Microcebus_murinus Locus SLC25A3
snOPY snoRNA Orthological Gene Database
Microcebus_murinus SLC25A3
Microcebus_murinus
SLC25A3
GeneScaffold_4672
SNORA53
5394..5634
8090
CCTTTTAAAATATTCTCCTGAAGCCTGATGAAAAATGCAGACATGCCTATGTTTAATGT
CAATGGATGACACTTTTACAAAGTACTGCAATGGCAAAAGTTGTGACATAGTATTCTGCA
GTGACGTTCTAACCGCAACACCGAATTGTATCATCAAACATTCGTGTTTTGTTTTGTTTT
TTAAGTGTCTACTATGGGGTGCGGCTCACCCTCCTCACTGAAGTGGGGAGAACTGAAGCC
CGAGTCAAGGAGAGACACACCTGAGGGTGAAGGGACAAAAAAAGTTGGCCACCAGCCTGA
CACCAACTCAATAGCCCGGCCCAGAATGCGCGCCTGCGAAAAAAAAATCCCTTGTGGAAA
AAAAGCCGGGCGGGAGGGCGGAACCGACCGGGGGGGGAAAAATCCGTTTGCAAGGAGACC
GGAAGGCCGTGCCCCCCCCGCCTTTTTTTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGGGCGGGGATACGGTTGCTAGGAGAACGCGATGACGCTGCGGCCTCCGG
CGCTCTTTTCCGCCAATGGGAGACGCGTGCCTGTAGCGATGCGCTAAGTGCGTCACGCTG
ACGACTGGCGAAGGGCACAGATCTGAGGGCCCGGAGGACGTTCGGCCTCTGTGAGCCGCA
GCCTTTCCAAGGGAGTGGTTGGGTCTTCGCCATCTTAGGGAGTGAGTGTGGCCGGGCCTT
CCTCGTGGTGGGTGCGGGGAGCGGAGCCCAAATCCCCTCTGGGGCCACTGCTTTGGCTGT
GGGCCCAGTCGGGCGCGGCTTCTTTCGGAAAGGCAGTCTTGACCTCTTCAAGGGCGCGGA
GGAAAAAGAGGAAAAAGGCCCCAGTTGGGGTCCCAGGGCGCCGGTGACATTAACTGCACC
TTGCCTGTCCTCTAACCGCCGCTCCCTCGTCCCCTAGGAAGATGTTCTCGTCCGTGGCGC
ACCTGGCGCGGGCGAACCCCTTCAACGCACCACACCTGCAGCTGGTGCACGATGGCCTCG
CGGGCCCCCGCAGCTGCCCCTCCGGGCCCACGGCCCCGCCTAGCCGCTCTCGCAACCTGG
CAGCCGCCGCGGTTGAAGGTGAGATCAGACCCTGCACCAGTACGCTCATTAGGCCCATTT
GTGGTCCGCTCTACCTTCGAGGCCTGGGCCCAGCCTGGAGGACAGGAAAGGACGCGCCCA
GCCTGTCGCACCGTAGGACGGCGCCCAGTTGCTTGCCCTGGGATGTCAGCCCTCTCCGCC
CTGGGCCAGTCTCCGGTCCTTGGCCCTCCCTCAAGGGCGTGGAAGGGCCTTGGTCCAGGT
CCCGTAGTGACCTCCACGTCCCGGAGGGAGTAGAGGCGGAGAGGCTGTGACTAGCTTCTT
ATCTTCGCCTGAGACCGCTTGGGCAGCGGACTATTGGTCAGCAAAGTATGGGGTAAAGTT
CCCTTCCTGAACACTGGCCACCCACAGTTTTAACTGTATTACCTGTTCTTTGATTTGGCT
TTAATTTTCTTGAAAGTACTCCTCCCTTAAGTATTTCCTAAGTTTTGTATTAGCTGACGC
CAGGTAAATCATCTTTCCACATAGTTGTATATGAGATAACTGGGTCTCTTGTTTTAATGC
GACTGGCTGAAGAGACTCTTCGCAGCCCCAGGTAGGCTGTAGAAAGGAGGTAATTGGTGG
GCATCTTTTGGGATTTGTGATGGTTGGGCCCAGTTTTAACTTGTGTTTTTTTTTTTAAAT
CCTAGTTGAGTTTATATTAAGAGAAACCTGAAAACCGAATTGTAGGAATCCTGAAAATGT
TATCTACATTGTGCCTGTAAAATCGAATTTTTTTTAAAAAAATCATTCATGTGCTTCTCT
GATCCTTGCATTATCATTCTGTCTTTCCATTTTAAAAGTTAAAGCTGACGTCATTTGTGT
ATTAAATGTCTTTGCAGGAATTTATGTGTACCTATTTTTGTGTTATAGGGGTTCATAATT
GGGGATAGTATTAATTAGTGGCTGGCTTGAACTTCGAAGTTTGCAGACTTTACATGTTGA
GTGTTCTCAGAATTGTACTGTTATCAGCAGTTAATAATTTGAAGTCTGATTTTAATTGTA
AAAGCTATTAGTGTAGAAAACTTTTTAAAAATGAATATGGCTTATTAGTATCTCACAGAT
ATAGAACCCTCATAATTTTTAAATGATCTGATTTTGGCAGTGAATTTTTTAGCCATTTAA
TTGTGACGAGAGCTGTTTGGCTATGACAGTACTGTTTCACAGGGAAATAAAGTTTTCTTT
CATTCCTATGGCCTTAGTCATCTCCAAAGTAATACTTATTTGATTTTTTTCCCAATCAAA
CAGAGGAGTATAGCTGTGAATATGGATCTGGCAGATTCTTTATCCTTTGTGGACTTGGAG
GAATTATTAGCTGTGGCACAACACATACAGCATTGGTTCCTCTAGATCTGGTTAAATGCA
GAATGCAGGTTTGTTTTGCATGCTGGACTAGAGCATATTGTTGAAGCATGACTTAAATTG
TAAGATGTAGTCCTCTACTAACAAGCTGTGTGGAAACCTAACTATGCAGGAGGTAAGTTG
ATGATCAGTAACATGAGTTTTATTTTAAAATGCATGGTGTGTCTTGTCTTATTACAGAGT
ACAGTTGTGAATTTGGCTCCATGAAGTATTATGCACTGTGTGGCTTTGGTGGGGTCTTAA
GTTGTGGTCTGACACACACTGCTGTCGTTCCCCTGGATTTAGTGAAATGCCGTATGCAGG
TTTGTATTGAAGTGACAACACTGAAAATATCTTTCATGCATTACCTAATTCTAAATATTA
ACAATCTTAAAGCACTTCACAAGTGAGAATTTGAAGACATCACATAGCTGCTAGAAAGTT
CAGTAGGAAACCACACCTGAATTTCTTTAACTTGTGGTCTTTATTTTGAATCCAAGAAAT
GTCTCTTTTGTGGGGGTAGATTATTCACTGTCAGACTCTGGCTGTAAATGGCTCTTTGCA
TTATGTGAAGTAACTTCATGTCCCTTATCTGTTAGTAAGGCTAAGGCAAAGAGTACATGT
AGATTTCTTTAAAATACTCTTAAAATCTTAGTATGAAAATTTTGTGAACATAGCCTCTTT
ATATTTACATAAAATTTTTAATAATTTGAATATCTTTTAATTAGGTTTATTGAAACAAAA
ATAATCAGACATCAAAAATTTATTTGTTCCAAACAGGATTAGAAGTCTACTTACCTAAAA
GAAAGGAAGGTGAAATATTAGGAGAGAGAGGAAGGTGATGTATACCAGCCCTTTTAGTAC
TGGCAGAAATAGTGAGATAAGCTTTTTTTTTACCATTAGTTAATAGAGTGGATATGAAAT
ATACCTTTGCTAAAACATAATTATGCATGTCTCTCGAAGTGAATTTATGTTAAGTCAAAA
GACAGATTCTCATTATGTTGATGTACCTTTTTAACTTGTATTTAGTTTGATTGTTTAATG
GTTACAAAACTTTGATATAATCTATTTAAAGGATTAGCAAATATCAAGAATACAGACTTA
TCTATTATTTAGACAGTAGCTTTAATTTTTTAAAAGTAATAGGAGTTGGGTAGTAAGAAA
TCTCTTAAGTCGTTATGTTTAGTATGTATTTTTGTTCAAATTTTACCCTTTTAACTATCC
CTCCAAGACTTAAGTCTGACTTAAAGAAAGCTAGACCTTAATGTATAAAAGTTTCCATTT
ATAAAAATAATCATAGACATTAAGCTGATATGCAGTGAACTTACACAGTAGTCCCCCCTT
ATCTGCATGGGATACATTCCAAGAACCTCAGTGGATGCCTGAAACCTCTGATGGTATGGG
ACCCTATGTTTTCTCCTGTACATACATATCATTGATAAAGTTTAATTTATAAATCATGCA
CAGTAAAAGGATTGCAATAACCAATAAAAGTTAAGTGAATGTGGTTGCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGCTGAAACGGCAGAAATTGAATCCTTGAAT
AAGGGGGGACTACTGTATTTATCTTTTGTGTAGTTATTGAAATTTATTTTAAACCCAAAA
CAAAAACTGATAGTGAAACTAAATATTATGAGACATGTTAGCTTTTTGGTGCATTTAATT
ATTTTTCTTGTTTTAAAAAAGGTGGACCCCCAAAAGTACAAGGGCATATTTAATGGATTC
TCAGTTACACTTAAGGAGGATGGTGTTCGTGGATTGGCTAAAGGATGGGCTCCGACTTTC
ATTGGCTACTCCTTGCAAGGACTCTGCAAGTTTGGCTTTTATGAAGTATTTAAAGTCTTG
TATAGCAACATGCTTGGAGAGGTATGTCATTAACTTTGAAATTGAAAGTACTGAGTGTTC
AACTTTGAGACCAAAAGGGATCTTGAGTTTTTGTCTCACCATGTTGTTTGTTTTAGAGCA
GAAAAAATGGTCCCAGAAAGTCAGCAATATACCTCAAATCATAAGACTGTTTTAACAGAC
ACAGGATGAGAAAAAGAAAATATATTTCACTGAATTACAGTGCTCTTTTTAATATACTGT
GTTGTTTTCTAAATGAGTTGAATTTTGAGTTTTTTAAAGAAAAGGTCTCTGGGATTTCTT
TGTATAATTCGAGGGATACCTACACTTGGCACCTAGATGTTCAAAAAATGTTTACATTGT
ACTATAGTTATGCATTTGATTAAGGAAGTTATGAGAGACAACACATTTGGTCTCGTGTGT
TACCCGCGGATTGTGTGATGAGAAATACTTTTAAAACGTCTAACGTTTACTTGTTTCCTA
GAACTGTCACTTTAAAGTAAAATTGAAAACAGCTAATGCAACAGCAATTCATATCCCTCC
TTGTTTTGCATTTTAGGAGAACACCTATCTCTGGCGCACATCACTATATTTGGCTGCCTC
TGCTAGTGCTGAATTCTTTGCTGACATTGCCCTGGCTCCTATGGAAGCTACTAAGGTTCG
AATTCAAACCCAACCAGGTTATGCCAACACATTGAGGGATGCAGCTCCCAAAATGTATAA
GGAAGAAGGCCTAAATGCGTAAGTAAACACTTGCTTAAAATTTTTATTATAAAAATATTC
ATGTTAAGGGAACTTCATTTCCACATCTTTTTTTTTATGTTAAAGTAAGGACCATTTGTC
ATTCTAAAAGTAACTTGATATTTGGCCTAAATATTTACTATTAACTTTCGGAAGGGGCTT
ATTAAAATTCTTATGATCTATTCAGAGTGAAGAATTTTCATGTAATCAGGCCACAACATG
CTTCCTTAGATCCACCTTTGTGGATGAACTTGAACTGAGTTCTGCCCGTAAACTTCTTGT
TTCTTGTAGTTCCAGTCAAACATCCAGCAACTTTTTTGGTTGTATAGTCAAAGGTGCTTG
AGTCATTGGCATGTGAGATAAATACACCTGCATGTTAGTCTAAAGTTCTGATAGAAATGA
CATGCAGTTATGCTGCCATTTTATACTATCAGGACTCGACTGGTGTGCGGACACTTCTGT
TAATGATGAAAATCTCTGCTAGATGAATGTATGCAACTGTGTAAAACAAGTCTCCTAATT
TCTTAGATTCTACAAGGGGGTTGCTCCTCTCTGGATGAGACAGATACCATACACCATGAT
GAAGTTTGCCTGCTTTGAACGTACTGTTGAAGCATTGTACAAGTTTGTGGTTCCTAAGCC
CCGCAGTGAATGTACAAAGTCAGAGCAGCTTGTTGTAACATTTGTGGCAGGTTACATAGG
TATGAATTATTTAGAACATATTTTTCTATGAAATTATAGACAAATCATTTCCATCACTGG
CCTATTTTGTTGAGGGAAAAATATTCTACAGTTTGTAAAGCAGTTTTTTCTTCCCATAAC
ATTTTATATTCCCTACAGGATTCATAAGTACTTCCTGATTAGTTCCTTAAAGGATGTTTT
ATGGTTAGCATGATTGTTTTGATATGTCATTATTAGGCTTGAGAATCTATTGATCTGACT
GCTGCACCTTTTTTTAATTGAGAACAAAGTTTTTATTTTTATTTTTTGAGACAGAGTCTC
ACTCTGTTGCCCAGGCTAGAGTGCCATGGTGTCAGCTTAGCTCACAGCAACCTCAAACTC
TTGGGCTCAAGCAATCCTACTGCCTCAGCCTTCCAAGTAGCTGGGACTATAGGCATGTGC
CACTATGCCTGGCTAATTTTTTCCATATATTTTAGTTGACCAATTTCTATTTTTAGTAGA
GATGGGGTCTCACTCTTGCTCAGGCTGGTTTCGAACTCCTGACCTCAAGTGATCCACCCA
CGTCGGCCTCCCAGAGTGCTAGGATTACAGGCGTGAGCCACCGTGCCCAAATGAGAACAC
AGTTTTTATATAATAAGAAGAAAGTGTTGACTCAAATCTGAATTAAAGAATCTTTTAAAG
GATTGTTATATTTTACATAGGGTAGACTGCATTATAACCATATCACTCTCACCCTAAATC
TGATTGGTGTGTTTGTTTCTTTTTTAGAACTTAAAGAAAATTTTACTATTGAAAGTCATG
AAAAAAGATAGTTGGCTGTGATATGAATTTCTTTTTAACTGACTCTGTATTGGATGATTT
ATCTTGACTTTTTTCAGCTGGAGTCTTTTGTGCAATTGTGTCTCACCCTGCTGATTCTGT
GGTGTCTGTGTTGAATAAAGAGAAAGGTAGCACTGCTTCTCAAGTCCTCAAGAGACTTGG
ATTTAAAGGTAAGATGATGTTTTTTTCTCTAAAGGAAGAACACTTTTGGGTATATTGCAT
TTTTTCATTTATGTTTCCTATTTGAACCAGGTGTATGGAAGGGACTCTTTGCCCGTATCA
TCATGATTGGTACTCTGACTGCACTGCAGTGGTTCATCTATGACTCTGTGAAGGTCTACT
TCAGGCTTCCTCGCCCTCCTCCACCTGAGATGCCAGAGTCTCTGAAGAAGAAGCTTGGGT
TAACTCAGTAGATAGATCAGAGCAAATGTGGACTGAATCTGCTTGTTGATCAGTGTTGAA
GAAAGTACAAAAGGAATGTTTATATATTTGACAGTGTAGGAAATTGTCTATTCCTGATAT
AATTACTGTAGACTCTTGCTTAAGGCAAGAGTTCCAAATTTACTGTTGAAATAAACCCAG
CTGTTCATGATTTGTCTATGATTTCATTTTTTGATTTTTAAAAAAATTTTGTAGAGGCTG
GGCATGGTGGCTCAGCGCTGTAATCCTAGCACTCTGGAAGGCCAAGACTGGGAGGATCAC
TTGAGCCCAGGGGTTCCGGACCAGCCTAGGCAATAGTGAGACTCCATTTCTATATAAAAT
TAAAAAATCAGCCAGATGTGGTGGTGTATACCTATAGTCTCAGCTACTTGGGAGGCTGAG
GCAAGAGGATGGCTTGAACTCCAGGAGGTGGAGGCTACAGTAAGCTATGATGATTGTACT
CTTGCTTGGGCACAGAAGACTCTGTCTTTTTTTTTGTAGAGATGAGGTCTTATTCTTGCC
CAGGCTGATCTTGAACTCTTGGCTTGAAGCAGTCTCTGCCTCAGTCTCCCACAGCACTGG
GATACAAGTTGAGTCTCCATGCCCCGTCTATTTAGAGCTAGGTTTGAAAAACTATTCAGT
TCTGAAATAGTCGCAAAGAATTAAGTAAATTAAGACCTTAAGGAAAACATGCAAACTAAC
CATTGAATGAATATTTCAGTCCCTATTCATAAATTGTGATGTCTCAAGTTTTATCACGAG
AGTCCTATATTTTTAGGATACATACCCAAAATTTTCAAAAACTTGATTTATTAAATTTAA
ATATGGATAAATATTCATTTGTGGTTTTATTTTGACAAGTAAATTTCAACATACGTTCAA
ATATTTACAATGTACTAGTTTTTAATGTTGATGAATTTACTAATCTTTAATTGTAAATGA
AGGTAACCCACGCTGGCTAATTTTTAGAATCCTAGTAAAGGACCAAAATAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1157, 2403..2527, 4281..4460, 4996..5177, 5706..5878, 6737..6847, 6930..7090
1001..1157, 2403..2527, 4281..4460, 4996..5177, 5706..5878, 6737..6847, 6930..7087
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved