Microcebus_murinus Locus BAT2
snOPY snoRNA Orthological Gene Database
Microcebus_murinus BAT2
Microcebus_murinus
BAT2
GeneScaffold_4643
SNORA38
1590..1719
15583
TTCCAAATACTTGGGGTTCCATAGCCTGGGTGTATGTAGAGTCCCAGTTCCATGAGGAT
TTCTCTGGCACCAGGCCCCAGTCTGGCTGAGCAAGCTCATAAAATCCTTAAACTCCCAGC
ACACCTTCCTGCAAACCCTGCCTGATGGGACATGAGGCTGCTGGGAATGGAACCTGGGGT
ACAGGGCCCTGGGGCATGATGAGGGAGCTGGTCTCCAATGAATGGGGAGTCTATTTTTTT
TTTTTTCTTTTTAGAGCTCATTCATACCAAATAATGGGGAGTCTAAAGCTCTGTCCCTTG
TACAATGGAATCGTATAATTTTTTATAGTTTTTTCTGAGTCTTGGACTTGCTTGCCCCAT
TTTAAGACTCTGAAATGATTTTGGTGGAGAAGAGATTATTGTGAGGATAATGAAAGAGGC
TGCTACCCTTTGTAGAATGGCCCAAATGGCAGAGTATTTATACTAGGATGATACTGGAGT
TTTATTTGGATTTCTTAGGTAGAAATGTCTGGANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTG
ACCCCAATGTCTCACTAGTGCCGAAAGATGGAACAGGATGGGCAAGCAAACAAGAGCAGT
CTGACCCCAAGAAGTAGACAGAGGCTTGGGGGGCTAGGGTGATGAGTGTTTTAACTTTGA
AGTTCGGGGGAGAATTGGGCTTGGTCTAGCCAAACCACATAAAGAGACAGAGAGGGCCAC
ATAATCTGAGACCCTAATGAGAATGAAAGGAACCTTCGGGCTTCTGTTATAGTCTGTAAA
GGGAGCAGAGACTGAGATACTTGCTGTCTGGTCCACAGGCTCCGGCACGTTTTGGGGGAG
GTGCCTGCAGGACCCAACATACTCAATGAGCTTCCAGCGCAATGTCCGATCGCTCGGGGC
CGACTGCCAAGGGGAAGGATGGAAAGAAGTATTCCTCGCTCAACCTGTTGGATACATATA
AGGGCAAGTCCCTTAGAGATCCCAGAAACCCGCTGGTGAGGGTCCTGCAAAGATGCCCTC
CTAATGGTTGGAAAGCTAGGGCATGGAATGGGGCATATGTTTTAGAGCTCTTCATTCAAA
GGGAAGTGGCTGTAGTAGAGACATCCAAAAGACCAGAGAGGGTGGTGGCTAAAGCCTAAA
GCCTGTAATCCCAGCAACTCAAGAGGTTAAGGTGGGAGGGTCGCTTGAGGCCAGAGTTAG
AGACCAGCCTGGGCAACATAGACACCCTCTCTCTTAAAAAAATAAGAAAAAACTAGCCAG
GCATGATAGTGTCCACCTATAGTCCCAGCCACTCAGGAGACTGAGGCAGGAGGATCCCTT
GAGTTTGAGGTTGCAGTGAGCTATGATGATGCCACTGTACTCCAGTCTGGGTGACAGAGT
AAGACCTAGTCTCCTGGAAGAGGAGGAAGAATAAAAAAAGACTTCCCAACTTTACCTTGG
GTCCTTTAGGGAGTAGGTGAACACCAATTACCCTCCTACAAAGGCGTGTCTGTGGTTCCT
CATCTTTGGACACGTAAGAGTTGGAGGCAAAGAAACATGGAATTGGAGAAGTCTGGGCCA
GCTTGGTCCCTGCAGGCTCAAGATCAACCATCCCACATGGAAGCCTTAGATGTAATACAT
CTCAGCCTTCCTGATAGGGATTTAGGAGAAAGGGATGGCTTCTAAGAAGTTTGGAGGAAA
TAGTAAGACGTTGAGGATGTGTAAATGGGACCTAGGGTGGGAGGCTGTCAGATCTCCTAT
GTGAAGCGTTTTTGACTCTCTCTTCACCTCTTCTCCAGTTGCCCCTCGCCATGGCCTGCA
GAGTCTTGGGAAAGTTGCCATTGCCCGGCGTATGCCACCCCCAGCCAACCTTCCAAGCCT
GAAAGCTGAGAACAAAGGCAATGACCCTAATGTCTCACTAGTCCCGAAAGACGGAACAGG
ATGGGCAAGCAAACAGGAGCAGTCCGACCCCAAGAGGTAGACAGAGGCTTGGGGGACCTA
GAGTGATTAGTGTTTTAACTTTGAAGTTCGGGGAAGAATTGAGCTTGGTCTAGTTGAACC
ATGTAACAGACTGAGACAGAGAGGGAGGTACCTTTCCTATCTATTCCAGATTTCATGTTA
GATAACTAAGGAACAATACCATTAGGTTTCTGTCAGATGGAGAGAAAGCATCAGGAAACA
GCCTATGCTGTATGACAAAATTAAAATATTTTGTCCTAATATTTATAAATGGTAGCAATG
GGCCTGATTTCAGTCCCTGCTCTCCACCAGTTGGAGAAGTAAGGAAGGCATCTCAGGCCT
GGGTAACCTTCCCATCCTGCCATCCCCTCAGTTCCGATGCCTCAACCGCTCAGCCGCCGG
AATCGCAGCCGCTGCCGGCTTCACAGACGCCTGCCTCCAACCAGCCGAAGCGACCCCCAG
CAGCCCCCGAGGTACCTGGAGAACTGGAGGGGTGAGTGGGGGGAAATTGCTCATAGCTGT
CCCACACCCATGACCATTTATCATCTTTTTGCTTCTCCAGAACACTCCTTCAGTTCCAAG
CGGGGTAAAGTCCTGGGCGCAAGCCAGCGTCACCCATGGAGCACATGGAGATGGTGAGTG
CAGGGCTGCTTAGGGAACTGTGTTTGGGCACTGTGAGAGGCAGGAGCCCTCCACTGTACC
TACAGCAAAGTGTCCCTTGGTCCTCTTTGGCCACATCTTGTTCTGTTACTATTCAGTTTT
ACGGGGCACTTGAGCAAATTTAAATCTCAGTCTACTGTGAGGGGGTGGAGGGGTCCCAGA
ACTGACCTTGCTTCTTGGGGAATGAGCACCTATTCCATAGGGGGTAAGTTTGAAAGCAGG
AACCCAACAATTTGATATCTGTCAGAGCCTTCCACTCTTACAGTCTGTCCTTAGTAAACG
TACATGTCTCCTGTTCTGCACCCCACCCCAACAAGGTGGAAGGGCATCAAGCCTACTGTC
GCGATTCTCTCGAGAGGAATTTCCGACCCTTCAGGCGGCTGGCGACCAGGACAAGGCTGC
CAAGGAAAGGGAGTCTGCCGAACAGTCGTCTGGGCCCGGACCAAGCCTCCGCCCCCAAAG
TGAGTAGCCTTTTGGCCAGGACATTACCTATTCTATCTCAGAGTTAAGCACTGTCTACTT
ACCTTCCTCCCCGTCAATTTCAGCTATGTTCACTTGCCCCTGAATCATNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACTTCATCATGGTCA
TGAGCCCCGGGGGGGCTGCAGCCTTCAGGCCCCCCCCAGTTCCCTCCCTACCGCGGAATG
ATGCCGCCCTTCGTGAGTTTGGATATTTTAGCTTTGAGTGATTTTGCTGGAAGCTAGAGA
ATTAGGACTTAGGACTTAGTCTTTGGAGGGGACAGCTAGAAAGCTAGGGGCCTATGAGGT
GGGGTGGGGGTGATAGTTTAAGGACCTGGCAGGCTATTCGACTGTCCCGCTGAGCAGCTA
CTGTTGGGCCCTTTTGCAGATGTATCCCCCATATCTCCCGTTCCCTCCGCCCTATGGACC
CCAGGGGCCTTACCGATACCCCACTCCTGATGGGCCCAGGTGAGCAATCCAAGTCTGGGT
TTATGGTTGGGGGTAGGGAAAGCCTATTGGGAAAGGAGATGGTTTTCTAGCCAGGAGGCT
CAATCTTGTATATGGTTATACAATATGCCATCTTTTATTTTCTCTCCTATTTTCTTTTCC
ATGCACAGCCGTTTCCCTCGTGTGGCGGGGCCCCGTGGCTCAGGGCCACCAATGCGCCTT
GTAGAGCCTGTGGGTCGGCCTTCTATTCTTAAAGAAGATAATCTCAAAGAGTTTGATCAG
TTGGACCAGGAGAATGATGATGGTTGGGCAGGTAAGTGGATATTAAGGGTCAAGCATTTG
GATCTGAAAAGGCAAAATCTGATGAAAATGGGGGTCATGTGGAAGAAAAGCAGACATTGA
AGGATAGGGGAGATACATGGAGGGAAACCAAGTGCTGGCACAGTACTGGGAGAAGTGAGA
ATGGCGAGACTCATAATTGGTGGATCTTGACTGCAGAGGGAGGGGATTGGCATTGGTAGT
ACATCCCACCATGTAGTTCTAGATCACTTGCTGTGTCCCAGGAAGGTATCTGAGATTGGA
GAGCAGAGTGCTTGGGTTACTATTCATTTTTCCCTTCAGGGGCTCATGAAGAGGTCGACT
ATACTGAAAAGCTCAAGTTCAGCGATGAGGAAGACGGGCGAGACTCTGATGAGGAGGGAG
CTGAGGGCCAGTAAGTTAGGGCCACCAGGGCAGAGAAGGGGGCTTGGTTTTTCTCACAAT
AATATATTCTTTGAGGAGCTGGAATGCAGCTTATTTTAATTTTGCTGTTAATCTGCTCAC
AGGAAGGATTCCCAATCAGCTGCTAGTGAGGAGCGGCCCCCTGAAGCAGACGGCAGAAAG
GGCAACTCCTCTGGCAGCGAACTGCCCCCTCCCAAGACAGCCTGGGCGGAGACCTCGCGG
CCTCCAGAGACAGAGCCGGGGCCTCCTGCCCCAAAGCCTCCCCCACCCCCACCTCACCGG
GGCCCTGCCGGGAACTGGGGCCCCCCTGGGGACTACCCAGTGAGTGTCTACAGTGAGGGA
TTGAGAGGTTCAGTTGTGGGAGATTAGTGTCAACTGGGTAGTTGGAGCAGTCTTAGAGGA
AGCTGGAGGGAGGGTTGAATAAAGGCTACGTGAAGGTGCAGGGCTGCAGAACAGCTCTGG
AAAGCTTAAAAACGTCGTTGGTGTTAGGGTAGTCCAGGTAAGAAGTGAGAAAAATCGAGA
TGCAAGTGAGGAAGAACAAGGAGGGCCTGGGTGTTGCGGTCTCTGACAGAGAGAGGGAAT
AGAGAAAAGACTAGAGTGTCTGTGTTGGTGCACATCTGTAGTCCCAGGTACTTGGGAGGC
TGAAGTGGGAGGGTTACTTAAGCCCAGAAGTTCTAGACCAGAAAACATAGTGAGACCCTG
TCTCAAAAAAGAAAAAAAGACTAGGGCGATGAGTTTATCACCACCCAGAGAAGAGAGGTC
ATCATCCCCCAAGGCCTGGTCCCTTCATCCTACAGCTAGACAGTGGATTGGTCTGTGAAA
GAGTTGGTAGAAAGCATAATGACTGACATCCCTGGGCCCTGCCGGGTGTGCCCATTGACA
GGATCGTGGGGGCCCTCCCTGTAAGCCCCCAGCACCTGAAGATGAGGACGAGGCCTGGCG
GCAGCGGCGAAAACAATCTTCATCTGAAATCTCCCTGGCAGTGGAGCGTGCCCGGAGACG
GCGAGAGGAAGAAGAGCGGCGCATGCAGGAAGAGCGCCGGGCAGCCTGTGCTGAGAAACT
TAAGCGGCTGGATGAAAAGTTTGGGGCGCCTGACAAGCGGCTCAAAGCAGAGCCTGCTGC
CCTGCCAGCTGCCCCTCCTGCCCCAGCTCCACCACCTGCAGTCCCCAAAGAACTCCCTAC
ACCTCCAGCTCCATCACCGGCACCAGCCCCAACACCAGAGAAAGAACCTGAAGAGCCAGC
ACAGGCCCCTCCTGCCCGGTCCACCCCTACTCCAGGTGTGGCTCCAGCTCCCACTCTGGT
GAGTGGTGGTGGCAGTACCAGTAGCACCAGCAGTGGCAGCTTCGAAGCCAGCCCAGGTAT
GGAGATGGGGATAGGTACTACCAGGTGTCAGACCTCTGCTTGGCTTGGAGGTGCAGGGTG
GTAAGGATGGGAGTAAATGAAGCAAAAGGCAGCTATTTTGGTTTATTTGACTATCCATGG
TAGTAGGGGATAGTCTCATCATTTGTGAGGTTATCTCAAAAATGGTTTTGGCCGGGCACA
GTCGCTCACACCTGTAATCCTAACACTCTAGGAGGCTGAGATGGGCGGATCGTTTGAGCT
CAGGAGTTCCAGACCAGCCTGAGCAAGAGCGAGACCCTGTCTCTACTAAAAAAGAAAGAA
ATTAGCTGGAGAACTAAAAATATATATTAAAAAAAATTAGCCGGGCATGGTGGCGCATGC
CTGTAGTACACCCAGCCACTTGGGAGGCTGAGGCAGGAGGATTGCTTGAGCCCAGGAGTT
TGAGGTTGCTGTGAGTTAGGCTGATGCCATGGCACGATAGCCTGGGTAACAGAATGAGAC
TGTCTCAAAAAAAAAAAAAAAAAAAGGTTCTATTATCTGAATTTCTGAATAAGTTGTGAT
TTAAAATGATTTTCTGCAGGCCAACACTGAAAAAAGTTTTATTTTGGTGGTTTCATAGGT
TAATGCTTCTACTGTAGGCTCTTGAGAGGCCTTAGTGTTTTTACGGGTTTTAAACAGGAA
AGGCTTCAGTAGAACAGATGTTGACTAGAATGTCTCAGGGAGCTGGGCACGTGAAGGCTG
ATATTCCTCGGATGTTCACAGAATGTCTGTTGATGAACTGTGTCACTCTGATTGTTGTCT
TTTCTTCAATGCAGTGGAACCACAGCTGCCCTCAAAAGAGGGTCCTGAACCACCAGAAGA
GGTTCCTCCTCCTACCACACCCCCAGCCCCAAAGGTGGAATCCAAGGGTGATGGGGTTGG
GCCCACCCGGCAGCCCCCTAGCCAGGGCTTGGGCTACCCCAAATATCAGAAGTCGTTGCC
TCCTCGTTTCCAGCGACAGCAGCAGGTGAAATCAAGTTCCCCTCTTACGGGCTGCTTCTC
TTCCTGGCTTCAAAATTTATTCCATCTATAAGTTGCCTTCTGGATCCCTTTGCCTCTTTG
TCTAGTTTTGTCTCTATTATGTCACCCCAGTTTCCATCTAGTCTGGGTTTTTGTCACATT
TGTGTATTAGTCGTTTTGATTTCCTTTGTGCGCTTTGATGCCTCTCTCATCCTCTTTGCT
TCTCCCTTAGGAGCAGCTCCTGAAACAGCAGCAGCAGCAGCAATGGCAGCAGCATCAACA
GGGCTCCACCCCTCCTGCCCCAGTGCCCCCATCACCACCACAGCCTGTGACCCTGGGAGC
TGTGCCAGCTCCACAGGCTCCGCCACCGCCCCCCAAGGCCCTGTACCCAGGTGCTCTGGG
CCGGCCTCCACCCATGCCCCCAATGAACTTTGATCCCCGCTGGATGATGATTCCTCCTTA
TGTGGATCCTCGGCTCCTCCAGGGCCGGCCCCCTCTGGACTTCTACCCTCCTGGAGTGCA
TCCCTCTGGTAAGGGGCTGTGGGAGTGGGGAGGGGTGGGGAGCCCCTTAGTCCTGGGAGT
TGTTGGATGTTGGGGTCTTACTGTGACTTTGGTATGACAGGTTTTACCAGTGAAAAGGGG
AGGGCATATGCTTCACTGCTGTGTTAGCTCTCTTGTGAGAATGGGCTTGGAGAAGAAATA
AGCAAGGGACTTTGATTGGCCAGGCTTTATTTGTGGCGGATTGATCCTTTCATAGAGAAG
CTATAAGTGGATAGCCCTGTTTCATAAGGGTGAGCAAGGCCCAGACCTACTGGGAACAAA
AGATGGAGGAGCTGACTTGACAGGGAGGACGAGACTACGGAGCTGCTTTTTGGGCCAGAG
GGCCTGTGACGTGATAAGGGTTATTTTTCTTGTTCTTTTGTTTCTTCAGGCCTAGTTCCC
CGGGAGCGCTCAGACAGTGGGGGCTCAAGCTCAGAGCCATTTGACCGGCACGCACCCCCC
CTCTTACGGGAACGGGGCACCCCACCAGTAGATCCAAAGTTGGCCTGGGTAGGAGATGTC
TTCACCACCACACCCACTGACCCCCGGCCACTTACCTCACCACTGCGTCAGGCTGCAGAT
GAGGACGACAAGGGGATGAGGTGAGTCTTGGTTTGAGAAATGGGTGAGTTCCCAGTGAAA
GGATCTGGGCCTAAAAGAAAAGTACTTAGGGTCAGTGGTAAGATGATAGTGATGAACAGG
AAAGATCATAATGTTAAGTGTTCTTTTATCACCTAGTTCTGGTATTCCACGTCCTGAGAT
ACTTACTCTTTTCTGTCTCTTCAGGAGTGAGACTCCTCCAGTACCTCCTCCACCACCCTA
TCTGGCCAGTTATCCAGGCTTTCCTGAGAATGGAGCCCCAGGGCCCCCAATCTCTCGCTT
CCCTCTGGAGGAGCCAGCTCCTCCAGGGCCCCGTCCACTCCCCTGGCCCCCAGGCAACGA
TGAGGCAGCCAAGATACAAGCTCCACCATCCAAGAAGGAGCCCCCCAAGGAGGAGACTGC
ACAGTTGATAGGGCCAGAAGCAGGCCGGAAGCCAGCCCGTGGAGTTGGAAGCGGAGGCCA
AGTCCCACCACCACCACGCAGAGAGAGTCGCACAGAGACCCGCTGGGGCCCTCGCCCAGG
CAGCAGTCGTCGTGGAATGCCTCCAGAGGAGCCAAGCGCCCCTCCCCGCCGGGCTGGGCC
TATAAAGAAACCCCCACCACCTGCAAAAGTTGAAGAGTTGCCTCCCAAGCCTCTTGAACA
GGGGGATGAGACCCCCAAGGTCCCAAAGCCAGACCCTCTAAAGACAGCCAAGGGGAAGCT
AGGGGGCCCCAAGGAGACCACACCCAGTGGGAATCTTTCCCCTGCCCCAAGGCTTCGGAG
AGACTATTCCTATGAACGAGTGGGTCCTGCCTCCTGCCGGGGTAGGGGCCGAGGGGAGTA
TTTTGCCAGAGGGAGGGGTTTTCGGGGGACCTATGGAGGACGGGGGCGGGGAGCCCGAAG
CCGAGAGTTTCGCAATTACCGAGAGTTCCGAGGAGATGATGGGCGTGGAGGTGGAGCAGG
GGTACCAAACCACCCTCCTGCTCCCCGTGGCCGCACTGCCAGCGAGACACGAAGCGAGGG
TTCAGAGTATGAAGAAATCCCCAAGCGGCGCCGGCAGCGCGGCTCAGAAACAGGCAGTGA
GACCCATGAGAGCGATCTGGCCCCCTCAGACAAGGAGGCCCCCCCACCCAAAGAAGGAGT
ACTCACCCAGGTCCCTCTTGCTCCCTTACCACCAGGAGCCCCACCCTCACCAGCCCCAGC
CCGCTTCTCTACTGCCCGTGGCGGGCGAGTCTTCACTCCCAGAGGGGTGCCGTCACGCCG
GGGCCGAGGGGGAGGGCGGCCCCCTCCTGTTTGCCCAGGCTGGAGCCCTCCACCAAGTCT
CTGGCTCCGAGGAACCTACCACAGGCCCTTTGCACCAGTAAGGAACCTTTGGAAAGAGAG
TGATCCAGGGCCTCTGTCCCCATGGCCCGGGGGCAGTGTGAGTAGCATGTGGGCATGGTT
GTGGAAGACGGGGAGCGCCCCGAAGAGACGGCATGGGAGGGCTCAACAGCAGGACAAACC
ACCTCGCTTCCGGAGGCTGAAACAGGAACGAGAGAATGCAGCCAGAGGGGCCGAGGGCAA
GCCTTCCTCCCTAGCCCTTCCAGCCTCTGCTCCTGGACCGGAGGAGGCCCTCACAACAGT
CACGGTGCCCCCACCAACTCGTCAGGCAGCTGCCAAGTCTCCTGATCTGTCAAACCAGAA
CTCAGACCAAGCCAACGAGGAATGGGAGACTGCATCAGAGAGTAGCGACTTTGCCAGTGA
GCGCTGGGGCGACAGAGAGGCTCCCCCACCAGCATTACTGACCCCTAAAGCTGTTGGAAC
TCCTGGGGGTAGCGGAGGTGGCTCCGGACCAGGCATTTCAACCTTGTCCCGTGGAGATCT
GAGCCAGAGAGCCAAGGATTTGAGTAAGCGGAGCTTCTCCAGTCAGCGGCCAGGCATGGA
ACGGCAGAACCGGCGCCCAGGCCCAGGGGGCAAGGCCAGCAGTGGTGGTAGCAGCAGTGG
AGGTGGCAGCGGGGGATCTGGGGGAAGGACCGGGCCAGGACGAGGGGACAAGAGAAGCTG
GCCCTCACCCAAGAACCGAAGGTGGGTAGGAACAGACTGTTAAAGTTTATGCCTAAGGTT
TAAAAATAGGGGGAGGGGGAAAAGGCGAGTTTGGGTGCTGTGGAGTTTTGTGACCTGAGG
GGACATGGACTTGTAGTCACTAGGATATCCACATCTAGGTAAGGCAGCTGGAGACCAGTT
GATAGGGTGATAGAGTCAGGAACACACATTTATTCCTTATTTGATTTCCACTCTGCAGAC
CTATACGTCAAAAACTCTTAGAAGGGCTCAGAAACACCTGGGTAGGGAAGAGGGTAGGCT
GTAAGGGGGAGCAGTTGGAAAGCAGATAACTGCCTTTCGTGGGAAGGGTAATGACTTGGT
GCGTACTGGAGCTGACTCTGTTTTCTGTTTTCTTTAGCCGGCCTCCGGAGGAGCGGCCCC
CAGGGCTTCCCCTGCCTCCCCCGCCCCCCAGCAGTTCCGCTGTCTTCCGCCTGGACCAAG
TTATCCACAGCAACCCTGCTGGCATCCAACAGGCTCTGGCCCAGCTTAGTAGCCGCCAAG
GAAGTGTAACTGCACCAGGGGGCCACCCAAGGCACAAGCCTGGGACTCCCCAAGCCCCTC
AGGGCCCTGCCCCTAGGCCCCCGACCCGTTATGAGCTCCAGAGGACCGGCAGCAGCGGCG
TCAGTTCCGGTAAGCTGGAGTGGTTATGGTTGGATCTCTGTTCCTAGAGAAGGTCAGGTG
ATGGGGGGGCGTCTGGCCTGGGGGCTGCTGCTGGGTCTGTAGGCAGAAGGATTGGGAGGT
AGAATAGGGAGGAAAAGCCAGGATCGGTGATATGGTAAGGCAGGTGCTGATGGTTTTTCT
CTTTTCCCCAGACCCCCACTTTGAGGAGCCGGGGCCAATGGTGAGAGGGGTGGGTGGGAG
TCCCCAGGATCCTGCCGGGGTTAATCCCTTCCCCCCCAAACGTCGGGAGCGGCCTTCTAG
AAAGCCAGAGCTACTGCAGGAGGTGAGGACAGGGTTTGAGATTGTGCTTCACTGCGCTCT
TGCTCCTGAAAGTTCTTGGTTTTGTTTTCTCCCTTCTCTTTCCTATTTCTATCATTGAGT
TTTTACCCCAAATTCTCACAATCACACTTGTTTGTCATGTGTCTCCCTTGTCACTCCCAC
ACCTCTTCCCCAGCTTTCTACATTTCTCAGTCTCCACCTCATTCATGTTTTGCCTCTGGC
TTTTCTCGCCCTTAGGAGTCTTCGCCATCTTCTCATAGCTCTGGATTCTTGGGCTCTAAG
CCCCAGGGCCCAGGCCCTCAGGGAGAATCCAGAGATGCAGGAACAGAGGCCCTGACCCCT
CACATCTGGAGTCGTTTACATACTGGTGAGTAAAGCTGAGTGAAAGGAAAGGGTGTGGTG
GAGGGCTGGCGTGAGATGGGCTCCAGAACTATCCTCCTCTCAATTTCTCTTTCTGGTCGG
TGGTGCGCCCTTCCCCAGCTGCTAGCCAAAAGAGTTACCGGCCCAGCTCCATGGAGCCCT
GGATGGAGCCCCTGAGTCCTTTTGAGGATGTGGCTGGCACAGAGGTGAGTGAGGATGGGA
GGGAGTGTCTGAGCTGGGATTTTTCTGAGCACTTGGCCATACTTCCCCATCTGCTCGGGT
TTGAGTCTGGGGCTATTTTTTCACTCAGTTGTCTCCTTTCTGCAGTTTTTCTATTTGTGT
GCACGAGTCAGGTATTGGGATGCTTTCTACCCTGACTTAACTAGCTCCTTCTCCACTCCT
CTCAGATGAGTCAGTCTGACAGTGGGGTGGACCTGAGTGGGGATTCTCAGGTGTCATCAG
GTCCCTGCAGCCAGCGAAGTTCCCCTGATGGAGGACTCAAGGGGACAGCAGAGGGACCCC
CCAAGCGGCCTGGAGGCCCCTCACCCATGAATGCTGTTCCTTGTGAGGGTCCACCTGGCT
CTGAACCCTCTGAACCTCCTAGGAGACGGCCACCTGCCCCCCACAATGGGGACAGAAAGG
TAAAAAACCAAGGAAAGATTAGAGAAATGTTTCCAGAAGTCTGACTTTGGCCCTACCTTT
GTCTGCCCCTTCCCTCTGCCTGTGTTTTCTGGTGATCTCCTGATTTTTCTTCCCTTTCTT
TTCACCAACCCAGGAGCTGCCCCGGGAGCAGCCTCTGCCCCCTGGCCCCATTGGCACAGA
ACGATCACAGCGTACAGACCGAGGCCCAGAGCCTGGGCCCCTCCGGCCAGCCCATCGACC
TGGCCCCTCGGTCCAGTTTGGCACTAATGACAAGGTCTGCATGTGCTGCATCTGGGCATC
CTAGGTTGGGGGGAGAAAAGGGAATGGCTAGAGGTGAGACAGAGAGAGCCTGTATCTAAA
TCCTGGGACAATCTTCTCTGCCTTGTGATCACAGGACTCAGACTTGCGCCTAGTGGTAGG
AGACAGTTTAAAAGTAGAGAAGGAGCTGACGGCATCAGGCACAGAGGTAAGTGGGAATAA
GTTTGGTGGAAAGGCCTGAGACTTCTGAAGAAGAATGCTGGGAGTGACTTGGGCATCAAG
GATGTCAGACATTGGCCTCTCCTCCCCAGGCCATTCCTATATCCCGGGACTGGGAGCTGC
TCCCCAGTGCTTCAGCCTCGGCTGAGTCACAGTCCAAGAACTTGGGTGCTGGGCACTGTG
GCCCAGAGCCCAGCTGCTCGGGCCAGCGCTTGTACCCTGAGGTCTTCTATGGCAGCCCTG
GGCCGCCCAGTTCTCAGGTAGGCCCCACTTCCCATCACATGACCCCTTCAGTAAGTGATT
ATTCTTTTTTGCCTGCTATGTCTTCTAATCAAGCCTAACTTGTATAGTTGTAAAACACCA
TTTCTTTTTTTGTCATTCCATTTTCCACCTTATTTTTTATTGCTGTGGGTGGGATGGGTG
TTCTTTTCTTTTTTCTTTTTTTTTTTTTTTTGGGTGTTCTTTTCTTGACTTGAGAAACTA
GAGCTATTTCAACCCTGCTCTTCTGCAGGTCTCTGGAGGAGCCATGGATTCTCAGTTACA
TCCAAACAGTGGAGGCTTCCGTCCTGGAACACCATCACTGCACCCTTATAGGTAAGGCTG
GATTCGTGTGGACCTTAGAAGGAAATGGAGATAACGTTTCAGGGGAGAGGAAGGAGAAGA
CACAGTTCTAGGGTACCAAAGGCTAGTGAACTTAAGGCATTGCTCAGACTAAAGGAGTAA
ATGGATCTGGCTTCCTAATGCCTCTTTCCCCCCCCAATTTCTTTCCAGATCACAGCCCCT
ATACCTTCCCCCAGGCCCAGCCCCTCCCTCAGCACTGCTCTCGGGGGTAGCTCTCAAGGG
CCAGTTTTTGGATTTCTCTGCATTGCAAGCAGCAGAGCTGGGGAAGTTGCCGGCCGGAGG
AGTTCTCTACCCTCCACCTTCTTTCCTCTACTCTCCAGCTTTCTGCCCCAGTCCTTTGCC
TGACCCACCTTTGCTTCAGGTAAGAGGTGGGCGGCAGGTATTGGGGCTTGCGAGTTAGGG
TGCAGAGGATGCGGGGAGTTGACATTTTTCTCCCCACTTCCAACAGGTACGCCAGGATTT
GCCATCCCCTTCGGATTTTTATTCTACTCTGCAGCCTGGTGGCCAAAGTGGCTTTCTCCC
TTCGGGGGCCCCTGCCCAACAGGTACCTTTTTATCTCCCCACTTCCCTTTCATTAGACAT
AGTTCTTTGTCCAATTTCTGGATTTTGTTTTGATTTTTTTCCTGGTTTTCTAACATTTCT
CCCTGCTCACAACATTCATACATACCCAAATTTGTTGTTACAGATGCTTCTACCCATGGT
AGACTCACAGCTGCCAGTGGTAAACTTTGGCTCCCTGCAGCCAGCACCGCCTCCTGCCCC
GCCCCCCCTTTCTCTGTTACCTGTGGGCCCTGCTCTGCAGCCCCCCAGCCTAGCTGTGCG
GCCCCCACCTGCTCCTGCTCCTCGGGTGCTGCCTTCACCTGCCAGGCCCTTCCCCGCTAG
CTTGGGGCGAGCAGAGGTAAGGTACAGCAACTGAGGTGCTGGGGAACTGGAGTTTAGGTG
TAGGGAGTCTGCATCTCAAGACAGGAGGCTCATGGCATCTTTTTCCTTCAGTTGCACCCG
GTGGAACTAAAGCCGTTCCAGGATTATCGAAAACTGAGCAGCAACCTTGGGGGACATGGG
TCATCACGTACTCCCTCAGCTGGAAGGTAACAGGGAGTGGGGATGATACAGACTCCCTGA
AAGGCTGGCTTGCTTTGGAACCAGGGGGTAGGTCCCTAGGCTTGCCTTAAAACACTCTTT
TCCCCTTAGGTCCTTCTCTGGCCTCAGTTCCCGCCTCAAGGCCCCACCTTCCACTTACAG
CAGAGTCTTCCGCACCCAGCGCATTGACCTTTACCACCAGGTGAAGGAGAAAACCTTGTG
GCCCCCAAATCTAAATTCGAGAGTTGCCATCTGAGTTCCTGTCCTTCCATCTGTCCCTGA
CCTCCCACCACGACTTACTTTTTCACATGTGCTTGTCCCCTAGGCCTCCACACCAGATGC
CCTGCGCTGGATGCCGAAGCCTTGGGAGCGGACAGGGCCACCTTCTCGAGAAGGGCCTTC
CCAACAGGCAGAGGAGCCTGGGTCCCCAGGGGACAAGGAGCCTGGGTTGCCCCCACCCCG
CTGAGGGAGTTCCCCTGGCCCCCTACCCCCGGGGCTTGTATATAGATTATAAATATATAA
GGGGGAAAGGGGTGGGTGGGGAGGGATTGTGGGGCTGGGGCCTCGCTTCCCCTCCTCCCC
CTTCCCCTGGTCCCCTATCCCTGGGGCCGTTTGTTAAAAAAGAATAATAAAAGGATTTAA
AAATTTTTACAAAGTCATTTGCGGGGGATGGGTTGGTTGCATGCATTGTTTTATAGCATG
GTGATGGTAAGGGATCTGTAGAGTAGTTTCAGTCAGGGACTGTTTGTTAATTTCCAGTGA
TCTGTTACAACAGACTACCTCAAAACATAACCAAGACCATTTTATGGGTTTTTAAATTTT
TGTGGGTTAGGAATTTGGTCCAGGCTCATCTGAGTAAATCACCTCTTGAGCCAGTTGGTT
ACGTCTGCAGCTGACACCGGGCTGGTCCCCATATGGCTTCCTTCACATGTCTGGAGCCTT
TGTGGGGCATCTGGAACTCTACTGGACTGTCATGGACTTGTCTTAACATGGACTCTCCAC
AGGGTGTTAAGCTCATCCCTGTTAAATGACCCTGAACCAAGTGTTCCAAGAGGTCAAGGT
GAAAGCTCCAGAGCTTATGACCTGGCCTTAGAATGTTTTGCCGCTTTATACTGGTCTGGT
ACCTCAACTAGCTGAAAAGGGGAATGAACATCTGCCTGTCAAAGGGAACAGCAAAGAATT
TGCAGCCATTAGGCCGGTCGTGGTGGCTCATGCCTATAATCCTAGCACTCTGGGAGGCCT
AGCTGGGTGTTAGTGGTACACTCCTGTAGTCCCAGCTACTTGGGAGGCTGAGGCAGGAGG
ATCGCTTGAGCCCAGGAGTTTGAGATTGCTGTGAGCTGGGCTGATGCCACTATACTCTAG
CTTGGGCAACAGAGAGACTCTGTCTCAAAAAAAAAAAACAAACATTGCTGCCATGGGACA
CCGGTCCCTTCATAGCAGCAGTCCCCAACCTTTTTGACGCCCGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1090, 1092..1101, 1103..1114, 1898..2075, 2431..2530, 2620..2692, 3035..3178, 3341..3429, 3432..3491, 3679..3758, 3908..4050, 4359..4449, 4562..4778, 5341..5815, 6614..6804, 7030..7327, 7729..7939, 8124..9231, 9234..9245, 9248..9271, 9276..9293, 9296..9301, 9304..9318, 9321..9329, 9334..9345, 9348..9374, 9377..9382, 9385..9980, 10357..10628, 10811..10941, 11175..11304, 11418..11503, 11705..11938, 12073..12213, 12334..12405, 12509..12676, 12928..13010, 13188..13398, 13486..13581, 13723..13935, 14031..14125, 14229..14319, 14443..14583
1001..1090, 1092..1101, 1103..1114, 1898..2075, 2431..2530, 2620..2692, 3035..3178, 3341..3429, 3432..3491, 3679..3758, 3908..4050, 4359..4449, 4562..4778, 5341..5815, 6614..6804, 7030..7327, 7729..7939, 8124..9231, 9234..9245, 9248..9271, 9276..9293, 9296..9301, 9304..9318, 9321..9329, 9334..9345, 9348..9374, 9377..9382, 9385..9980, 10357..10628, 10811..10941, 11175..11304, 11418..11503, 11705..11938, 12073..12213, 12334..12405, 12509..12676, 12928..13010, 13188..13398, 13486..13581, 13723..13935, 14031..14125, 14229..14319, 14443..14580
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved