Microcebus_murinus Locus CCAR1
snOPY snoRNA Orthological Gene Database
Microcebus_murinus CCAR1
Microcebus_murinus
CCAR1
GeneScaffold_257
SNORD98
25101..25165
71745
AGCGCCCCTCAGCCTCGCCTCCGCAGCCTTCAGCCTGCTGTCTGCCGTCCATCACCCCT
GCGCCGCTGCGGTGTTAGCCTCCAGGCCCAGGGCATTGGGGCGGCTCGCGGCAGCATGCG
GTTTGAGAGATGGAGGCTTTCTCCGTCCGGTCCAGGGGTTGAGGAGACTGCAGCTCTCAG
TATCCCCTCGTTAGCGCTTCACCCACTATCGTGGGTCGGTAGATTCCGCCTTCCGTGTTC
TACGGCTGGCTGAGGCCGGAGGAAGATGGATGGCAGAGCTCTGGCCCTTCCGAGTCGTGC
GGCCTGGGGGGGAGGGAGGGGGCGGGGAGGAGTGCGCGGGCGGAGGTCTTCGCCTTTTCT
GGTGTGAATTGGGGGGAGGGGTCTTTGCAGTGGTTTTTGAAGGGGCATCCGTTATCTCAA
CTGCCTTTTCCCTCGAGGGAGGGGATGGAAAAGAATCTCACGGTTTCTTTAGTAGAGAAA
GTAAAGAGATGTTCGTTATTTAAATGATATTCTTTAAAGTTTTTTCTTGGGGGTCTCGTC
CTAATTTCCGTTATTGGCTTCATCACTTCTCTGGCTTTACTCCCCAACCTATTGCAGTAG
GAAACACGCAGGCGATGTTTCCTGTGAATATAAAGTTGTGAACTTCTTTTTGTTAACAAT
TGGGTAGACACAGCAGATGGTCTTCCGTTTAAATGCGACAATTTGTAGTCGCATGAGTGC
CTTTCTTGTAAGTGTACTCCTTAGGTCACCTTTTAAACTAGGGTAGTTTTGGTGATGTAC
TTGATGTAAAACGTTTTAGCTGCATTTCAGATGTTCTTTTGCCCTTTTTCTACTTCCACT
TATGTCTACTTAGATCTATGAAGATGTCCTTGATACATTAAACATTTCTTTCAGATGTCA
CTTTGTGATATTTATAGTTTGGCTGAACTTTAAAATGTGGATCCTTTCTTAATAGATCGC
TGCTATAGAAGACAAGCGAAGGTTTCTTTTCCCTTTGCATCATGGCTCAGTTTGGAGGAC
AGAAGAATCCGCCATGGGCTACTCAGTTTACAGCCACTGCAGTATCACAGCCAGGTCAGG
CTACTGAACACATGTACTGTAAATGTGGGGGGAGGACCCTATTATAGCTATATGGATTAG
ACTGTGCATGATGGTGTAAAATGTTTGCAAATGATGCATCCTTTATCTGTGAGGGTCCTT
TTAAAAATTCACGGAAAAACTCGTAAAAAGGCTGTTTCACCTAGCAATTTGGACAGTATT
GGCTTTTAATTGATCTGATTATGTTAGAGGTTAACAGCCATTAAAATAGAATATATTTTG
CGTGCTAAGGTGCTAGTATTTACAAGTTATATTTAAAAGTAAATATTTGAAAGCCATACT
TTATGAAAAACTATACATGCCTGTGGTCTTCAGTTTGAATTCGAAGTAGGAAAAACCAAC
TCTAAAGAATGTAATTACCAAGCAAAGGAAAATGATAGTTGTTAAAGCAGTAAGTGCACA
TTTACATTTTCAAAATAAATGAAAAATGTTACTGAACCTGTTTCAATAGATTTTTTCCCA
ATTTTCTAAGGAAGAATTTTTTTTCCATTTCTTGACTTACTGGTTGAAACTTAAAACATT
TAATTCTTCTGTAGCTTTTCATTTTTTACTTAAATATAATAAGCCAGTAATGTTTAGGCA
TTTTAAATCAGTTTCCCAGGGATTCTACAGAATTGAGATTTTGAGTACCCAGAAAAGTTG
CAGCTTAGTCTGTTCATTTGAATATATTTTTATTTATGATATATCTTGTAGTAGTGCTTA
GTTGTGTTCTATTTGCTTAAAATATGTTTTGTGATTTGAGGTCAATTGTAGAGACACTAA
TCCTCTAACTTTAGTGTTCTAAAATTTCTTTCTCTTTTTGTATGTCACTCTCTTGTCCCA
GAAGTGTTCTAAAATTTGGTAGGAATGATAGTTATCTAGGTGACCTTTTTCCTTAAATGG
ATATTTCAGTGTTTTTTTTTTTTCTTCCTCTAGTCATGGAAATAGTGTTTTTAATTACTC
TTGATTTGGGTGATTAAAGATCAGCAGTTACTTCTGTTGGTAAATGAAAATTATATGAAA
TGATAATTATAGATATACTGAATTTGGATCCAGGTATTTCTTTTCTATGTTACATAATGG
GAAAAAAAATTTACTTAGTTTTGATTAAACAGGAATTATTAGCAACTACTGTGTGTCTAG
AAGCAAGTGCTGTATGGTAAACAAGCATGTTTTAGCTGGCTTTTACTGCATATGATTTGT
TTTAGATTCATGTCTGTATTGTGTCAATAAAATAGCTGTTGTGTACAATTCTGTTGTCCT
TAGCTCTTAATATCTGTATTGTAATTATTTGAATGCATGTTGTATTCCTTTATTTTTATT
TTAAGATTGAGCAAAGGAGGCACAAAGGAGGTTTATAAAATTTGTCAAAGGCTGAGTCAG
TAGTGAATGTAGGTCTTCTTTTTCTGTGTTTGGATATACAGATTCCATATATGAATAATG
AGATTTTGTAAACAGCTTGTATTTGTGCCTGAAATTATTTATGGATTTTCTTAGATCTAT
CATTAATCAGAATTTTTCAAAAATCTAAAATTTGCTGACATCATCACTTCTAAAAGTAGG
CAGGTATTTTGTTAGTGTTTAGGGCTTGGCTTTCCTATGAAAGTCCTGGAGTAGGTTCTA
AATGGAACTGTCCAGAGACTTTGTTTTGATTAAAATATCTAATCTCTAGGTGCTATATTT
TGGGCTACTTCCTGAACATTTGATATTTTTCTTGCCACTTTTTTTTTNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTCACACTTGTAATCCTAGCACTCTGGGAGG
CCGAGGCGGGCGGATTGCTCAAGGTCAGGAGTTCAAAACCAGCCTGAGCGAGACCCCGTC
TCTACTATAAAAATAGAAAGAAATCAATTGGCCAACTAATATATATATAGAAAAAATTAG
CTGGGCATGGTGGCTTGTGCCTGTAGTCCCAGCAACTCAGGAGGCTGAGGCAGTAGGATT
GCTTGAGCCCAGGAGTTTGAGGTTGCTGTGAGCTAGGCTGACGCCACGGCACTCACTCTA
GCCTAGGCAAGAAAGCGAGACTCTGTCTCAAAAAAAAAGAAAAAAAAAAGAAAAGAGACA
TGTGGGTATTGATTGTCTTCCCACCTGCTTGGAGCTGGACTGCTGTGTGCCAGGGCACAG
AACACTTATAAAAATTATGAGAAAATATAGACATTCTGAGAAATTGGCTCTGAGCTCTTC
TGCTATGGCAACTATCAGTACTTCACAGGGGTCTGGAAATTGGTACCAGCTGAGGCCAGA
GCTCAGGTGTGTGAAGGAGATGGACATGCTATTTGAAGCTCTGATGTTAATTTTTTTTTA
TTTTTTTTTTGAGACAGAGTCTCACTTTGTTACCCAGGCTAGAGTGAGTGCCNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTTATTACC
TCACATCCTTATTTTTTTGTGTGGTGAGAATACTTAAAATCTACTCTCAGCAATTTTCAA
ATATACAATATATTGTTATTAACTGTAGTCAACATGGTATACAATATGTCTCTTGAACTT
ACTCCTCTTAACTGAAATTTTGTGACCTTTGACCAGCATCTGCCCAGTCCTGCCCTCCTC
CCCTGATAGCCACCATTTTACTGTTTGAGTTCCACTTTTACTCTCCACACACATAAGTGG
GATCATGTAATGTTTGTCTTTCTGTGCTTCGCTTATTTCACTTAACATAATGTCCTTTAG
TTTTACTCATGTCACAAATGACAATTTTTTTTTTTTTTTGAGACAGTCTCACTCTGTTGC
CCAGGCTGGAGTGCCGTGGCATCAGCCTGGCTCACAGCAGCCTCAAACTCTTGGGCTCAA
GCAATCCTACTGCCTCAGCCTCCCATGTAGCTGGGACTATAGGCATGCACCACCAGGCCC
GGCTAATTTTTTCTATATATTTTTAGTTGTCCAGCTAATTTATTTCTGTTTATTTTTTAG
TAGAGATGGGGGTCTCGCTCTTGCTCAGGCTGGTCTCGATCTCCTGAGCTCAAACCATCT
GCCAGCCTTTGTCTTCCAGAGTGCTAGGATTACAGGTGTGAGCCACTGTGCCTGGTCTTT
TTTTTTTTTCTTTTCTTTTTTTGTTTTGGAGATAGGGTCTTGCTGTCTTCCTCTGGCTAG
AGTGTAGTGACACAATCATAGCTCACTATAACCTCAAACTCCTGGGCTCACACATACTTC
CTGATTTAGCCTCCTGAGTAGCGGGGATTACAAGCACCAGCCACTGTGTGTGACTAATAT
TTTCTTTGTCTGTTCTTCTATTGATGGGTACTCAATGTTGATTCCATATATATAATTAAT
ATTCATGGACATTTGATAGTTACATAGATTTATGAGATACAAGCCATATTTTGATTCAAA
CATACAATGTATAATGATCAAATCTGAGTAATTGGGATAGCCATCACATCAAGCATTTAT
CATTTCTTTTTGTTAGAAACATTCTAATTTCACTCTTCTAGTTATTCAAAATACACAATA
AATTATAGTTAACTCTAGTTGCCCTATCATGGTATCACACTAGATCTTATGCTAAGTGTA
TTTTTATAAGATTCCACATCTCGAAGATTGTGAATAATGTTACAATGAACATTGAAGTAC
AGATGTTTCTTCAGTATACTGATTTTATATTCTTTTATATTCTTAATAATCTTGATTTTT
TTCCTTCTCTTTTTAATGTCATTTTAGCTGCACTGGGTGTTCAGCAGCCGTCACTCCTTG
GAGCATCTCCAACCATTTATACACAGCAAACTGCACTGGCGGCAGCAGGCCTTACCACAC
AAACCCCAGCAAACTATCAGTTAACTCAAACTGCAGCTTTGCAGCAACAAGCTGCAGCTG
CAGCAGCTGCATTGCAACAGGTGAATCTTTACTAGGTTTTATTTTGTGATTGTAGAAAAC
TTTATAAAATCTGTCTGAGTAGCCAAGGTTGTGACCATTTTATAAATAATGAAGAATTGT
GGGGATTTTTGTTTGTTTGTTTTATTTGTTTTTTATATTTTACTTTAAAATAAATCTTCT
AATAATCTTTTTCTCTTCTTCTTCCCTGGCATTGTCTGTCTTATAACATTGTGGGTTTTT
ATTATGCTTATTGTTTTTTTCAGGGGATGAAAATTATATATGCCCAGCACATATAGAGAA
GTATAGTGGAATAATAAAAATTCTTAAGTTCTTAAATTAGACAGTTCTTATATCTTACTT
ATTTGAACAAAATTCAGTTCTTGATGGATCCCAGTGTATAAGTAATTACCATTTTGTTTA
TTTTAGGTGAAGTTTAGCTTCAAGAAAATTTCTGTTTAGTGTAATTTTATGTATTTCTAT
ATATGCACTACTTTTTGAGAATGAATAAAAATATTTGTTTTTCAAAAATCTTTTTTTAAT
CTTTCAGCAATATTCCCAACCTCAGCAGGCCTTGTATAGTGTGCAGCAACAGGTTAGTTT
ATATTTTCCATATTAAAAACTCATATAAAATAGCCATTTGTTCCAAAGGTCAATTGATGT
AGATTTTTTTTTTTTACCAGCTACCTTAATGTATGAAATGAATTCTTTGGGAGGGTATGA
GGTAAATGAGGTAGGAAAAAAGGAATGTCTCCAAGGGCAATGGGGATATGGGAGTGGTCC
TAAAAACCTAGATTCTCAACTAGCACCCAGTCTTAGTCACATATTTCTAAGAAAGTATGC
AGAGGATAATCTGGAAAGAACCACTCTATTACTGAGTCTGGCCCTTTACTCCTTTCTGGA
ACCTGTAGGCCAACTCTGCTGAACTAGACCACATGTGAAAATGAAAAGCTCCTTTTTGTG
CTTGTAGCCTAAATTCTATATAGGCCATTGTTTTTTATCCTTTATTTTTTTAAAGCAGTA
GAACCTCCGCTTGTTATTTTATTACTAAAATTGTATGGATCTGATGGTTTTAGTTCCAGT
CCTACCAAAAAAAATGATAAAAATTAAAAATTCTTAAAAAGTAAAAATAGGTGGCTCACG
CCTGTAATCCTAGCACTCTGGGAGGCTGAGGCGGGTAGATTGCTCGAGGTCAGGAGTTCA
AAACCAGCCTGAGCAAAAGCGAGACCCCGTCTCTACTATAAATAGAAAGAAATTAATTGG
CCAACTAATATATATGTATAAAATTAGCCGGGCATGGTGGCACATGCCTGTAGTCCCAGC
TACTCGGGAGGCTGAGGCAGAAGGATTACTTGAGCCCAGGAGTTTGAGGTTGCTGTGAGC
TAGGCTGACGCCACGGCACTCACTATAACCTGGGCAACAAGTGAGACTGTGTCTCAAAAA
AAAAAAAAAAAAAAAAAAAAAAGTAAAAATAATAAAAAAAATAAAATAAAATTGTATGGA
AATCTTATATATAACATACTAAGATAGAGTTGTTGAAAATGGGAGAGCCTCCCCTTGTAG
TTCACACCCCTGCTCCCAAGGCATAGTTGAATAATCTGAAAACTCCTGATTTAGACATAA
AGCAGTTTCTTTGGCTCTTTTTCCTTAGACTCATACTGTAATCATTTTCCTCAAGGTCTT
ACATCTATGTTGGTTGGAAGAGGTTTAAAAAAAAAAGAACCCCAGGAGAAGATTGTAAAG
GAAAAGAGAGTTTGCCTTGGTGGAATCTAGATAAGCTGTAGTCTAAGTGCCCATTCTAAG
CTTATCCACGGCTAGGAGGTGATCTTCAGTCCTTTCTGATGCCATTAGGAAGTTTTAGGA
ACATACAGCATTCAGGAAAGGAAAAAGGAATGAAAAAGATAGGGACCAAAAACTTGATTC
AAAGAAGTATAGAGGAACATGAGGCTTCTCAATCCATAAGCTCTTGTCCCTAGATCTGTG
GCCTACTTTCATTCTTGGCTTAAGCCCTTTGAGGCTTCAGAAGCATTGCATTTTCCCTCA
GCATTATAGTATTCCAATAGTAATTGCTTTAAAATTTAAAATACTGGCAAGAGATTTCAA
AGTCAACTATCTTGTTTTCAAAATACTCTTAGACTTATTTTACTCTTATAAAATGTTATT
AAAATTATAATGATTTAGGTCAAACTATATGAAAATGGCATTACTCATTCTTGCCTTAAC
AATGGCATTATTCAGTTGTTCTGTACTTTTAGAAAAATGGTATTCTGGTCTGATTTTACC
TCTAATATATGGTGACTCCAGGTAAACTGAGTGTTTTGAATTAGAACCTCATTGTAGGAC
AGGTGCCTCTAAAAATTTTGGGGGAGGAGCAGTGGCTCACAACTATAATCCCAGCACTTT
GTGTGGGAGGCTGAGGCAAGAGGACCACTTGAGGCCAGGAGTTTGAGACTGGCTTGGCAA
CATAGTAAGACCTTGTCTCTCTACAAAAACCAAAAAACTTAATATAGGTTTTTTTGTCTT
AGCCTAATTCAATTTATATTCTAGAGTTTTAAATTTCCCGCCTCACACCAATTCCTTTAC
TTTCTTGTAATGGCACAATTTGCTATGCCAGGAAAAACATGGGCAAAGTGTGTGGTCCTT
TCATAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTTACTTTCTT
GTAATGGCACAATTTGCTATTGCCAGAAAAACATGGGCAAAGTGTGTGGTCCTTCATAGT
CACATGCCTGTGACAAGTCTGACCATCAAGAGTCCATTTTAGGGGATATATATGAATTAG
ATGACCAGTGATTTTTTTTGATACAAATAACATAGTGATGATATTGAATCATTTCTGTAG
CATATTGGGGAACCAGAAATCTTTACTTTTAGGTACTTGTGGGGTGTTATTGTGGGTGTT
ATTCATATGAAATAACAACAAAAAAATCAAGTTTTCAGTTTTTTATTAAATGTAACTAAG
CGCCTATTAGTGAATGAGTTACGTACATATATGGTCTTCAGTTGTTAGAAATAGTTGTAG
AAAATCTTATACCTAATGACCTTTGTTAGTTTTCACATTTTACTTAAAAATAAAGTAGCT
ATTTAATAGGAATTTTTCCTTTTATAAATTATCTCTGAAACAACAATTCTGATTGATCTT
TTTCCTTTTTTTTTTATGTATTTTTTTTCCTATTTTCAGTTACAGCAACCCCAGCAGACC
CTCTTAACGCAGGTCAGTTTGGTGTTACTTTATTTCTTTTGGATATCCGACTGAACCATA
AAATTTTATTCCTATTCTAGTTTTTCTTTCGTGGTTGAAAGATACTTATTAGATTCATAT
AATACTTAAGCAATATAATGCTAAATAAAGATGGAAGGTGTGCTCCTTTTTTCTTTTATG
CTTTTTTGTTTCAAGTCCATCTGTGATATAGTTTGAATAAATATGAGGTTTTATTTTAAA
CTGAATATTTTTGCTTTTGCTTTTTTTGTAGCTAATATTTTAGGAGTTTTTTTTAATGTT
ATTATTTTTTTTTTACCTCGTCCTCAGCAGATGAAATTATTGTGTATGTTATCTTAATTT
TTAAACAATATTAAAAAGTTTTGAACTTTTTTTTTCTCTTTTTTTGGATATAAGGTCTTG
TTCTGTTGGCCAGGCTAGAGTGCAGTGGCATCACCATAGCTCACTGTAGTCTCAAACTCC
TGGACCACACTGATCCTCATCCTCAGCCTCTGGAGTAGCTAGTACTACAGGCTCACGCCA
CCATGCCTGGCTGATATTTGTATTTCCCCCCTCAACACCCTCCCACCACCACCCGTAGAA
ATAGAGTCTTGCTATGTTGCTCAGGCTGATCTGGAACTCTTGTCCTCAAGTCTTCCTCCA
GCTTCAGCCTCCAAAAGTGCTAGGATTATAGGCATGAGCCACCATTCCTTGCCAGTTTTG
AACTTTTGATATATAATGCTACCTTAGGCTTTCTGGAGCACTTACAGTCTCTGTCACATA
TTCTGTTTTTATAACTCTTGAAAAGCATAAATAGGATTCTCAGGATACAAACTGTATAGC
AACAGGCTGTGGGCTATATTTTGCCCATGGGCCATAGTTGACTGACTCCTGGTTGTACAT
AGAACGAAATGCTATGCAGTGTTAAAAAAGCCGCAGAACCTCTTTGTGTACAGATATGGA
ATGTTATTCCCAGATAATATGAAGAAGAAAAGTAATGTATTATGAGCTTCCATTTATATA
AGAGGAAGGAGAAGGGGATCTGTCTCTTTATCTGTATGTACATACTTGAATAAAACATTT
CCAGGGGGCTCTATAATAATAACTGGTGACAGTGGTTATTTCATGGTTAGGAACTGGGTA
GCTGAGGAAAAGGGATAGGAAAGAAGTTATTCACTGTATGACCTTTTCTACTTTTTTGGT
CTTGAATCTCTTATTTTTTTTAAACAAATAAAGTATACATCAGTTGAGAAATCAGCCTTA
CTCTGTTTTTATTAAAGAACTGAAATTGACTAACACCTATCTCATATTTTCACTTCTCAT
CAGAATTTCCAAATAAAGTAGAAAAGCTGTAGAAATTTCTTTTTTTAGGACTGCATTTCC
CAAAGTGTGCCCATAAAGCATTACTATCTTAAGATATTAAAGAAATTTCATGAGAAAATA
ATTTTGTGGTCAAAGTTTAAGAAATGTTGAGTTCTTTTGCTATATTTAGAAATTGCCTGA
TCCTTTATAATGCTAGCATGGATTTTGAATTTCTAAGAGGGGATTAAAATAGGCACTGTG
ACAATGATTTTTAAGCTCCTTGCACGATGGTACCTTTTTTTCCTTAAGAAACCCAAGAAA
ACACTTAATTAAAGAAACTTTATGATGAAATAGATTGAAAATAATTTACAATTTTTCAGG
CTTGATTCTCACTTTGAAGATTATATGTTTATTTTCTAACTTTATATGAATTATTTTTTT
TTCACATTCTGGGTTAGTTTTAAGTAGTCATTTTAAATTCTTAGACAATTTCCAAATCAT
TACCATAATCTGATGTTGTTTTTTTTTTTTCTATAGCCAGCTGTTGCACTGCCGACAAGC
CTTAGCCTGTCCCACTCCTCAGCCTACAGCACAGATAACTGTATCATATCCAACACCAAG
GTCCAGTCAGCAACAAACCCAGCCTCAGAAGCAGCGTGTTTTCACAGGGGTCGTTACAAA
GCTACATGATACATTTGGATTTGTGGATGAAGATGTGTTCTTTCAGCTTAGGTAAACTTT
ATTCTGTTTTGTCAGATGGCTTCTTGCATTTAGCACAAACCACCTGCTTAATCATGACAA
AGATTTGAATTTAGCTTTAATTTTCTTTATTTTTTTGTAAGACCCATAAAGGCATAAATA
ATTTACTGTTTTTATCATTTAGTTTATATTATATTTGTACTTGTGACCTATTTTGATGGA
GAATATAATTAAATATATCTTATTATTGAACAAACTAGTTTAAGGAAAATTCTTTTCTTT
TTCTTTTTTTTTTTTTTTGAGACAAAATCTCAATCTGTTGTCAAGGATAGAGTGCTGTGG
CATCAGCCTAGCTCACAGCAACCTCAAACTCCTGGGCTCAAGCAATCCTCTTGCCTCAGC
CTCCCAAGTAGCTGGGAGTACAGGCATGTGCCAACATGCCCGGCTAATTTTTTCTCTATA
TATTTTTAGTTGGCCAATTAATTACTTTCTATTTATAGTAGAGACAGGGTCTCGCTCTTG
CTTAGGCTGATTTTGAACTCCTGACTTTGAGCGATCCGCCTGCCTCAGCCTCCCAGAGTG
CTAGGATTATAGACTTGAGCCACCGCGCCTGGCCCTTAGAAAATTCTTTATAAATATTTT
ATAGGTGTTACGTGGCATTTCTCACAATATTCTTGGGCAGACTTGTAGTGAGGTTGGAAG
TTTAAGTAGTCATGTGTTTTTTCACTTCAAACTTTGTGTTTGTATGCAGAAAGTGAAACA
TGATCATTTCTGAAGTGAGTCTAGGAGATATATCTACTTCTAAAAAGAGATTGCCAGACT
TCCATTTTAGATATAGTTTAATATTTTATTCTATTTATTTATTTATTTATTTTGAGACAG
TGTCACTTTGTTGCCCAGGCTAGAGTGAGTGCTGTGGCGCCAGCCTAGCTCACAGCAACC
TCAAACTCCTGGGTTCAAGCAATCCTCCTGCCTCAGCCTCCCGAATAGCTGGGACTACAG
GCATGTGCCACCATGCCCAGCTAATTTTTTTTCTATATATATTAGTTGGCCAATTAATTT
TCTTCCTATTTATAGTAGAGATGGGGTCTTACTCTTGCTCAGGCTGGTTTCGAACTCCTG
ACCTCGAGCAATCTGCCCGCCTCTGCCTCCCAGAGTGCTAGGATTACAGGCTGAGCCACT
GCGCCTGGCCAATATTTTATTTTATTTTTGAGATGGGATCTTGCCATATTGCCCAGGCAG
GTCTCAAACTCCTGGGCTCAAGCCATTCTTCTACCTCAGCTTTTCAAGTAGCTGGAGTTA
CAGGTGTGCACCACCACACCTGTCTAGATATAATTTGCTGTGAAATACTAAGTATGTGCT
TATTGAGAGAATGACTTTAACTATTTTTTCTTTTCCTGTTTTTTTTTTTTTTTTGCAGTG
CTGTCAAAGGGAAAACCCCCCAAGTGGGTGACAGAGTATTGGTTGAAGCTACTTATAATC
CTAATATGCCTTTTAATGGAATGCACAAGAATTCAAACACTACCAATCAGGTACGTAAAT
ACTGAGTTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATATCTGA
GTTACGGTATATAAGAACCTTGTAACTGGAATCTTATGATACACCAAGAAGTTTTAGTCT
CGTTATTAAAATTTTTATCTCTTCAATTATTAGTCAGGAATACGGTCCCAACCCCAACCT
TTATTGAAGGCTTCACTCCTCCTGCTGTACTTCAGCCAATTGCACCACAGACAACATTTG
GTGTTCAGGCTCAGCCCCAGCCCCAGTCTCTGCTGCAGGCACAGATTTCAGCAGCTTCTA
TTACACCACTGTTGCAGACTCAGCCACAGCCCTTATTACAGCAACCACAGCAGAAAGGTA
TCTTTGCTTCTTTTTCAGACTAATATGTAATTCTTTAGTTGTTAAAATAACAACAATATG
CTTTTAATGACAAAAACGGCCAGGACTTCCAGAAAACAACTTGAAACTTTAAAATCCTTA
ATAGAACAACTCTATTTCTGCATCTATATGGAAGTATTTTTATTTTATTGCCCTTAAAAA
ATAAACTCAATGATGTCTTCTATGTTGACCTAAAACAAATGTCAAATCTATTAATCCCCT
GTCCCATTTTTGGTATATATATATATATATTTTTTGAGACAGAGTCTCACTCTGTTGCCC
TGGCTAGAGTGCCATGGCGTCAGCCTAGCTCACAGCAACTTCAAACTCCTGGGCTCAAGC
GATCCTGCCTCAGCCTCCTGAGTAGCTGGTACTACAGGCATGTGCCACGATGCCCAGCTA
ATTTTTTCTATATATTTTTAGTTGGCCAATAATTTCTTTCTATTTTTAGTAGAGACGGGG
TCTCGCTCTTGCTCAGGCTGGTCTTGAACTCCTTAGCTCAAACGGGGATCCGTCCACCTT
GGCTTCCCAGAGTGCTAGGATTACAGGCATGAGCCACCGTGCCTGATCTTTTATTATTAT
TAATATTATTTTTTTTTTTTTTTTTTTTTTTTTTTTTGAAGAGACAGGGCTTTGCTTTGT
CATCGAGGCTGAAATGTACTTACTGGCTCAATCATACCTTACTACAGCCTTGAACTCTTG
GGCTAAAGGGATCCTCCTGACTTAGCCTCCCAAGTAGCTGGGACTACAGGTGTGTACCAC
CATGCTGGGCTAATTTTTGTTTACTTTTTCCAGAGATAGAATCTTACTGTGTTGCCTAGG
CTGGTCTTAAAATCCTGGCCAAAGGCCATTCTCCTGGGTTGCTGAGATTACAGGCATGAG
CCACTGCAGTCAGCTCTTTTTCGTGTCTTGTCTGTAATAAAAGAATATGTTTTTGAGACT
TATTTCTTATAAACATACCAAAAACATTTTATATACATGTAGAGTCTGCTGCTTTATTTA
CTGAACCATAGTGGATCTGATGAATGAGTTGAGCTTTAAATTTTTCTTTGCAAAATGTTT
TATTTTGATATGCTGGACATGTTTAAACGGTGTTTAAAATGATAGCCTTAGATTATAGAC
GTCTACTCAATTGGCATTTAAAGAATGTAATTATGGGCTGGTTGCGATTGCTTCCATCTG
TAATCCTAGCACTCTGGGAGGGCTCGCTCAAAGTCAGGAGTTCAAGACCAGCCTGAGCAA
GAGCGAGACCTCCTTCTCTACTAAAAATAGAGAGAAATTAATTGGCAAACTAAAAATACA
TATATAAAGTTTTTCATAACTTTATTCCATGTGGCTTTAGTTTTTTAATTTTCATTGTCG
CATAGTATTCTGTTGTATGAATACAGTTGTTTCTGTTTTTGTAAACATTTGGATTGTTTC
TAGTTTTGGATTTCTGAAAATTCTGGTGTGTATGTTCTCATATGTGTTTACAGGGTCAAT
GTGAATGACTTTCTGAAAGGTATATATCTTGAATGGAATTGCTGGGTGTGAGGATTATGT
GTATCATAAACTTATTAGGTAATACCAAATTGTTTTTAAGTTTCTTGTTTCTTCCAGGTA
TCAGGGCCTTTCATAGTGTAATTTTTGATTTTTTTCTTTCTCGTGTTCTTCCTAGAGATC
TATTTTCCAGTTGTGAATTGGGACTTAAATACCTTTTTCCCCCAGCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNGGTATGCATCTCCTTCCTTAAAAACAATCCGCCTGCCTCGAT
CCAAACCAAGAGCTAAGATTTCAGGAAGTGACCGACAGCGCCCTACTTTTATATTTTTTT
TTGAAGCCAGAGTCTTCTCTTTGTTGCCGAGGCTAGAGTGAGTGCCGTGGCGTCAGCCTA
GCTCACAGCAACCTCAAACTCCTGGGCTCAAGCGATCCTTCTGCCTCAGCCTCCCGAGTA
GCTGGGACTACAGGCATGTGCCACCATGCCCGGCTAATTTTTTCTATATATATTAGTTGG
CCAATTAATTTCTTTCTATTTATAGTAGAGATGAGGTCTCGCTCTTGCTCAGGCTGGTTT
CGAACTCCTGACCTTGAGCAATCCGCCCGTCTCGGCCTCCCAGAGAGCTAGGATTACAGG
CGTGAGCCACCGCGCCCGGCCTTGAATTAATTTTTTAGGAAACATAGTAGTTGAGAAATA
TTTTTCCTGCTAAAAGTCCAGAGGAGTAATTCAGATGAGTACCTTACTAGGTTTCATACT
GGGAATTAATATCATTATCATAGACTGATGTTAAAAAAGTATTATCTAGGAGAGATATGG
TGAATCTCTTTTATGTTATCAGTAAAGAAATATAAAGTTATTTATTCTGTATTCTTGTGT
TTCTTATTTTCTATGATATTGTTTTATCTATTTCAGAGATTTTTAATTTTTTTTTTTTTT
TTTTTTTTTTGAGGCAGAGTCTCACTTTGTTGCCCAGGCTAGAGTGAGTGCCTTGGCATC
AGCCTAGCTTACAGCAACCTCAAACTCCTAGGCTCAAGCATTCCTGCTGCCTCAGCCTCC
CGAGTAGCTGGGACTACAGGCATGCGCCACCATGCCCGGCTAATNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTTTTAATTTAAAAATTTTATTTGTTTTCACTTTTTT
GGAGACAGAATCTTGCTTTGTTGCCCAGGCTAGAGTTCAGTAGCATAATCATAACTCATT
GCAGCCTTGAAATCTTGGGCTCAGGAGACCTCTGCTTTAGCTTCCTAAGTAGATGGGACT
TACAGGCACGTACTACCACCCCCAGCTAGTTATTTAATGTTTTTTGTTCTTTTTTAGAGA
TGGGGTCTCACTTGTTGCTCAGGCTGATCTGAACTCTTGGCCTCAAGCTATTCTGCCTTG
GCGTCCCAAAGTCCTGGGGTTAAAGGCATGAGCTACCATTACCAGCCTAGTTAATCTTTT
TAAAATACTTCTATCTGTCAGTAATTATTTTCAGTTTGAATTGTACTTAGGCAGATAGAT
ATGTTATATTGATTATATCCTATATGGAAATAAAGTAAATATTTATGTTACTTCAAAACA
AAATTTTTGATTTTCAGTAATAGGAAGAATTCATTAGACAGTACCTATTCTTTTAAAAAT
TTATAAATTGTGCTAACATTGCGTAAATAATTTTAGTCACTCCCAATTATTTGTCTGTGT
TCATCTAATTAACTATGCTTTTGAACTTTGTTTAAACAAGTGAAATTTTTTTTCTTTGTC
TTTTAAAGCTGGTTTATTGCAGCCCCCTGTTCGTATAGTTTCACAGCCACAACCTGCACG
AAGGTTAGATCCACCATCCAGATTTTCAGGAAGGAATGACAGAGGAGATCAAGTGCCTAA
CAGAAAAGATGACCGAAGGTGTGTTTTTAAAAAGTATACTTTGGATGGTGATGATGACTG
CACCAGTAATGTGAGTGCACTTAATGCCACTGAAATAAATATACACTTCAAAGAGGGTGA
AATGGTAAATTTTATGTGATGTATATTTTACCAAAAGTTTTTAAAAGTTAAATATATAGT
GGAATCTTGCTTATATTACCTATTATATTTCACTAAATAGCTGTTNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACTCTTTTTT
TTTCAGCATTTTGCTGTGTCAGATTATATTTAGCTTCAGAATTGAGTGAATGTTTGCGGT
AGCCTTTGATATAAGACTATGTATTCACTACTTATGTCTGTTTTTCAGTCCCAGTTGTGA
CATGATGGAGCTAAGGCGCCGTTATCAGAATTTGTATATACCTAGTGACTTTTTTGATGC
TCAATTTACATGGGTGGATGCTTTCCCTTTGTCAAGACCATTTCAGCTGGGAAATTACTG
CAATTTTTATGTAATGCACAGAGAAGTAGAGTCCTTAGAAAAAAATATGGCCATTCTTGA
TCCACCAGATGCTGACCACTTATACAGTGCAAAGGTTTGTATTCCACTGTGATATATAGT
TTAAATTTCTTAGAGCAGTTTTTTATAATAAGAGGGTATGTGGAGTTAATCTTTACAAAG
TGGTTATTTAATAGAAGACCTAAATAACCTGGTTTTTTTATGACTGCCTAATTCTGTTTT
GTTTATATAAGTAATTAACTGTCCTTGCCTCACCTCTTAAGCTATGAAATTATGGTTTTT
ACAACATTTTAAACTTCATAAAAATGTGAAGATATAGTTGATGTTACTGAGCTTTTTGGA
ATGTTGTATGACTTTGGATAGCCCCAGGGATGAATGCATTAAATTTTAGTCTTTAGGGTA
ATAGTCACTGTATTGCATATAGTCAACAGATGTTTCAGATGTCTTTTGATCAACAAAATG
TCCCTTGAAATTTTAAAACTAAGTAATTATAAGGTATTTAATATCATTTCTGCTATAGCA
TTTTACTTTCCATTATTATAAAAAATTTCAGGTATATAATATGTAAAGATAATTAGTAGT
GCTTCTCATTTTTTTACATTACTTTAGACTTTTGACAGGATTGAATTATTTGACTATAAT
AGGTAATGCTGATGGCTAGCCCTAGTATGGAAGATTTGTATCATAAGTCGTGTGCTCTTG
CTGAAGACCCACAAGAACTTCGAGATGGATTTCAACATCCTGCTAGACTTGTTAAGGTAA
AATGACACATTTATTTTAACTTTAGGTATATATTACTTTACTTAGTTCTAACTGTATATA
CATAAAACTTAAAATGCATTTTCATTTTGTTAATTAGTTTAATAACGAATTTCACTATTG
TTAAGGCACCTAGAATTTAATGATGTAGATGTTTTTGTTATAGATTGTATCTTATTGAAT
TGACATTGTGATATTTTATATTTGTATCATAGTAAAATCTTAGTGGTAATGGACTTCAGA
GTGTCTTTGGATGCTGTTAAAGTTTAAATTATAGCTTGTTTCTTTAAAAGAACTCTATCT
GAAGAAATATTTTAGAAGGATGAGTTATGATGTGTAAATCCTATTCCATTGCTGAAATGC
AGTGTGGAACACGATGAACTGAACTCTTCCTTGACTGACAGATACCAGAGGTAGTAAAAA
TGATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCCTA
AGCCTTTTTATAGCCTCTACTGAACATTTTAAGCCCACTATTGAGACCTACTACTGAAAC
AAAAGGATTCCTTTCAATATATTACTGCTCATTGACAATGCACCTAGTCCCTCAAGAGCA
CTGATGGAGATATGCTAGGAGATTAATGTTTTCATGCCTACACAACATCCATTCTGCAGC
CCATGGATCAAGAAGTCATTTTGACTTTCTAGTCTTTTTATTTGAGAAAGACATTTTGTA
AGACTATCTCCTATAGATAGTGATTCTTCTGATGGATCTGGGAAAAGTCCATTGAAAACC
TGGAAAGAATTCACCATTCTAGATGCCATTAGGAACATTCTGTCTTTGTGTTATTCTGTC
TAGAAATTCCTTTCTTACAAGGACATCAGTCATTGTATTAGAGCCTACACTTCGGACTTC
ATTTTAACTTAATTACCTCTGAATAGAACTTATTTCCAAGTATGGTCACATTCTAAGATA
CTAGGGGTTAGGTCTTCAACATATGAATTTAGGGGATACAGTTCAACCCATAACTGATGA
AATCTTTTTATATTAGCACTTTTTTTTCTTTTTTGAGACAGGGTCAACTGTTGCCCATGC
TGGAATACAGTGGCTTCATCATAGCTTACTGCAACCTCAAACTCCTGGGCTCCAGTGATC
CTCCTGCCTCAGCCTTCCGAGATCTAGTACTACAGACATGTGCCACCATGCCCAGCTAAT
TTTTCTATTTTTTATAGAAATGGGGTCTCTCTCTTGCCTATGCTGGTCTTAAACTCCTGG
CCTCATGATCCTCTTGGATCTGCCTCCTCAAGTGGTCAGATTACAGTAGTGATTGTGGTT
GTATAGGAAGTTTATTTTTTGCCAGCTATTTTTTGTGTCTTTTGCATTTTGTACAAAAAT
CATTATAGTCCAACATATATATTAACAACAGAGGCCAGGCTTGGTTGTTTATGACTGTAA
TTCCAGCACACTGTGAGGCCAAGGAGGGAGGATCGCATGAGTTCAGGAGTTTGAGTTGAG
TCCAGCCAGATGCCATCTTTACTAAAAATTTTTAAAAATTAGCTGGGTGTAGGCTGAGTA
CAGTGGCTCATGCCTGTAATCCTAGCACTCTGGGAGGCTGAGGCAGGTGGATGGCTCAGG
GTCAGGAGTTCGAAACCAGCCTGAGCAAGAGCGACACCCCGTCTCTACTAAATTAGAAAG
AAATCAATTGGCTGACTAAAAATATATAGAAAATTTAGCCAGGCATGGTGGCATATGCCT
GTGTCCCAGCTACTTCGGAGGCTGAGGCAGGAGGATCACTTGAGCTCTGGAATTGAAGTT
GCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGCAGTATTCAGAAAGATCAACTCTCTGCTACTGCACTGTTTCTCAGAATCCTCT
AATTTATATAATCTCAATATAGGTAATTCCCTCCTGCCCCTTTAGAAGGTAGTTTTTTAT
GCTGAGAAATCCAAAAGAAAATTAGGAGCCATAAAAGCTACTATCCTTAGTAAATTTAAA
CTTCTCTCCCTTCTCAACCCTAAGTCTAGTATAATCATTATCAGAACTTTGTTCTTTTTC
TTTATATGGTATAATATCGTATGTGGAAGCTTAACCATGGCTTAACATTTCGAATACTTA
GGAAGAAGAAAGGAAACGTCAAGAGGAAATGGAGCGCCAGCGTCGGGAAAGACGGTATAT
TTTGCCTGACGAACCAGCCATCATTGTACATCCAAATTGGGCTGCAAAAAGTGGCAAATT
TGATTGTAGCATCATGTCTTTGAGTGTCCTTTTGGACTACAGATTAGAGGATAATAAAGA
ACATTCATTTGAGGTAATGTTTTTAATTTGAAATAGCAACCAGCTACACATTGTGGCTAT
TTAATAAGTTTCTGAAGTCTCTTTGAGTGCCTCTTTAATTGCTTCTGTTTTTTTCTGTTT
TTGTTGTTTTTTCTTTTAATTTACTTTTTGGAGGACAAATACAAAATGATCTCTCTTCAA
AAGTACTTCTAGACTCATTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NCATGCCCAGCTGATTTTTTCTATGTATATTAGTTGGCCAATTAATTTCTTTCTATTTAT
AGTAGAGACAGGGTTTTGCTCTTGCTCAGGCTAGTTTTGAACTCCTGACCTCGAGCAATC
CGCCTGCCTAGGCCTCCCAGAGTGCTAGGATTACAGGCATGAGCCACTGTGCCCAGCCTT
AATTCTTATAACTGTATTATAAGTGTACATAATTTTTAGATGTGGCCAGGTTTTATTTAA
TAAATTACTAACTGTGCTGGATTTATTTAGTATTTCTGTTGAAGTTGGTTGAGTTAATAT
TAGTGTCTTTTTATAGGTTTCATTGTTTGCAGAACTGTTTAATGAAATGCTTCAAAGAGA
TTTTGGTGTCAGAATATACAAATCATTACTATCGCTTCCTGAGAAAGAGGACAAAAAAGA
AAAGGATAAGAAAAGCAAAAAGGATGACAGAAAAGATAAGAAAGAAGAAAGAGATGATGA
AAATGATGATCCAAAACCCAAACGGAGAAAATCAGGAGATGATAAAGATAAAAAAGAAGA
TAGAGATGAACGGAAGGTCTCTAATTATTTCTATGGCTATTAACCTGATTTAGATGTTTT
CGATGAATCTTCTAGATTGTAACAGAATATTAATTTCCATGAGAATTCAGTAAAATGTAA
TGGACAAACAAAGATTTTAGTTTATTATTCGAAATATAAATCATCGAATTAAGCCCATAT
AAACATCTGTAGCTAGTTTTCTAATCATTTATTTTTGAAATATGTTATTATGATTATTAA
AAGGTTAAAATGTGAAACTAACTTGAATGGATTTGATGTTTTCTAGTTAGTCACTTGATG
TTTGATGTTTAGTCAATTGTTACTTTCTTGCTTAATTTTAAGGCATTTTAAATTACAGAA
AGAAGATAAAAGAAAAGATGATTCTAAAGATGATGATGAAACTGAAGAAGATAATAATCA
AGATGAATATGATCCAATGGAAGCAGAAGAAGCCGAGGATGAAGAAGATGGTATAATTCA
AATTTATTTATTACTCCTTAGGATTAAAAATAACATTTTGTTTGGTGACTTTGTGTCCCT
GAAATCTATAATTATTAACTAATTGTACTTTCATTAGTTTTTAGGGGAAAAGATTGTTTT
AAGGCAAATTGATTATCATATGTCCCATGTATAAATTTTTCTTGATATCAGGTCTTGCTC
TGTCTCCCAGGCTAGGGTGCAGTGGCCTCATCATAGCTCACTGCAACCCCAAACTCCTTG
GCTAAAGTGATCCTCCTGCCTCAATCTCCCTAGTAGCTGGCACTATAGGTGTGTACACCA
TACCCAGCTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATATTTTG
TTTTATCCTGTTGGATAAATCAATTCCTGTTGGAATTTATTGTGCTTCAAAGATAACTGT
GTTTTTTACCAATTGAAGGCTTGTGGCAACTCAGCATCAAGTCTGTCAGTGCCATTTTTC
CAACTATATATGCCTACTTCGTGTCTCTGTGTCATGTTTTGGTAATTGTAATATTTCCAA
CTTTCTCTGTATTATTGTATCCGTTTTAGTGATCTGAGGTCAATGCCATGGCTGGGGGTG
GTGGCTCATGCCTCTAATCCCAGCACTTTGGGAGGCTAAGGCAGAAGGATCACTTGAGGC
CAGGAGTTTAAGACCAGCCTGGGCAACATGGCAAAACCCTGTCTCTAATGATCTGTGTTC
AGTGATCTTAGATATTACTATTATAATTGTTTTAAGGCAACCTAAACCATGCCCACAGAA
GATGGCAAACTTAATGAATGTTGTTGGTGTTCTGATTGCTTCACTAGCCAGCTCTTTATC
TGGTCTCTCCCCCCGTCCTTGGGCCTACCTATGCCTTGAGAGAAAACAATGTTGAAATTA
GGCCAGTTAATAACCCTACAATAGCCTATAAGTGTTCAAGTGTAAAAAGAGGCACATCTC
TCACTTTAAATTAAAAGGTAGAAATGATTAAGGTTAGTGAAGAAGGAATGTCAAAGCTGA
GATAGGCCAGAAGCTAAACCGATTGTGACAGCTTCCCTAGGTCCTTTGATGGCAAGTTGT
GAATTCAAGTAAAAGTTCTTAAAGGAAATTAAAAGTGCTACTCCAGTGAACGCAAATGGT
ATGAAAGCAAAACAGCCTTATTGCTAATATGGAGAAACTTTAAGCAGTCTGGATAGAAGA
ACAAACCAGCAACAACATTCCCTTAATCCAAAGACTAGTCCAAAGCAAGTTCCTAACTTT
CTTTGATTGTCTGAAGACAAGAGAGGTGAGGAAGCTGCAAAAGAAAAGTTTGAAGGTAGC
AGAGGTGGGTTCATAAGGTTTAAGGCAAGAAGCTATTTCTATAACATAAAAATGCAAGAT
GAGGCAGCAAATGCTGATATAGAAGCTTCCGCATATTATCCAGAAGATCTAGCTAAGATG
ATTGAAGATAAATAATAGACTTCATCAGCAATTGAAACAGCCTTCTATTGGAAGAAGAGG
CCATCTAGGACTTTTATAGCTAGAGAGAAGTCAATGAATGCCTGGCTTCAAAGGACAAGC
TGGCTTTCTTAATTAGGGGCTAATGCAGCTGGTGACTTAAGTTGAAGCCAGTGCTCATTG
ACCGTTCTGAAAATTCTAGGGCCTTTATGAATTATGCTAAAGAATTATGCCTGCGTAGGC
CGGGATTGGTGGCTCACGTCTGTAATCCTAGCCCTCTGGGAGGCCGAGGCGGGCGGATTG
CTCCAGGTCAGGAGTTTGAAACCAGCCTGAGCAAGAGCAAGACCCTGTCTCTACTAAAAA
GAGAAAGAAATTAATTGGCCAACTAATATATATAGAAAAAATTAGCCGGGCATGGTGGCG
CATGCCTGTAGGTCCAGCTACTTGGGAGGCTGAGGCAGGAGGATTGCTTGAGCCCAGGAG
TTTGAGGTTGTTGTGAGCTAGGCTGATGCCACGGCACTCACTCTAGCCTGGGCAACAAAA
TGAGATTCTGTCTCAAAAAAAAAAAGAATTATGCCTGGGCTTTATAAATGGAGTAGCAAA
GCCTGGATGACAGCACATCTTTTTATAGCCTAAGCCTTTTTATAGCCTCTACTGAACATT
TTAAGCCCACTATGAGACCTACTACTGAAACAAAANNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCCAATGTCTGAATGTCCTTGTAGGAAAGAGAATTTCTGGATC
CCATAACCCAGAGACCTGAGGTTTCTAAGAGCAAGTCGAACGGCCAAGTCCCTTTAGGGT
AGACAAAAGAGTGTTCCCCAGATCCCATAAGGAAAAATCCCAAATATATAGGAGATCGTT
GAGATATTCTTATTTCTCAAAAAGAACAGCTTAGATAGTCAAATTGAGTTGCTTTAAAAT
AATCTATCTGAAAATAGCTGTAGTATGCTGGAAACTTTCTTCTCGGCGCTTAGAAACATC
AGCGTTCCCGAGGGTCGTGGGATTTAAATTTGTGAGCATAGTTTTCATTGAAAGGTATAC
AATTCATTCTGTAAAAAGGTTCAAGTATGTATGGAAATAAGTTCTTTGAGGCGATTCAAT
AAAATCAGTTTTTTTCATCTTCATAATCTCTTCTTGAATTTTTTCCTTATTTATAAATGT
TTTGGTATATTTTTTTTTTTTTTTGAGACAGAGTCTCACTTTGTTGCCCAGGCTAGAGTG
AGTGCCGTGGCGTCAGCCTAGCTCACAGCAACCTCAAACTCCTGGGCTCAAGTGATCCTT
CTGCCTCAGCCTCCCGGGTAGCTGGGACTACAGGCATGCGCCACCATGCCCGGCTAATTT
TTTATATATATATCAGTTGGCCAAATAATTTCTTTGTATTTATAGTAGAGACGGGGTCTC
ACTCTTGCTCAGGCTGGTTTTGAACTCCTGACCTTGAGCAATCCGCCCGCCTCAGCCTCC
CAATATAATTGTTTTTTATGATCCAAAGTATTTTTATTCATATAATTCTTTGCAATTTTG
TCACTTGAAAACTGTTCTGTAATGGAATAGTAGTTCTGGTTTCTATAGTAGTTAAAAATA
TATAGCGTTTTTTTGTTTTTTAAGAGATGAAGTATTAATATGTTGTCCAGATTGGAGTGC
AGTGGCTATTTACAGGCACGGTCATAGCACACTGCAGCCTCAAACTCCTGTCTTCAGGCA
ATTCTTCTGCCTCAGTCTCCTGAGGGATTACAGGTGTGTGTTTCTGTGCCTAACTTGAAA
ATACCTGTATTTATAAGTGTTTTGCTGCTGTTGTATTTATTTTACAGATAGGGATGAGGA
AGAAATGAACAAGCGAGACGATAAAAGAGATATCAACAGGTACTGCAAGGAGAGGCCCTC
TAAAGATAAGGTATTTACCTGAATGCTGTATTCTTGATAATATGATGATTCCTATATCTT
ATATATTCTAAACTTATTGAAAATAACAGTCATGAAGTTTAGTAATACTTTGTATGTCTA
TATATTACCATTATGTAAAATTCATTCAGTTGTTTTTTGGTATTTGTGGCTCTTAGGCAA
CCAGTATATCTGATTCTTTTCTCCCATATTAATATACAAAATGAACTCATTTTAGCTAGG
ATGGGCAAAAGTCTTTTCAGATTATTGCTATTATATGGAAACAGTCACACTTTCTCACTT
TTCAGGGATGAAAAAAGAATTGTATAGTATGTCTTCTACTTCTGCATTTTCTTTAGGAAA
AAGAGAAGACTCAGATGATCACAATTAACAGGGATCTGTTAATGGCTTTTGTTTATTTTG
ATCAAAGTCATTGTGGTTACCTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGACTCAGATGATCACATTACAGGGATCTGTTAATGCTTTGTTTATTTTGA
TCAAAGTCATTGTGGTTACCTTCTTGAAAAGGATTTGGAAGAAATACTTTATACTCTTGG
ACTACATCTTTCTCGGGCTCAGGTAATTTATCTTGTGAATATTTAATATAAAATCATTTT
TTAGTGACTCTTTAAAAAGTTACCTTTTCAAAAAAAAGATAACAGATTAATATATTTAAT
TCTATAGATTGGTGCTTATCTTTCCTTTAAATCTCTACTGACTTTTTAATGTATAAAAGA
AATACAGCACATGCTGATTTTTTTTTTTTTTTTTGAGACAGAGTCTTGCTTTGTTGCCCA
GGTTAGAGTGAGTGCCATGGCGTCAGCCTAGCTCACAGCAACCTCAAACTCCTGGGCTCA
AGCAATCCTCCTGCCTCAGCCTCCCGAGTAGCTGGGACTACAGGCATGCACCACCATGCC
TGGCTAATTTTTTCTATATATATTAGTTGGCCAATTAATTTCATTCTATTTATAGTAGAG
ACAGGGTCTCGCTCTTGCTCAGGCTGGTTTCGAACTCCTGACCTCGAGCAATCCGCCCGC
CTCGGCCTCCCAGAGTGCTAGGATTACAGGCGTGAGCCACCGCGCCTGGCCAGCACATGC
TGATTTTAAAACAGCCAAGCAATATTGAAATGTATACAGTCCCTTCTCCCTGTTCTTCTA
GTTCTATTCCTTGGAGCTAATACATAACCTTCTAGTTTTCAGCTACATATGATAGTTCCA
TTTTCATAAACAAGACATGAAATCATTCTGGACATGTTGATTGGCACCTTTTTCATTCAG
CAATATATTACAGTCTTTCTACCATGAAAATAAAGATCTACCTCATTCTTTTTATAGCTG
CATAGTATCTCATTATATAGATGTATCATAATTTACTTAACTCTAGTCCCTATTGCTGAT
AGTTTCCATTTCTTAGAATTACAAGCTAAGATGTAATAAACATCTTTTTTTACATATATT
TTAATGTATGTGTTAGAATTTCCATCGATGTTATTCTTTGTCTTTTTAATGAATTTTTTT
TTCAAATAATAACTTGGAACTTAGATTTATAGGGAAGACACTTAAAAAGTATAACTGCTT
TAATTGAATGGGAGTGGATACTTGAGAAAACAGTTTTCATGGATGTTCATTATAGGTGAA
AATTAGAACAATTATTCTAGGACAATCAAATAATGTATTTTCATCTTTTTAATTTGTTTA
CTTACTTGCTTATAAGGTAAAGAAACTTCTTAATAAAGTAGTGCTCCGTGAATCTTGCTT
TTACCGGAAATTAACAGACACCTCAAAAGATGAAGAAAACCATGAAGAGTCTGAATCATT
GTTGGAAGATATGCTAGGTTTGTGTGCATTATTTTAAGATCTTGCTTTTTTATAAGCATA
TTAATTAGGCTATTAAGATAAATAGCTTACTAAAATATGGAATCTTTTATACTATGTTCT
AGGAAACAGGTTATTACTTCCTACACCAACAGTAAAACAGGAATCAAAGGATGTAGAAGA
AAATGTTGGCCTCATTGTGTATAATGGTGCAATGGTAGATGTAGGAAGCCTCTTGCAAAA
ATTGGAAAAAAGTGAAAAAGTAAGAGCTGAAGTAGAACAGAAGCTGCAGTTACTAGAAGA
AAAAACAGGTAACGGATGGCATTGACTGTGTTAATACTTTCAGCACCCTGCTGGGGTATA
CGAATACATACACATGACATACCTACATGCCCATGCATATACATAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1073, 6627..6799, 7327..7371, 10059..10091, 11916..11951, 11953..12110, 13498..13573, 13576..13584, 13587..13604, 13607..13609, 13839..13868, 13874..14036, 20228..20357, 22076..22237, 23868..24093, 24662..24775, 57398..57564, 57665..57875, 57976..58059, 58160..58345, 58741..58932, 61996..62235, 62578..62689, 68147..68229, 69959..69985, 69990..70004, 70006..70101, 71236..71356, 71462..71646
1001..1073, 6627..6799, 7327..7371, 10059..10091, 11916..11951, 11953..12110, 13498..13573, 13576..13584, 13587..13604, 13607..13609, 13839..13868, 13874..14036, 20228..20357, 22076..22237, 23868..24093, 24662..24775, 57398..57564, 57665..57875, 57976..58059, 58160..58345, 58741..58932, 61996..62235, 62578..62689, 68147..68229, 69959..69985, 69990..70004, 70006..70101, 71236..71356, 71462..71646
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved