Microcebus_murinus Locus RPS13
snOPY snoRNA Orthological Gene Database
Microcebus_murinus RPS13
Microcebus_murinus
RPS13
GeneScaffold_1126
SNORD14, SNORD14
2242..2332, 3584..3673
4888
TCTCACCAGTTACATTAAACTTGTCGCAGTGAATTTCACTGACATTCCCCTCTCCCATG
GCCATGCTTACTTTTGCTTCATTCGCCTATCCTTTGGCGCCCTGTGTCAGTACTGGATCA
GTCTTAAAAGACCTTCCTCCTCGGTGGTTCCCTTTTCTCAGGAAGTTGAGGTGCCTCATT
TTCTCCCTCACTCTCCTGGCCTTTGCAATCTTGTTCCCTACACTCTTCTCTGCTGGCCAA
CTCTCTTACTTGGGTATGCGGCTCGGTAAGGCTTTGGCCAGCACCCCTCCAATGCGAGCC
GCGCGCGCCACAACCCCGCGCAGGGCAAACAGCGTACCCGGGCTGAGTCCGCCAAGGTCT
GGTTCAAATCCTCAAGCCGGTTTGTTACCGTCGGTGAACTCTTCCCCGGCAGAGTAGGTT
TGGATTAGAGATTAAAAAAAAAAAAAAATGGAAGCGCGGGCTGGGCGGTGGCTGCTACCA
CTACTTCCGTGTAGTATTTATCACAGGGTACTTATTGTACCTGTGAATGTGCTACAGGCA
GGGGCAGACTTTGAGGGATCTAGTACCAAGACAAAGCCTGGCTCTGGCGAACGAACGAAC
ACTGCGTATGGCTGATCCCTGCAGCTCTAGTGACTCCATGGCTGCGGGCCCAGGACTCGA
ACCTTTACGATCTCGGCGCTGGCAGCACTTCTCTTTCTAGAGATGGCCACAGCAGGGAAC
TGTGATCGGAAGCCAGCGTCAACCTCAATTTCCCGCTCCGGCCAAGAGACTGGCCAAAGA
CCGGAGCACGCCGGGATGCGCTTCCGGCCCACAGAGGCGTCTAGTGCGACCGTGAAGTGC
ATTTCGGGATATATAGTCACGTGGACGCCGGTGGCTGCGCAGCGTGGCTCCGCCTCCCGC
CTGCGAGGCGACGGGACGTGTGAGGTCACTTCCTGCGTGCTGGGTGGCTTCCTGCGGCGC
TCCTAACCTCGCTCTCTTTTTGCTGCCAGACTGCCGCCATCATGGGTCGCATGCATGCTC
CCGGGTGAGTGTGGGCACCGAGCCGGATTGCGGGGCTGGGCTGCGGGATAGGGGAAGGGA
GGGAGTGTGGGCAGCGGGCCGGGGCGGTGTTCTGGGCTGCTGTAGCACGAGCCGCCGCCT
GACACGGAGATTGCTTTTGTCCTCAGGAAGGGCCTGTCCCAGTCGGCTTTGCCCTATCGC
CGCAGCGTCCCAACTGTAAGTAGTGGCGGGGACTGGGGAGAAGGGTGGCCTTTGTCGCTC
GGGGGAAGCGGCGCTGGGGTGGGGGACCTGTGTATGTGGAGCGCGACTTTGCGGGTAGAG
GGGGCGGCTGTGCTTGGCGCTATCAATGGTTTTTCATCCTATGGCTACTTTCTGTTTCAT
AAACAGTGGCTGAAGTTGACGTCTGACGACGTGAAGGAGCAGATTTATAAATTGGCCAAG
AAGGGCCTTACTCCCTCACAAATCGGTGAGTGTTTGTGTCTAACGTAGCTTCTTCCGCCG
GCCCTCGTGTGACTTGTAGGAAAAGCCCTGGGATTAAATGTGTCTTATACCTGCCTTGAA
AATTGTTTGTCCATATTTTCTGGCTGTACTGTTGATGACTGAGGTCTAAGTTTTATTTGT
TGAACTTTGAAGTTGTTATTTAGCAAATGCCAAAACTTAGTGAGCATTTACTATGGGCTA
GGCATCCTTAGGTGCATGCTTCTAAGCACTTTACGTGTACTGACCTCGTTGAATTCTGCG
AGCAATACTTGGAAATAAATACTGGTAATTACCCCCATTTTACAGTTGAGGAACTGAGGC
ACATTGCAGTTAAATACTGGCCCCAAATTACACAGCTAAGTGGAAGAGTTGGAATTGGCT
ACTCAGAGTGCTTGCCACGCTTACTCACATTTAGATGTGTTTGAATCTCAGCTGTGTCTG
ATATTGTCCAAGTGGCTTCATTCAGCAAATGTTTGCCTGCTTGTTTTGAACGCAGTCTAG
GCCCTGAGAATACGCTAGTCTAAAAAAAAGGACAAAATATCTCCCCTCCTGGGTCTTATA
GTCTAGTGGTGGTGCGACATAATTCAAAAAGAAAATGCATAACAGACTGTCAAGTAGTCA
GAATTAAGTTGAGGTTTAAAAGAAATGGTGTGATTTTTTATTTTTTTTTTTTGAAGAATT
AGTAGCAGCTGGTTTTAGTTACAGAACAAATAGACATACAGAAATCTCATTGCTTCCTTT
GGTCATCTGTATTCCGGCAAGCTCACTGTGATGATGGTTTTCCAACATTCGCAGTTTCCA
CCAGAAGGGTTTTCCTTAGTGTTGGGTAAAACCTTCCTTGGATGTCTGAGTGAGCTTTCA
TGCATTCTCCTATTGGTTTCTGTGATGCATAAAAGGAGACCTCATGTCACAGATAGGAAA
CTTGGAAAGTGGCCTGTGCTGAGCCTTGACATCACAGGCTCTGGTTTGGTTTTGGTGTTG
GAAGTTACAATATATGATTCCCTTTTCAGGTGTGATCCTGAGGGACTCACATGGCGTTGC
ACAAGTACGTTTTGTAACAGGAAACAAAATCTTGAGAATCCTTAAGTCTAAAGGACTTGC
TCCTGATCTTCCTGAGGATCTCTATCATTTAATTAAGAAAGCGGTTGCTGTTCGAAAGCA
TCTTGAGAGGAATAGAAAGGTAGGAGAATAAATAAAACCTACTACTAAACAGAAATAACT
GCTTTTACTAACTTATTTCAGTGAAATGTAATAATGCATCTAATTTGAATTGTCTAAGGT
GGTTTTAGGGCACAAACTAGCAACTGTAGCTGCTTTGAAATAAAAATTCTACCAGAAGAG
ATTTTTTTTTAAATCTTTAGTGCCCCTAAATACAGTATATTCAGTTGAGTGAAAATGTCG
GGATATGGGGTTTTTTGTTTTTGTTTTTTGTTGCAGAGTTTTGCAAATCATTCCTGTAAA
GTCTTACCCTGGAAGCCTGAATTCCCTTAAGGACTTAATCTGGCCACATGAACCCTAGTC
TTTGATTTTATTACAGGGTGTTGGATAACTTTTCATCAGAAAAAGTGCATGGTAGCTCTA
CATTCCTTTGTTAAATTAATGTCTGATAAAATATTAGGCCATTTGGGTGATGGTCTTGAA
TTGTGTTGGTTTATTTTTAGGATAAGGATGCTAAATTCCGCCTGATTCTGATAGAGAGCC
GAATTCATCGATTGGCTCGATATTACAAGACCAAGCGAGTTCTTCCTCCCAATTGGAAGT
AGTAAGTATAACCTTTTTTCTTAACAAGAATAGGAGTCAGCCAGATAGTAAATATCAGGT
GGCAAATATAATAAAAGGCCTGATCATTTCATGCCTTGTGGGACATATGGTTAACTACTC
TCTCTTTCTGCCATGCTAGTGGGCAAGCAGCCACAGACTGCATAATCAAATGGATATGTC
TGTGCTCTATTGAAACTTTTTTAGACAAGCATTGGGCCGTAGTTTGCAGACCCCTGGTTT
AGACCATGAACAAGCCCTTTTGACCCCTCTTTAGATAGTGGGTAGTTTGATTTCACACCT
CTGCTTCCAGGTGTTTGTGTTCTTTTAATTTTTCCATGAATTGCTCACTGTGATGATTGA
TTCCAAACATTCGCAGTTTCCACCAGAAAGGTCTTTCCTTGTGTTGGCCAGTTCTTCCTT
GGATGTCTGAGTGAGCATCTTCATTATGCTTGAGCACAATGAGCTGTTTCAGGAACTCAG
TAGTTGGGTGTATTTTATTATAGTTGGGGTTTATTTTGGCTTTTTGCAAATAACTCTATT
AACAGGGAGATTCTGTGAATGGATATGGAGGACCAGTATTAATCCTGATTTTCTCTCCCC
CTTTTTCCTTTTCAGTGAGTCATCCACAGCCTCTGCCCTGGTTGCATAAATTTGTCTCTG
AACTCAAGCAATAAAATCATTGTTTAACTAAAAGCAAATCTTGTGTTTCTTTTCCTGTTA
AAAACTAGTAGGTATCAGTAATAATATGTGTTGGTCTTCTATGATGGGGAAGTGTTTTAG
CTCAGTTATTGTAATTCTGGGATTCCACAGGGAGCGGTAAGATGGTGTCCATCTACAGCA
TCCCTTCACTAGCTCCTTAAACTAGCTGAGCAGTTTATAATCTCACAGGTGATTGCTATA
TACATACGGGGAGAACGGGAAAAGACTAGGAAGTAATGACTTTGTTTTTATATCATGGCA
AAAATGTTTCTAAGTATTTTTAATATGTTTGATTTTTTTTTTTTGAGACAGAGTCTCGCT
TTGTTGTCCAGGCTAGAGTGAGTGCCGTGGCGTCAGCCTAGCTCACAGCAACCTCAAACT
CCTGGGCTCGAGTGATCCTTCTGCCTCAGCCTCCCGAGTAGCTGGGACTACAGGCATGCG
CCACCATGCCCGGCTAATTTTTTATATATATATATATCAGTTGGCCAATTGATTTCTTTC
TATTTATAGTAGAGACGGGGTCTCGCTCTTGCTCAGGCTGGTTTTGAACTCCTGACCTTG
AGCAATCCGCCCGCCTCGGCCTCCCAAGAGCTAGGATTACAGGCGTGAGCCACAGCGCCC
GGCCTAATATGTTTGATATTAATACTGAGATCTGTGACATGTTAGCCACAGTGTAGCATT
AGAAATAATACATAAAAGTGTCACTGGAAGGAGGATGATCTTTCTTATGGAGGTTTATTG
GGTCTTGCTTGTTAGACTTAAAGATGAGGAGGAAGGAATTCAGGGAACAGTAAGCAAGCA
GAGTTTCATCTGGAGCACAGAGGTTCAGGAAGAACTATTGAAGATGGGCTCAGTTCCCTG
AGCCTTACAACACTTGTAGATGGGTTAAAATGTACACATCCAGGTGTTGTCAGAGTATTT
AATTCTTAACTTAGTGGGGTATGTAGGTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 1166..1214, 1386..1464, 2489..2658, 3140..3240, 3855..3888
1001..1023, 1166..1214, 1386..1464, 2489..2658, 3140..3240, 3855..3885
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved