTCAGAACCAACGTGTTAAATGATCCAGAATTTAGA
CTTTTCATTACTTTGTACCTTGTCTATTTCATCAGAAGTATTAAGTTTTTTTTTAAGATA
CCTATTAAGAAATTAAAATTATCTAATTGACAAGCCTGAGAACTAGAGTTCACTCAGTAA
TTTAGAGTCTTAAATGTTTATGTAAATCTCTTTGGTGTTAAATTAGGTTTTATCTCAAAA
GTAGCTTTGAAATAGTTGTCATTAATAAAGATGGTATCAAGTGTCAAGGTTTTTTTTTAT
TCTTATTGCTGTATCAACAGATTTAGACATGATTGAATTACATGTTGTGGGACATTTGTA
TGTATATGTTTCTGTTGTTTCTTTTATGGGAAGAGATTAACTGTTTAAAATGGTGATGAC
CAGCCTTTTTAAATGAAATTAATGACTTGGCCACAGCAAGTAGACATCTTTTGATTCCCA
TTTTGATAATGGCAAAATGAAAATATTACATTACATTTCTTTTATTTTTTTTGAGACAGA
GTCTCGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTAAGTATATATTTCCCCCTCATGTATGTATATTAGAAACAGTTCC
ATATGGGTACAAATGATCTGACTCTTTTTAACAGCTACATAATATTCAGTTGTGAACGCA
CTATAGGTTGTTTCCAGTATTTGGCTTGCTCAGTCTTTTTGGGTAGAGTCATTTGGAGAT
AGAGTCGAAACAGCAGATGATTTTTTTTTTTTTTGAGACAGAGTCTCACTTTGTTGCCTA
GGCTAAAGTGAGTGCCGTGGCATCAGCCTAGCTCACAGCAACCTCAAACTCCTGGGCTCA
AGCAATCCTGCTGCCTCAGCCTCCCGAGTAGCTGGGACTACAGGCATGCACCACCATGCC
CGACTAATTTTTTCTAGATATATTAGTTAGCCAATTAATTTCTTTTTATTTATAGTAGAG
ACGGGGTCTAGCTCTTGCTCAGGCTGGTTTTGAACTCCTGACCTCGAGCAATCCGCCCAC
CTCGGCCTCCCAGAGTGCTGGGATTATAGGCGTGAACCACTGCGCCCGGCCAGCAGTTGA
ATTTTGACAAAGGCAAAGGCATTTCAGGTTACATGTAATTTTATGTAAATCTTACAGGTG
AATATGAGAAGGGTGTGGACCATCTTACGAATGCAATTGCTGTGTGTGGACAGCCACAGC
AGTTGCTACAGGTGTTACAGCAAACTCTTCCACCACCAGTGTTCCAGATGCTTCTGACTA
AGCTCCCGACAATTAGTCAGGTAAGGCATTGAAATGTTACGAAATAAAAGTGAGCAGGAT
CTGAGAATTGAATGGTTAGGGACATTTATAAATGATCCTAGTGAACAGGATGAAATCATG
AAACTCATCTGTTCAATGAAAGTAATACTGGAGATAGCAGTTCTTGAAATTATCTTCCCT
CGTGGCAAAACATCCAAATGACTGGGCCATAAGATCTAGTGATTGTACCTTGGAGATGGA
TCAAGGAAGTGTTTGTCTTAGTGTTAAGTCTCAGGCCATAGTATTTCAATCCCTAAATTC
AGGCCACTGTCAGCTACTTTGTACAACTAGCTTTTGTCTACTTTCCTGAGAGACTGTGCC
TTTAGTTAGGTGGCCTGACAGGAGCCAAGATGGCATAGCCTGGTCGTTAAGTCATCAAGG
AATGAGGACTCTGAGCTGACCTGTCTAAAGGCTCTGTGTCTCCACTGCTGCTGAGGTAGT
GGGCTTAGAGTGTGGCGCTTTATAGACTGTATCCCTACTAAGAAGTATAAAGTACCGTCA
AAATACTGTAAAAGATTAAATTATGCTTAACTTAAGAGTGAATTAAAATGTATTGTATTC
ATTTTGAATTCTTTCCACAGAGCCCAAATGAACCTACTTTTTGGAATAACATGTCTATTA
TATGTGTTCATTTCCCAAGTTGTTGTGATTAAACATCCGTGAATTGACGGAAAAGAAAGT
TTTTACAGAACTTTAATAACTGACTGAAATAAAGGTCCCAAAGATTTGAAAGGAAGAGTT
GGAAAACCAAGGACTTGGTGTAAATCTTTTTTATTTAGAGTAATGTGGTTGTGGTCCTGC
CTGTTCATACCAGAATCTTCTGTTTAATATTATGTGTTATTTGAAAGGCAATATAGCATA
GTGCTTTTGGAAAATTGACCTGAGGATGATGTCTTGAAATATGTGTGAGTTCAAGGTGAA
GCCTAATTCCTTTCTATAAAAGTGGCCTCCTTAGGCCGGGCGCGGTGGCTCACGCCTGTA
ATCCTAGCTCTCTGGGAGGCCGAGCCGGCGGATTGCTCGAGGTCGGAGTTCGAAACCAGC
CTGAGCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGATTCTTGATGTTTTCTAGCATGTAGCATAAT
GTAATCTTATGCCTCCTTTATTAACTTTTGAAATGGGACTGGCACTGGTATGATCTTGTT
TCATTAGATGCTAAGAGTGTATAAAGTGTTGTATTTTGAAATAAATGTTAGAATGGGTGA
ACTTTAGCAAGATTTGATTCTTTAAATACAGAGAACATTTTATGTCAAAGTTAGAGTTTT
GATTAAATACTTACGACACTTTTGAAAATTACTTATTTTTTTTCTCTTTCAGAGAATTGT
AAGCGCTCAGAGCTTGGCTGAAGATGATGTGGAATGAGAAACAAATGTCAACGTAATAAA
ATCTCAGTTAAAAATACTTTAAAAATTCTTAACTCGGAAGTTGAGCAGCTCTGGGGGAAT
AAGGGCAAATATGCTTGTGACGGACTATCCTACACTGAAATCTACCAAAGTTCATGTTTA
CTTTGTGTAGATCCATTTGTCACTTTTATTTATTTTTCCCAGTGAAAAGTGTATTTTGAT
AGAGAGCTTTTCATTTTATAAATACACTACGAGTTACTGAAATACCATGGATTTTGTTTA
TTTCTTAAACATGCAATTAAAATGTATATATAACAGAGCATTATTAAAAATACCCAGTGC
TCAGTTTTGAAAGAGGCAAAAAAAAAAGTGTAAGAGAAAGGTGAAGAATGCACATTTTTA
AAGCTTGTACATTTTGCTATAAATCAGAAAGTTACACAGAGACTTGTTTTATGGAAACTG
AGCATTAAAATTTTTGAGTGATCTTTTCTTTCCATTTAATCTCTTAAACATAAATTTGTA
AGGTGTGTTGCTGTGCTGTATTAACAACTTCACCCCATTCCCCTGCCCCCATATATCAGT
CTTGCAATGCTTTGTTTAAATCAGTGGTCTTAATGTGTTCTGGGTATTTATCTCCTTGTA
TTTTAAATATATGTAGTTGCAAATGGCACCAGGAATTAGATCTATGTACGACCCCCTTCT
GGCCATGTGGACTTCACCAGTTCACATCTGCTCACTTTCCTCACTGTATTAAATGAGGGA
ATCAGGCTGCTAAACTCTGAGGCATACCTTTTATCTTCTCATTTTGGCCTTCTGTTCAGC
ATCTTTAACTCCACCTTCCCCTGCTTCCCCTGAGGAGTGTGTGTGGGCAACTAGGCCTTG
CATATTTTTATTTTCTGAATTTTGCATGCTTGCCTGACTTAGTAGTTCTGAATTAATCTC
TTTTTTAACGGTATAACTATATTGTTGATTTTTGCTGAAATTATGTGTTTCTGTCACTAC
CCCGTAAATTAATCTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1013, 1016..1033, 1035..1058, 1063..1076, 1078..1086, 1089..1101, 5859..5905, 7299..7380, 10317..10459, 12592..12636
1001..1013, 1016..1033, 1035..1058, 1063..1076, 1078..1086, 1089..1101, 5859..5905, 7299..7380, 10317..10459, 12592..12633
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved