Microcebus_murinus Locus EIF4G1
snOPY snoRNA Orthological Gene Database
Microcebus_murinus EIF4G1
Microcebus_murinus
EIF4G1
GeneScaffold_456
SNORD66
9908..9983
22412
ACCCTGCACCGCCGCCCTGGCGCCCTGGCCCCGCGGCCCGAGACCGGGCCCCGGCCCGC
CAGGGCCCGATCCCTGGCCCACGTGTGTCAGGCCTGGCCCGGCCTGGCTGCTGGGTGGGG
GGTGGGGAGCGCGGGGACGGACTATGCGGGCCTCGCGGGCTGGGAGGGCGCCGGGTTCGC
CGGCCGCGAAATGCCACCTCGGCCCGACTCGAGGAGGCCCGGCAGCCCATGGGCGCAGGC
ACCGCAGCTCCCAGCTCGCCGCCCCCTCCCCCCTTCGCGGCCAGGCCGCCGGGAAGTGAC
ACGTTGTTCTTTGGCACTGGCCGGCGCTGCGCAGGGAGGGCGCAGGGGAGGGAGGCGGCG
GTGGCGGCGGGCAGGGAGGAGCCCCCGGCCCCTCCCGCCCTCCAGGCCGACCCTCACTTG
CCTGAAACCGGCTCCTCGACAGCCGCCGCCCGCTTGGCCTTTTAGGGCTTGACTCCCACC
CTTCCTGGCCTATACTTCTGGGCGGTGGCAGGCCTCGCCTCTGGCCCCGCGCGGGTCCCC
CGGCGGCAGGCGTACCTTGTGTGCCCCTGGGCCAGGCCTCGAACCCGGTGTCCCCGGGTG
GGGGGTGGGGACACCACGGCCGAAGCAGCTAGCTCCGTTTGTGATCCGGGAGCCTGGTGC
CAGCGAGACCTGGAATTTCCGGTCTGGTTGGTCTTGGGCCCCGCAGAGCCAGGTTGATAC
CCCTCACCTCCCAACCCCAGGCCCTCGGATGCCCAGAACCTGTAGGCCGCACCGTGGACT
TATTCTTAACCGAGGGGGTGAGTGAGGGGACTGTTTCAGCAGGCCAGGGGGGGTGGTTGG
AGGTGATTCGGGTTTGACAACGTGGTGGTGGGGACATAGGCTTGATCTTTTCTACTCTTT
CACTCCCTTGTCACCTCCAGGGCTCCTTATTGGACCCAGCCCTTGCATCAACCCTTCCCT
CACTCCATTTGCCTTAAGCTTGAGTCCCTTCCTCTTCTCGAGCTCCACTCTTTTCCTAAC
AGGTGTTGGGGGGACCCTGATGTTGGGGCACCAAATGAAATGAACAAAGCTCCACAGTCC
ACAGGCCCCCCACCCGCCCCATCCCCCGGACTCCCACAGGTAATTAGGGAGGAATTAGCA
GGGACTGGGGTGGGGGTGGGGGTGGTGGAGACCAAGCAGCCTGTCAGGAACAGGTTCTGA
CCTCTGGATTTTCCCACCCCCATCTGTGTCAGGGCAAAGTGCAGCTGCCTGCTGCCAAAT
TGAGACAGGGCCCCTGGGCTCTCCCCCTGGGCTGTCACGGGGAGGGGGTATGTGGACTGC
TGAGGCTCTTGCCATAGATCTGCTCCCCTTATTTCACCAGCTTGGGTTTCTGCCCCACCT
GGGCTTCCCCTCTTGCTGAACTCTGGTCTCCCCCCTTCAGCCAGCGTTTCCCCCGGGGCA
GACAGCACCGGTGGTGTTCAGTGCGCCACAAGCGACACAAATGAACACGCCTTCTCAAAC
CCGCCAGGTGAGGGGCTGTGGGGAGGGGAATAGGGGACCTGGGTGGGAGCTGTGGAGAAC
TTTGGCCAATTTAGGCCTAGGATGGAAAGTATGGAGGCTGTGTACCTGGCCCCTACTTGC
TGACAGTTGGCTTTGTATTCTTTCATGCTGCTCTGCAGTTTGCGCTGTTGATTACTTATG
GTGGCTGGCCCAGTGGGTAGTATGTAGTCGATGAGGGTGGCATTACTGGGGTCCTGTGCC
TCTGAGGATTGGGGACAGTACTTTGGGCCCTGCTGCTAACTCTTGCTTTCCTTATTTCCT
CCTTTTACTGGAGGTTGCCATTGCTCCATTCTCCTCTCTGCTTTCTTTTTGGACTGTGTT
GAGATACAAACTCCAGCTGGTTCTTGGCCTTTCTCTGTTTCTCAACTTCATCCTCACTAA
GTAGAAGGATTCTTGTCCTAATTCCTTCATTGTTTTTCCCCTCATCACCTTGGGGATAAT
TTTCTTCTTTCCTGTCCCCATGTGCTCTCAGGGAGGATTCAGGTCTCTGCAGGTAATACT
CCTTTCCTAATCTGGACTGTCTTCTGGTCTCACCCTTACCCTTTACCTTAGTCAGGGGCT
AGATGCAGGGATTGGGGTCTTCAGGGTGGGAACTTGTTTGCTGTTCAGGTCCTGAGTCTG
AGGCTGAGTGATGCATGTTAGGAGCTAAATCCCAAGCGTGTATCTGGGGACTGGGAGACT
GTTGCATGTCCTCAGTGCCTTAGGTGGATCAGTGCATGCTGGGGAGTATGTTGCCGGAAT
GTGCCTCACTTAGGCGTGATGTACCTGGGTGTTAGGAAGCCTCTGCAGAGGGGTAGTCTG
GTGGAGGTGACATGGGTATGCATGGCAGTGAGAGAGTAAATATACATGGAATGCAAAGTA
TACATCTGAATTGGGAGGGCATGTGTGCAGTATAAGAAGCCATTTAACCATAAGTTTGTC
AAGTGAGACTAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNTTTCCTCCCTCCTGACAGCACTTCTACCCTAGCCGGGCTCA
GCCCCCAAGCAGTGCAGCCTCCCGAGTGCAGAGTGCAGCCCCTGCCCGCCCTGGCCCAGC
TGCCCATGTCTACCCTGCTGGATCCCAAGTAATGATGATCCCTTCCCAGATCTCCTATTC
AGCCTCCCAGGGGGCCTACTACATCCCTGGACAGGTGAGGCTAGAGGCTTGGGGGCTGGA
AGCCATAGGACCTTGTATCCCAACCCTCACCCTGATCTTCCAGTTCCACCCCTTTTCCAG
AGGTGGTACTTCCTTCTGGTCATTGTCCAGAGTTGGCTTGTCCTGTCTTGCCCTACATTC
TCTTTGGAGTCCATTATGGTGCTCATAGCTCCCTCAACTCCTTCTCTCCCCCTAACCCCA
GGGGCGTTCCACATATGTTGTCCCGACACAGCAGTACCCTGTGCAGCCAGGAGCCCCAGG
CTTCTATCCGGGTGCAAGCCCTACAGAATTTGGGACCTACGGTAAGCAGGGGAGGGAGAG
TCAAGGGTGAGATGGAATCCTAGGGAGCATCTAAAGTGGTCTACTGGTTTCTAAGCATAG
GACCCTTCCCAGGCTTGGCTTTGGTCTAAAAATGATAGGGTTAATAGGTAGTAGGGATTG
GTGCTTAATATTTAACTGGCGTTGGTGGGAGAAAATTTGATCTTATAGCCAAGAGAGTTA
GAGTCCTCCCCATGTCAAGGAATGTGGGATCAGGCACCAGCTTGAGGGCCTGTCATTAGA
ATTTCCCTGTGACGCTTCTTCCATGGTTGGGGGGAGCCTGTGTAGCACAGATTTGGGAGG
GTTTTTGTAGCTCCTTTTCATTTATATTTTAGGGAAAGGATTAGTCTGTTCTTTATGGCA
GTGGTTTCCAAGTTTTTTGATCACCTATCAAAATAAATTTAAGTATGTGCCTTTAATACA
TGTATGTTTTTGTTTGTATATATGTATGCATAATTTAAAAAATGAACACACTTGTGTTTG
TTGAAAACAAGTGGAAATTACAGATGAGTTTGAAGAATGCACCCCATTTTGGAGACCATT
GCTTTAAGGAATGAATTTCTTCATCCTGAGACCAGTTTATAATGTTACTTTTTGTTTCCT
TGTCCCTTTTCAAGGGGCTGGATACTGTAACTGGACTCAAGTTGAGTGGAACAGGGTTAG
CAAATCTCTTTCTCTCGTTCCCAGCCAAAGACCTGATTCTGTTTCAGGTTCAGAGTATGT
GTGTATGTGTTGCCGGGGTGGAGTTCGTACAAAAGAGTACCTTGTGGGGTAAAAGACTTA
AATCCTCCTGGTAGCTGGTGTGTGGTGGAAAAGGAGTGCCTGCTTATGAGGTGTGTGTGT
GTGAGGTGTGTGTCAGTGTTAGGAATTCTTGTAAACGCAGTTCAGACTGGTTCCCCAGCT
TTGACAGACACTTAATTCCCTGGGGGAGGAGGGCAGGGCAGGGCAAGGGGCCGGCTATGG
GTGATGGGAGGTTCTGGGGTTGGGAGGTGTTTAAGCTGACATTAGTATATGGTTGGGCCC
TGACGCTGCCACCATTCTTTTTCTCTGTTCCCCCTCCCCCAAGCTGGCGCCTATTATCCA
GCCCAAGGGGTGCAGCAGTTTCCCACTGGTGTGGCCCCTGCCCCAGTTTTGATGAACCAG
CCACCCCAGATTGCTCCCAAGAGGGAGCGTAAGACGGTAAGTAGCAGCATAGCAGCAAGG
GGCTCTGGGACATCTCGGAAGGGGAGAACCAAGGTCAGTTGCCTCCAGGACATTGTGCCT
GAAGGAGCTGGAATTTAAGGAAGGAGGTCTTCAGCTGAGAGTGGGCAGAAAATGAGGGTC
TGTGGAGTGTTCAGGTTTTATATAAAGTACTAAGATTTCAGCATAGAAGCAGCTCATGGG
AGGACAGAAGTGGCTAGTGGGGAAGTTCCTGAGAGATAAGGGCTTTGGGGGTTCGTAAGA
ACTGTGCTTGGTTTTGGGTTTTTGGTGGCTCCCCTTGGAAATGGTTTGTTTTCTGTGGCC
CCGCCCCCACGCCCCCCCCCCCCAGTCCTGGAAGCTTTCAAGGCCTCCGCCTCTGCTCAG
TCCTCAAGCCCTGGGCGTGGTGCCCAGAATAGGGTGCCAGAGCTGGGGAAGCCGCTGAGT
CACTCTGGCTCCACCCACTGGATCTGGGCCCTGCCCCCAGAGATCAGGCAGACTAGCCAC
AAGTGAGCCGAATGGGTGCTGGATGGGGGTCCTGGGCCCCAGGGTGTGCATCCACTGACT
TGGGGACTGCTGGTGGGCAGGGGTGAGGGAGGGAGGGGCATTGTGATGTACAGAACTGCT
CTGTGAGGTCAAGGGTCTCTTAGGGGTGGGGGCTAGGACAGAAACTACAAGAGCAGCCGG
ATGGGTTGACAGTAGAACTCAGGGGGTTTCTGGCACCCACCCACCTGCTTCCCAGTAGGG
GGTGGGGGGTTGGCCTGGAGTCTTAGAGTGGGGCAGGGTGGAGAGGTGGGCTCCTCCTGC
TTCCCACTCATCCTATAGCTTTCTTTCCCCAGATCCGAATTCGAGATCCAAACCAAGGAG
GAAAGGATATCACCGAGGAGATCATGTCTGGGGCCCGCACTGCCTCCACTCCCACCCCTC
CCCAGGTACTGTCTGCTCTTTGAGTGATCCCCTCGCTGAGGTGGCTTTTCTGCCCTGAAC
TCCCAAGTCCCTTGATCTTTTCTTTTTTTCAACTAAGGGATTTATTTCCCTGCTTTCCTG
GATTTCTAGGCAGAGCTAACTTAAAAATGGCTCTAGTAAAGAAGGGTTGTGGGACTCTTC
AGTGCAAACTTGGTAACCCTTTGTGTCCTGCAGACGGGAGGCGGTATGGAGCCTCAAGCT
AATGGGGAGACGCCCCAAGTTGCTGTCATTGTCCGGCCAGGTAAGTAAGCAGATGGGACA
GAAGTTTTATAGGGAAAGAGGAGTGTGGCAGCTTAATGCCGAGAAGGTGGAGTGACTTGA
ACTAGGTGTCAGAGAAAAATGACTTAGGTTTTAGGTAGTGGAAATTTGAGGGTGGATTAG
GTTTTGGATGGGAAGGGAAAAATAGCTTAGATGAGAGAAGGTTAGAGAGGGGGAGGTGTT
AAGTTGGGAATACCTTGCTGGGAGGATGGGGAGGAACAGTAGCAGTGGAGGACTTGCCTT
AAGTTACTCGTTCTCCCTTCCTGTGCTGCAGATGACCGGTCACAGGGAGCAATCACTGGG
GTCCGGCCAGGACTGCCTGGCCCAGAACACAGCCCTTCAGAGTCCCAGCCTTCATCACCT
TCTCCGACCCCATCACCACCCCCAATCTTGGAGCCAGGGTCTGAGGCTAATCTTGCAGTC
CTCTCTATTCCTGGGGACACCATGACAACGGGGATGATACAGATGTCTGTAGAAGAATCA
ACCCCCATCCCCCATGAAACTGGGGAGCCATATTGCCTCTCTCCAGAACCCACTCCTCTC
GCTGAACCCATACTGGAAGTAGAAGTGACACTTAGCAAACCAATTCCAGAATCCGAGTTC
TCTTCCAGTTCTCTCCAGGTTCCCACCCCCCTGCCATCTCACACAGTGGAAATTCATGAG
CCTAATGGCGTGGTCCCGTCTGAGGATCTGGAACCAGAGGAGGAGTCAAGCCCAGAGCTT
GCCCCTCTCCCTCCCCCGGCTTGCCCTTCCGAATCTCCTGTGCCCATTGCTCCCACTGCC
CAACCTGAGGAACTGCTCAACGGAGCCCCTTCGCCACCAGCTGTGACTTAAGCCCAGTCA
GTGAGCCAGAGGAGCAGCCCAAGGAGTTACAGTGTCGTCGGCTCCTGCTACCATCCTCAC
TGCCACTCCAGCTATGGCTCCTTCAGCAACTCCCCCTGCTCAGGAAGAGGAAATGGAGGA
AGAGGAAGAAGAAGGAGAAGCAGGAGAAGCTGAGAGTGAGAAAGGAGGAGAGGAACTGCT
CCCCACAGAGAACACCCCTGTCCCACCCCATTCATCCCAGAATTTGGAGGCAGCAGCAAT
CACCCAAGGTAAGGTGGGGCTGGATAGTGGAGGTGGCGCCAGCTGGGGGTGTGGTTCCTT
GTCTTTATTGATGACTTCCCATCTGTGCCATAGTGTCTGGGTCATAGAAGGCCTGTGATG
GAACCTAGATTAAGGTTTTAAGCCTAGAGAGGGTGTAATGGAAAGAATACTGTGCTGTAG
CAGCTTTTTATTTCCCAGGAGTTAGGGATGCTTCCCAAATCCTTCCCAACCTTGCTTTTC
TTTCTTTCTTTCTTTTTTTAATTAGTGGCAGTGTCTGTGCCAAAGAGGAGACGGAAAATT
AAGGAGCTAAATAAGAAGGAGGCTGTAGGAGACCTTCTAGATGCCTTCAAGGAGGTAAGG
GAGCAGAAAAGTCGGGGAAGGCAGAGTTTGGGTGTGGAACAGTGGTCATTCTGCAACCAA
AACGGGGTGTTCTGTTGTTTCAGGTGAACGTCACAGTACCAGAGGTGGAGAATCAACCTC
CTGCAGTCAACAATCCACGTCCAGAGTCTGAGGGCAGCAGTGTGCCCCCACGGCCTGAGG
AAGCAGATGAGACCTGGGACTCAAAGGAAGACAAAATTCACAATGCTGAGAATATTCAGC
CCGGGGAACAGAAGTATGAATATAAGTCAGGTATGCTGAAGGAAGGGTTGAGAATGACTG
AGTAATCTAGTCAAGGCCCCAGGAGACAGTATGATGTGTTCACGCTCTTTCTTGCAGATC
AGTGGAAGCCTCTAAACCTTGAGGAGAAAAAGCGTTATGACCGTGAGTTCCTACTTGGCT
TTCAGTTCATCTTTGCCAGTATGCAGAAGCCAGAGGGATTACCCCATATCAGTGATGTCG
TGCTGGACAAGGTTGGTGGCTTGAGGGGGAGGAGAAATTTGGGCTGAATGGATTAGGGAA
GAGCCTGAGGTCCTGAAAGAGTAGTCAATATTCCTAGGAGCTTCTGAGAACTTCCTTTTC
CCTGTCTCTTTTCAGGCCAATAAAACACCACTACGACCACTGGATCCCACCAGACTTCAA
GGCATAAATTGTGGCCCAGACTTCACTCCGTCCTTTGCCAACCTTGGCCGACCAGCACTT
AGTGGTCGTGGGCCCCCAAGGGTGGGGCAAGGTGGGAAGCTGCCCCGCGGCCGGTGAGTG
GGGCTGGTTAAGGGGGCAGGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNACTGAACAAAGCAGAAAAGGCCTGGAAACCCAGCA
GCAAGCGGACGGCGGCTGATAAGGACCGAGGGGAAGAGGATGCTGATGGCAGCAAAACCC
AGGTACTGGCAAGTCCTACTTTTGGTCTCCATTTCTCTTTAAGGTTTGCCATCTGAGCCA
ATTTTGCCCTCTTTGTGTCTGTCTGTCCTTATTACTAACATCTGCATAGGTCCCCACCAC
CCTCTCTGGTCTCTCTTCTTCTGAGAACCTCACTGGATCTTCTGTCTTCTGTCTCCTATC
TCCCCAGGACCTGTTCCGCAGGGTGCGCTCCATCCTGAATAAACTGACACCCCAGATGTT
CCAGCAGCTGATGAAGCAAGTGACACAGCTGGCCATCGACACCGAGGAACGCCTCAAAGG
GGTCATTGACCTCATCTTTGAAAAGGCCATTTCAGAGCCCAACTTCTCTGTAGCCTATGC
CAACATGTGCCGCTGCCTCATGGCGGTTAGTTTCCACTGTTTTCTAAACCTCTTGGTCTA
GTTTCCCACTTCTGTTCCCAAGACTCCTTGAGCCCAGCTTCTTGGTTCTCCTCCAACTTA
TGCTGTTGATGGCAGCCAGGAGGCAGAGCTGGGGCCAGAGGTCTTCCTGGGTCAGGTAGT
TAAAGACTCTTGGAGAGCCTTCCCCAGACTAGTCTGAAATGTGACATTCTCTTTGACCAA
CAGCTGAAAGTGCCCACTACAGAAAAGCCAACAGTGACCGTGAACTTCCGAAAACTCTTG
TTGAATCGTTGTCAGAAGGAATTTGAGAAAGATAAAGACGATGATGAGGTTTTTGAGAAG
AAACAAAAAGAGATGGATGAAGCTGCTACGGTGAGAGAAAACCCACCAATTCCATGCCCT
CTTGCAGATGTTACTTAGTTGTATAATTCAGGGTGGGGATAGTGGTAAGGGTGTGAGGGA
TTCTCTGCCTCAGGGCCTGAGTGCTAACTGCTAGGTTTGGATATCCAGAGGAGAAGGGTT
TTAGCTGTATGGCTTGATATCTTTTTGACCTGATCCCTGCCCCATGACTGGCAGGCAGAG
GAACGGGGACGTCTGAAGGAAGAGCTGGAAGAGGCTCGGGACATAGCCCGGCGGCGCTCT
TTAGGGAATATCAAGTTTATTGGGGAGCTGTTCAAGCTAAAGATGTAACAGAAGCGATAA
TGCATGACTGTGTGGTGAAACTGCTTAAGAACCATGATGAAGAGTCCCTCGAATGCCTGT
GCCGTCTGCTCACCACCATTGGCAAAGACCTGGACTTTGAAAAAGCCAAGGTAGGGGTCC
TTGCATGTGGAGAGGGATGGGCTGAAGCCCATGGAGCCCACTGAACCACACAGGTGGGGC
TGAGGGCCTACAGTTGGAGGTCAGGTGTTAAAAGTTCCTGATCTCTTTGCTCCTCCCTAG
CCCCGAATGGATCAGTATTTCAACCAGATGGAAAAAATCATTAAAGAAAAGAAGACATCT
TCTCGCATCCGCTTTATGCTGCAGGATGTGCTGGATCTGCGAGGGGTATGCATCTCATCT
TTTCCTTCCCCCACTACACTACCGCCCCCAGTTCCCGACACTGTCTTGTCTGGCCCTTCC
TGGCAATTACGTGACTGGCCCCCTTTCCCCACAGAGCAATTGGGTGCCGCGCCGAGGGGA
TCAGGGTCCCAAGACCATTGACCAGATCCACAAGGAGGCAGAGATGGAGGAGCATCGGGA
GCACATCAAAGTGCAACAGCTCATGGCCAAGGGCAGCGACAAGCGTCGGGGTGGCCCTCC
AGGCCCACCTATCAGTGAGTTTGAGGCTAGGATTAAGGAGGGGGCAGTGAAGGGACTGAG
GTTGTGCTTTCCTCTGATGACTTCATGTTAGTGCCACGTGTCTGGGCCACTGAGACCCCA
TGATGGAACTGAGGATCTGAGGAAGGGAGGTTGGGGGTGGCCCAAGGGGAAGGAGCTATT
AGGATTTACTCATTATTATGGTATTGCCCCCCCACCTCCTTTTTGTCCCAGGCCGTGGCC
TTCCACTTGTGGATGATGGTGGCTGGAACACAGTCCCCATCAGCAAAGGCAGCCGCCCCA
TTGACACCTCACGACTCACGAAGATCACCAAGGTAGGGATGTGCATACGGGTAATGCTGG
TGAGGTGGAGGGTAAATAGGGATCAGGCAGGTGTTAAGCTCAGGTTTGGATCCTAGTCCT
CTCACTTTTCTAAGGTTGGGAAGGTGACAGCTGAATTATTCGTCTTAGACTAACTGGTTA
GATTGCTAGACAGGACTGCCAGCTCTCTAGGGAGTATATTCTTACCAGTCTGAGCCAGTG
ATTGGCAAACTGATACATACGCAAATCCAGCCTGTTGCCTGCTTCTGTACATCTGTGAGC
TAGGAATGGTTTTTATGTTTTTAAATGGTTGAGAAAAATAAAAAAAGTTATATGGTAACT
TAATGATGTGAAAGTCAAATAAAATTTAAATTTCAGTGTTCATAAATAAAGTTTTATTGA
AACAGTCACAGTTAACTCCTTTAAGTATCATCTATGATGCTTTCATCCTACAGTGTTAGA
ATTGAGTGGTTACAATAGTGACTGTCTGGCTCTGTATAGAAAAAGTTTGTCTGACCTCTG
GTCTGGGACCTTCAGTACCTTTGTGGTTGTGTATGGTGGTGCTGGCTGAGGGATTTGGCC
AGGTCAGACCCATGACTTGTCTCTTTTTCCTCCTCCTTCAGCCTGGCTCCATTGATTCTA
ACAACCAGCTCTTTGCACCTGGAGGGCGGCTGAGCTGGGGCAAGGGCAGCAGCGGAGGCT
CAGGAGCCAAGCCTTCAGATGCAGGTACGGGGAACGCTGTAAGGAGCTTGTGGTTATTAA
CTTGAGCTTTCCCTTGAGGGCAGAGCCTTGCCCAGAAGGGAGGCTTCCAGTACAAGGTGG
TTAGGTAATACAGGTAGTATCAGAGGCATATGTTTGAGATTGAACTGCTTAACTATTGGG
ACTGGGACCAAATGTCCTAAACTGACAAACAGAGGAGAGGATACAAGAAAGTAGGAGATT
ATAATTCACATTTTCTGCCTTCCCAGCATCAGAAGCCGCTCGTCCAGCTACTAGTACTTT
AAATCGGTTCTCAGCCCTTCAACAAGCAGTTCCCACGGAAAGCACAGATAACAGGCGTGT
GGTACAGAGGTGAGGTTTCCTGTGTGTCAGTGTTCTTCACACTGAGTATGTGATTGCCTC
GTGCTTGATGCCATAGGATGGGAATTTCTCATACCTGTCGTTCTCCAAGCCCTTGGGTTA
TATTGGGACATAATTTATTATGCCTAGATAAAGGCCCAGCAGGTGCTCAGCATGTTGTGT
CATTACACAAGAGAGTGCCTGGGCAGTACAGGTGAGAGACAATGTGCCTATCTTTCTTCC
AGGAGTAGCTTGAGCCGGGAACGAGGCGAGAAAGCTGGGGACCGGGGAGACCGCCTAGAG
CGGAGTGAACGGGGAGGTGACCGTGGTGACCGGCTTGATCGTGCACGGACACCCGCCTAC
GAAGCTGAGCTTCAGCAAGGAAGTGGAGGAGCGGAGTAGAGAGCCGTCCCTCCCTAGCCG
TAGTGACTGCGCAAGGCTGCTAGCCTCACGGAGGATCGGGACCGTGGGCGGGATGCTGTG
AGCAGCTGGCAGAGGATTGGAGGGGAGGGAAGGGTGTTGGCTTGCTTGTGCCTAGCTGCT
CCCCAGCTCTCTTGAGAGCTCCAGACCCTGTTTGCTGGGAAGGCTGAGACTGAATTTCTG
ATCTGTGTTCTCCCACAGTGAAGCGAGAAGCTACCCTTCCCCCGGTAAGTCCCCCGAAGG
CAGCACTTTCTGAGGAGGAGCTGGAGAAGAAATCCAAGGCCATCATTGAGGAATACCTCC
ATCTCAATGACATGAAGGTAGGCAGTGGGAGGGGTCTGGGTGTTTGAGGAAGGGGCGGTG
GGAGAAGGGAGCCATGCTAACAGGCATGGGGGGGGCCAGGCAGTGACCACTTTCCTTGTT
GTGCCCTGTGCCTCATAGGAGGCAGTACAGTGTGTGCAAGAGCTGTCCTCACCCTCCCTG
CTCTTCATCTTTGTACGGCATGGTGTTGAGTCTACACTGGAGCGCAGCGCCATTGCTCGT
GAGCGTATGGGGCAGCTGCTACACCAGCTACTCTATGCAGGACACCTCTCCACTGCTCAG
TACTACCAAGGGTATGACCAGCTTCTGAGGGTCCCCCACTTTTACAAATCCTTCCTTTGT
GGGGCCCCTTGAACCTTTCATGAGAATGTAGGCTTCTCAGCCATTCTAGTCAATACTCTA
TAGAGAGTGGTCGGGGGTAGTGGTGAAGGGGGGAACAATCTAAGGACAAGAAGGTGGCCT
TAGCTTGAGATAACTGCCCCATGTCTAGAATAATGTTCCTTGGGTGGGTGGGGCTCCACA
GTTGATCCTTTAGCCATGCCATGCCTGTTGCCTCAGAAGGAGGAGGTGGCCTGGCCTGTC
TTCCCTAGAATGTCCTGACTTTGAATTCCCTTTGCAGACTGTATGAAATCCTAGAATTGG
CTGAAGACATGGAAATTGATATCCCCCACGTGTGGCTCTACCTAGCGGAACTGGTAACAC
CCATTCTGCAGGAAGGTGGAGTGCCCATGGGGGAGCTATTCCGGTAAGTCCCCCTTGGTG
AAATTTAGGGAAGTAAAGACAGGAAGAAGTAGGGAGGGTAGGGGTGTGTGGCAGGTTTGA
TGCTTGGGTTTGGAGAGGGATGGAGTAGGGTTGAGAGAGGTGTGGAGGCTGTCAACATTT
TGTTTTTCTCTTGTAGGGAGATTACAAAGCCTCTAAGACCCCTGGGCAAAGCTGCTTCCC
TGTTGCTGGAGATCCTGGGCCTCCTATGCAAAAGCATGGTGAGTGAGGGCCTTTCTGAGG
GTGGTGTGTTCAGGACTCCTCTCACCATGCGGTTTTGGCTCCTTGGAGTGGCCCTGAAGC
TTCATGGTCCATTGTTGGGATGGAGTAATGGTGATGCCAGTGCTATGTTGGTACCTGGGA
GAGGAAACATTGAGGTGGGCAGTCTCCCACAGGCCAGTTCCTGTCATGAGTTCTGGCCAA
CGCTGGAGGAGGATGGCACGCTAAGACCTTAGGCCCANNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGTGAGATTAGAAGGCTGTGATGAA
GTGTGCAGATTTGGTTTCCTTTGATTGGAGAATCCTACAAAAGCTAATTGACATTTTTTC
CTATAGGCTCTTAGGTCATTTTCCCTGCCCTAGTGTCATAACCCTGTGGTGAATGAGTTC
TTATTTATTTGAGTGGTTATTTGACTGGCATCTGTGCCTTGCACTAGACTGTAGACATGG
AAGGATTGTTCCAGTTGGTACCTCTATGGTATCCTTACTTAACTCCTAGCAGGTACCTAG
TAGACTTTTAGTAAATATTGTTGGGTGACTGTTGTGGAGCTGTTAAGTCCTTTAAAGAGA
AAGGATTGCTAAGTTGGTCTTGTGCTTTCCAGGGTCCCAAAAAGGTGGGGACACTGTGGC
GAGAAGCTGGGCTCAGCTGGAAGGAATTTCTGCCGGAAGGCCAGGACATTGGTGCATTTG
TCACTAAACAGGTTTGGGAGTTAGATTAATTCTAGTTAGATTAATTTGTCCTCATCTCTC
ACATGGTGTAACTTGCCTCTCTTGACTGTGGGCCTCTTTGGTTGCAGAAGGTAGAGTATA
CTCTGGGAGAGGAGTCAGAATCCCTTGGCCAGAGGGCACTGCCCTCCGAGGAGCTGACCA
AGCAGCTGGAGAAGCTGCTGAAGGACGGCAGCAGTAACCAGCAGGTGTTTGACTGGATAG
AGGTATGTTTCCCCTGGGTATCGGGGGAGGGGGTGTAAAGGAGAGGTATTTCTTGGGGCA
GGGTTGGGGGTGACAAGAATGAAGGCTTAAGGGCACAATTCAGAACTCTTGGGCCATTTG
TTTTCTCCTGCACAGGCCAACCTGAGTGAGCAGCAGATAGCATCCAACACATTAGTTCGA
GCCCTCATGACAGCTGTCTGCTATTCTGCAATCATCTGTAAGAGGAGTTAGGGAGATGGC
AGGGCGAGGGTGGACCCGAAAGACAAATGGAAGGAGGGGGGTTTCAGATTGCCTCCTGCT
TCCAAACCAGGCTAAGGGTACATTATGCCACTTAACATCCCTGTCTTCTTACAGTTGAGA
CTCCCCTCCGAGTGGATGTTGCAGTGCTGAAAGCGCGAGCGAAACTGCTAGAGAAATACC
TGTGTGATGAGCAGAAGGAGTTGCAGGCGCTCTATGCCCTCCAGGCCCTTGTAGTGACCT
TAGAACAGCCCGCCAGTAAGAGCCACGCGGGATGGGGATAGGGTGGAGGGACTGCCAGAT
AGCAGGGTGTAGTGGTGGAAGGGTCTCAATCCAAGAAAGGTGGGTAGTCNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTTTTTTTTATGGCCATTGATTAATTTCTGTGCACCAGTTTCTTA
GATTGTGACGTTAGCATCCTGTTGGAACCCTAGTCACTCTGGAATGGTCACAAATGTTAG
GACAGTGGGGCAGGGTCTTGTTTTAACAGTGGAGCTTAGAAGGGACCCCTGGGAGATAGG
CTGGGGTGGCTATGGCCAGTCACCTCTAACTGCTGCCCTGCCTCCTTGCAGACCTGCTTC
GGACATTCTTTGATACCCTGTATGATGAGGACGTGGTGAAGGAGGACGCATTCTACAGCT
GGGAGAGTAGCAAAGACCCCGCTGAGCAGCAGGGCAAGGGTGTAGCCCTTAAATCTGTCA
CAACCTTCTTCAATTGGCTTCGACAGGAGGAGGAGGAGTCTGACCACAACTGAGGGCTGG
TGGGGCCGGGCACTTGGAGCCCCATGGACATGCAGATGGCCCAGCCAGCCGCCTGGACTG
CAGGGGGGGCGGTGGCAGCGGCGGTGGCAGTGGGTGCCTGTAGTGCGATGTGTCTGAGCT
AATAAAGTGGCTGAAGAGGCAGGATGGCTTGGGGCTGCCTGGGGCCCCCCTCCAGGATGC
TGCCAGGTGTCCCTCTCCTCCCCCTGGGGCACAGAGATATATTATATATAAAGTCTTGAA
ATTTGGTGTGTCTTGGGGGGGGCACCACTGCTTGCCCCTGGGGTCCTTTTTTATTTTCTG
AAAAATCACTCTTGGGACTGCCGTCCTCGCTGCTGGGGGCATATGCCCCAGCCCCTGCAC
CACCCCTGCTGCTGCCTGGGCAGGGGGAAGGGGGGCACGGTGCCTGTAATTATTAAACAT
GAATTCAATTAAGTTCACTGCTTCTGCTTTATGGCCTGTTCCCTCTGGAGAAGGGGTGTG
CATAGATGGGTATTCTCCTTTCCAGAGCTGGCACTGTAACACTTCCCTGTAACCTGGCAC
CCCTCCTGCCTCTTCCCCTGTCCATGATTTCAGGGGTCCGGGGAGTCACTTCCCTGGAAG
GTTGGGCCCTTGAGGTGGGCCCTCTTGGTTAGCAGAGAAGGGAAATCAGTATTAGAACAT
CCATGCTGCCCCATGCTCTCCTACCAGAATGTGGTACAACGCCCTGTGAAGCCTTTGGGT
TTCAGGCTGTTTATAGCCAGAGGATCCTTTTATGGCTTCAGAGTGTCATCTGTAAAATGA
GGGGGCTGGATCCAAGGAGGTTTTCTGTCCCCGCGTGAGTTACTGCCTCCCCTGCATTTC
CAGTGGCTCCACAGTCGGGCCTGGGAGGAGAGGACCGGCGTTTTCCGACCTCGGCCCCGG
GCCGCCCCTGCGTGGCCGTGACGTCGGCTGCGCCCCGCCTGCTCCGAAGGTGACGCGGGC
GGCCACGCCCCCGCGCTTACGTCACCAGCCCGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 1017..1118, 1420..1506, 2011..2031, 2677..2853, 3061..3160, 4243..4355, 5192..5284, 5493..5559, 5851..6401, 6404..6442, 6445..6667, 6925..7013, 7103..7289, 7377..7510, 7635..7787, 7790..7792, 7976..8161, 8347..8544, 8763..8909, 9114..9224, 9227..9349, 9480..9584, 9694..9853, 10071..10171, 10781..10883, 11126..11228, 11462..11574, 11576..11625, 11628..11633, 11637..11639, 11646..11696, 11840..11956, 12078..12250, 12577..12702, 12856..12937, 14492..14590, 14687..14821, 14955..15036, 15174..15314, 21231..21412
1001..1015, 1017..1118, 1420..1506, 2011..2031, 2677..2853, 3061..3160, 4243..4355, 5192..5284, 5493..5559, 5851..6401, 6404..6442, 6445..6667, 6925..7013, 7103..7289, 7377..7510, 7635..7787, 7790..7792, 7976..8161, 8347..8544, 8763..8909, 9114..9224, 9227..9349, 9480..9584, 9694..9853, 10071..10171, 10781..10883, 11126..11228, 11462..11574, 11576..11625, 11628..11633, 11637..11639, 11646..11696, 11840..11956, 12078..12250, 12577..12702, 12856..12937, 14492..14590, 14687..14821, 14955..15036, 15174..15314, 21231..21409
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved