Microcebus_murinus Locus SPNS1
snOPY snoRNA Orthological Gene Database
Microcebus_murinus SPNS1
Microcebus_murinus
SPNS1
GeneScaffold_3831
SNORA57
4065..4210
7477
CTGTGCCCCTTCCTAACAACGGCTATAATCGCTGCGCGCCTCATCTGTGGCCGTGGACT
ATAGTCACGCTCCTACGGAAGTGGTTAGTAAGCGTCCCCGTGAAGGCTCGGGGACTCAGG
GTTGGGGAGTCCGAGGAGAAGGAAGGGGGCCCCCGGCCCAACCTTCATTCATTCAACATT
ACTGAGTGGCCGCCGAGCGGACACGAAGAGGGAGACAGAAGGATGATTTCCGCGGAGGCA
GGACTACTTACGGGCATTTCTAGAGACATGCACTATTTCCAAAGCCTTTTGAGATCTCAT
GATCTCGTTGGATCCAGCAGGCCGCCAAGTGGGCGTTCCAGATAAGGCGAGTGAGATGCG
GAAGGGATGGGCGACTCCGCCACGTCAGGGACGCCCCTCAGGTTTGAGGTCTCCGCGGGG
AGAGCGGCCGGGTTGCGCTGGCGCCCAGCCAGCTGGGGCTTCCGGGCTGCAGGGTCTGGG
ACCAGGTCACTGGTTACCCCGGCGACCGGTCGGCAGTCACGTGACGCGGGAGCACGGCAA
GATGCCCAAGAGGCTTCCGTAGGCGGGCGGGCGGTCACGTGTGGGGGGCTTGTTGGCTGG
GACACCTTCCCGCCGGCTCCGGTGTCACATGACCGGCTCAAAGCCAACATGGCGGCTGCC
GTGGTGCAGCGCCAGGACTGAGCGACAGCGACTGCAGTGGGCTCCTACCTGGGGTGAGGG
GTGGCCTCAACGTGGGATGGGGGATCGCGTCCTCCGCAGTGCCCGACGTCACCTGAATTC
CACACGCCGCCTCTGCGCAGTGTGTCAACTGAGATGGGGAGGCGTGACAGGGCCCGGGTC
CCTTCCCACCCGTACTCTGTGCTTCAGGGCCAGCTCCTACGGGTCTCCGGGTGCACTCCC
CTCGCCTGGGCTCCCTCCATCTTCCTTTTTCCACCTTCCTCTCTTTCCAGGTGAGATCGT
CGGTGGGACCGGAGCGCGGGCGGGCGCGGTCCCCCGGGACTATGGCCGGGTCCGACACTG
CGCCTTTCCTCAGCCAGGCGGATGACCCGGACGACCGGCCGGTGCCCGGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNCCTGGAGACCTCTGCAGTGTCCTTAGCCAATGCCATCTTATACCCCCTCCTA
GCCTGAGTTAATCTGCCCACCCTACCCCCTTTCCTTTTCTTCTAGATCCTTTTGTCCATC
ATCCCCTCTTCCTCTGACCACTTACTCCTTCCACTCCATACCTAGACTCTATGCTTCTCT
GCCATGGCAAAATCCTTTCTGTCCCTCTCTCCCTCTTTGCCTTCCTGGTCAGGCTTCCCG
AAAGGCCCCCTGGATCCCTCCCTCGCCTCCCGCTCACATCCTTGCACCCACTGCTCTGTG
ACCCTGCTCTTTCCAGAGTCTGAGTGGCCTCCTGGTGATAGATCTCCGGAGCTTCTGGCA
CTATTGACCCACTTCCTCCTTCCTGAAACTCTTTTCTAATTTATATGATGCCACACTCTT
CCAGTTTTCCTCCTGCCTCCCCGGCAGGTGCTTCTTTGCTCCTTTGAAGTCTCCTCTGTC
ACTTCTCACTGTGCACTCTGTCCTCAGCCCCGGGCCCTGCATGGGTGGTGTACCCGTCCT
TAGCTTCAGGTGTCTTTGGTAGAGAAATCATCTCCCACCTAGAATTGTTATTCACCACCA
GAGTGTCTTATTTAGACCTCTTATTATCCAATCCTCACAATAGCTATGTGAATAAGTCGT
TATCCTCCTTTTGCAGATGAGGAAACTGAGGCTCAGAGAGGTTAAGTTACTTTCCCAGAG
TCACAGCTAGTCAGTGGTGGAGCCGGCATTCAAGCTCAGGTCTGTCTAATTGTAAAATCC
AGGCCTCTCCTGCTATCCCTGCTGCCTCATCGGAGCCGGCTGGCGAGGTGGCCCGGGAGG
CCGCTGCAGGGCAGGGCGCCACCTCTCCCTGTCTCGTTCCCTAGCGTTTCTGGCTGCTCC
TCCTGACCCGGGGCCTGGTGGGGGTCGGGGAGGCCAGTTACTCCACCATCGCCCCCACAC
TCATCGCTGACCTCTTTGTGGCCGACCAGAGGAGTCGAATGCTCAGCGTGTTCTATTTCG
CCATCCCGGTGGGCAGGTGAGGGGTCCCTGGGCCTGGTGGGGAGGCAGATGGGCCTGGCA
TGGGGGACTTGACTGACTGGCTGTCACCTCTTTTTCTCATCCCCCCCACAGTGGTCTGGG
TTACATTGCAGGCTCCAAAGTAAAGGATGTGGCCGGAGACTGGCATTGGGCTCTGAGGGT
GAGTCTAGTCATGGCCTGGGGCAGGTCAGCGATGTTCTCACTGATCCCCCTTTCCCCTTC
AGACACCCCCTTTCTGAGGCCGTGCTCCCTCTGCAGGAACCTGGCCACCCTTACCATGAA
GCCATGTGCTAGACAGAACTCTTGCTTGCAGGTGACAGAAACCCATTGTAAGCCCCCAAA
AGGGACTGTATTGGCTTTCTTCATGGAAAGTCCCAGGGTGAGCTTCAGGTAAAGCTGGAT
CCAGGCTTCCACACCATCACAGGAATTTAATCGTCCTCTTCTCAGCTTTACTTTCCTCTG
TGTTACCTTTATTCTCAAGCATGTGAAGCTCCAAATAATTATCTTCCCATTTAGAAACAT
CAGCATCTCGGATCCTTGAGCTGTAGTCCTGGGACAGTGTCTGATTAGATGAGTGTGGCT
CGCATGCCTGCTGTGGAATCAGTCATCGAGGCTGGGCTGGTGGCAGCACTTTCACTGGCC
AAGCCTAGAATCCTGCTTGAACCATGTGGGTTGAGAGAAGCTGGGGGAGTGGTTTTCCAA
ATGAAAATTAGGATGCAGTTACCAAAAAGGAAGCAAAGTTAGGCTTACAAAAATATGGTG
GCCCCTAGTAGCAACACCCCCATTATAGGTCAGCTTGTTTGAGCAGGCACATGGGTGTTT
GAGGTTTTGGGCCCAAGTTGTCTCTACCCCCTCATTCTCCCCAGCTCCAGGGGTTGTGCC
TGCCTGTCCTGAAGCCAACTCTCTCCCCAGGTGACACCAGGTCTAGGAGTGGTGGCTGTT
CTGCTGCTTTTCCTGGTAGTACGGGAGCCACCGAGGGGAGCTGTGGAGCGCCACTCTGAT
TCGCCACCCCTGAGTCCCACCTCATGGTGGGCAGATCTGAGGGCTCTGGCGAGAAAGTGA
GTTTAGTCCCTTCCTAGACCAACATCTGAGGTCCCCCAGGAAGTCCCTGACATCTGAGAT
TTCCATGGCCATGTTCATTGTTTTCTTTTCTGCCAACCGGCCCACCCCAAGGCCAGGAAT
CAGTCACAACTGCCCCCTTGTGCCAGCTTCTTGAATTACAGGCCCACATCCTGGGAGCTA
GGACAGCCTTCAGTGTTCTGGCCTTACTAAAATAAGCTAGACTGTCCTTTTCTTGGCAGG
GACTGGGCATGTGGTCCCACTCCCTGCTATGTACAAAGGCAGAGGGAAAGGGCTCCAGCC
CCCTCAGGGTCACGCTGTCAATGTTGGTGGCTTCCCATCTGCTGGTTCTATCCTCACGTG
CTAGGATCCTGGGCAAGAAAAACAAAAATAGGCCAGAAAGGAGGAGAGAGGCCCCTCCTG
CCTCAACACCTCCATGGAGTCTGACTTCCGCCCTCCCAACTCTCTGCAGTCCTAGTTTCA
TCCTGTCTTCTCTTGGATTCACTGCTGTGGCCTTTGTCACGGGCTCCCTGGCTCTGTGGG
CTCCCGCATTCCTGCTTCGTTCCCGGGTGGTCCTGGGGGAGACCCCACCCTGCCTTCCTG
GAGACTCCTGCTCTTCCTCTGACAGGTACCCAGGGCGGCTGGGCTAGGTGGCTTGCAGAT
GGCAGGGATGGAAAGAAGAGGGTCTGTGGTTCACACCCAGGCACGGAGGTCCAATCCCAA
CTCCACACGCTGCGTCTTCTCCCAGAGTTTGTTTCCTGGTCTGGGAAACATGTGATGGGA
TAACACCTGCATCTCAGGGCTGTGTGACCTCGGGGTGCTGTGCCGGGATGGACCCGATTG
TGGGGGTGGCTGGGATGGGCCGTCTTCCTCTGCAGGCCATGGGGGCCAGCCTGGGGGCTG
CGCAGGCAGGACTGGCCCCCATACCCCTTCCCCATCCCCCAGTCTCATCTTTGGGCTCAT
CACCTGCCTGACCGGGGTCCTGGGTGTGGGCCTGGGCGTGGAGATCAGCCGCCGCCTGCG
CCGCTCCAACCCCCGGGCAGACCCGCTGGTCTGTGCCGCTGGCCTCTTGGGCTCTGCACC
ATTCCTCTTCCTGTCCCTTGCCTGCGCCCGCGGTAGCATCGTAGCCACCTATGTGAGTAG
TCGGCAGGTGACAAGAGGGGTGGTCTGGGTTCGGGGTGGGGAGGAACAGAGTATTGGGGA
GGACTGGCGTTAGCCAGCGTGTTGTTCTAGGCCTGCTCTCGGTTGAATGCCTGGCCTTTG
AATCAGCTCTGTGACCCAGGCAACCGCTTTAACCTCTCTGTGCTCACTTTTGTTATCTAA
AGATGGGGGTAATAGTAGCACCTGTGTCACAGGGGTATGGTGATGATTAATGAGTTAATA
GAGGAGCCTGGGATGGGTGCACACCTGTTTATGACCTTGTTGTGATAAGATCCTACCCAC
TCCCGTCCCCCAGATTTTCATCTTTAGTGGAGAGACGCTGCTGTCCATGAACTGGGCCAT
CGTGGCTGACATCATGCTGGTGAGTGGCTGGGCAGCTCCGTGGTTAGCCCAGAGCCTACT
TCCGGAGGCCTCACTCACCCGCTCTAGACTGCAGGCTCCGGCCCACAGCCCTGGCTTGCC
CTGTGACCTCATCCCCAGTCACACCTCTGACCCCAGCCTTGGCCCCAACCTGGCCCCCTG
CCCCTGCTCCTGTGAGCCCCCACTGAGCTCCTGCTCCCCCTAGTACGTGGTGATCCCCAC
ACGACGGTCCACCGCCGAGGCCTTCCAGATCGTGCTGTCCCACCTGCTGGGTGACGCTGG
GAGCCCCTACCTCATTGGCCTGGTGAGCACTGCCCCTCGGCCGGGATGGGATGGGGAGTA
GGTAGGGGACCAGGCACGGGCACTCCTGCCACTGCCAGTGGCTTGAGCCTGGCCACGTCG
GAAGCTCTGGCCCCTTTCAGGCATCTGTGTCTCCTGTGCTCACCTACCGTCCTCAGCTGG
AGGGCGAGGATTTTGTCTTGGAAGATTCTACCCATGAGGCCAGAGAAGACCTTGCCTTGC
CGGTCCAAACTGTCTTCCCTTTTCCAGGCTCCATTTTCCTTTTTTCCTGGAGTTTGGGGG
CTCCTCCCTGGGTCTCTCCCTGACTCTCCTGTCCCCTTCCTCCCGCAGATCTCTGACCGC
CTGCGCCGGGGCTGGCCCCCCTCCTTCTTGTCCGAGTTCCGGGCCCTGCAGTTCTCTCTC
ATGCTCTGTGCCTTCGTCGGGGCGCTGGGCGGTGCGGCCTTCCTGGGCACCGCCATCTTC
ATTGAGGGCGACCGCCGGCGGGCCCAGCTGCACGTGCAGGGTCAGTTGGAGGCTGCACCC
TGCCCAGCTGCTCGGTGCTGCCTGTCTGTCTGTCTGTCTATGTCCCTCAGTCCACAGTTC
TCCCTCTATTCAGCTTTGGGCCTGTCTGGGTCCACAGCTCTGGTGCTCTCTGCTGCTGCC
CCATCTGTGTTCCAACATCTGCGTGTCCCTGCTCTGGCTTTGTGTCTGTCCATCCAGCCC
CAGCTCTGACCCTTCCCCCGCAGGTCTGCTGCCCGAGGCAGGGCCCGCAGATGACCGGAT
CGTGGTGCCCCAGCGAGGCCGCTCCACCCGGGTCCCTGTGTCCAGTGTACTCATCTGAGA
GGCTGTTGGATACCTGTGTATACATCTGTCAGCAGTGGCCCAGGGCTTGCCCCACAGGGT
GCATGGACCTAAACGTTTGGCCTGGCCCGGCTTCCAGGAGGGACCGTGGGCTGTGTCCCA
GCTCCCAGACACTACATAGGCAGCCCAGGGGAGGAGGTGGGGGTCCAGGAGTGGAATCCC
CTCCACAGGGGCAGCCCCAGGAGCTCGGTGCTATTTGTAATGGAATAAAATTTGTAGCCA
GACCCCAAGAGCCTGTTCGACTCTTTCTCTGGGTGCTGGTGACCTCTGACCTCTGGACTA
TAGGGGATGCCCTGTCTCCACCGCTAGGGCTTCCGGGGGCTATTGGGTCTCATCTGTGGG
GCCTTGGGTGAGTCTCTGCCCTTCTGGGCTGGGTGGTCAAGAGGGAAGACTACTGTCCTC
TGAGCTGGCTCGGTGTGACCGTGAGTCATGCCCATGCTTCCCCGGAGCCTGCCCCTGCTG
GCATGCAGGCCTCAGGGAGGTGGGGGTGGGCACGGCTCGCGCTCACAATTCCCACTGCGG
AGTCTCTCGGCTTGCTGCTCCAGCCGTGGAGGTGAAGGCCACAGCTGCTGGCTGGCCTGT
GAGGGTCTCTCCCTTCCACTATGTCGTGAATTGTCCTTGTCCTGGGGCCAGCAGACCTCT
TGAGAACCTGGGGTGGCTCCTTGGGTCTCCCCCTACCCCCTCCCCACGGGCTGGGTGGGG
GTGGGAAGGGGCGGGCGCAGCCAGCTGAGGAGCCCGATGATTTCCTGCCCTCACCCAGCG
CTCACCACAGCTTCCTGCCACGGGCGGAGGGGAGGCGGGCGCCAGCGAGGGGCAGGTACG
GCTGGGGTGGGGGGACCAAGCAGCAGGTGGCTGGAGCCCTGGACTCCAGCCCAGGCCCTG
GCCTGACTGCCCTGGGACCAAGGGCTCCCAGAGCCAGTGCCGACCCCCACTCGGCCCATC
TAGGGAGGGGATCCAGGGACCCCAAGGAAGGGCAGCTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1241, 1344..1409, 1510..1646, 2624..2775, 2871..2937, 3690..3835, 4309..4464, 4782..4971, 5293..5358, 5563..5661, 5988..6159, 6383..6477
1001..1241, 1344..1409, 1510..1646, 2624..2775, 2871..2937, 3690..3835, 4309..4464, 4782..4971, 5293..5358, 5563..5661, 5988..6159, 6383..6474
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved