Microcebus_murinus Locus EIF4A1
snOPY snoRNA Orthological Gene Database
Microcebus_murinus EIF4A1
Microcebus_murinus
EIF4A1
GeneScaffold_2967
SNORA48, SNORA67
3109..3243, 6576..6719
8104
CGGGCAACGGGATAACTGCCTGCCAGATCTTCAAACATTTTTTTATATATATATATAAA
TGCCACGGTCCTGCTCTCGTCAATAAAGGATCCTTTGGAGATACATAAATGGTGGTCTTC
CTTAAGGGGCCTCAAACTAGTGTTTATGTTTATCTCAGGCCTTCTTCCAGCCAGTGCTTG
TGTAGCTGACCTGTTCTTGGTCTTGAGACTTCAGGGGCCAGCTTTGTATCGCTGGCTCAG
GCAAAGTCAACACCATGTCTCATCACCAGACAAATCCCCCAGCCAAGGGAGCAGAGGGCA
GGAAGCCTCAAAATTAAGAGACCGTGAGAGGGAAGCTGGGGAACTGAAGGGACTGGGGAG
GGGGCCAGCTAGGATTCATGACAGCTATCCCAAATGTTCGTAGGCCCATAAGTCGTTTTT
TCCACTCGTCCCTCCAGCCACGGGAATCCTTCCAGTCCTTAGGATATGGTCTTGATTCCT
TCATCCCTGGCATACTTAGAACACATCCAGGCAGTGTTCCATCTCTTTCTGCGGAAGGGG
AGAACGTTAAATTTGGGTCCCGGGAAACTTAGGGCAGACGTAAAGGGAAATGGTAGTCCC
AGAAGCCCGGAAGTCCCTGGAGGCTGAGGCCTCGCCCCCCTCGCGTGATAGGGCCTACTA
AGCCACATGACTAAGGCACTATCTCCTCCGCACGTGTAAGGGTACAGGGCCCCAAAATGG
CTGCCAGGCCGCGAGGCCTGACTCCTATATGTCACTTCCGCACCGGCGAGAAAGGCGGGC
CCTCTAGCCAATCAGGCTGTAGGGCGGGTCTTCACCTTGATAGGCGCTCAAGTTATCCAA
TGGTGGCCTCGTGCCTGAGCGCCTACGAACTAACGTCATGCGCAGTTGCTGAGCGCCGGC
AGGCGGGGCCGAGGCGGGCAAGCCAATGCGATGGCTGGGGCGGGGTCGGGTGCTCTATAA
GTTGTCGATAGGCGGGCACTCCGCCCTAGTTTCTAAGGATCATGTCTGCGAGTCAGGATT
CCCGGTAAGAAAGGCATTTGCAGGAGGTTGTGCCTACTTACCGTGCCGCTCCCTTCCGAG
GGGCCCGCCGGGGGGGGGTTGCTGAGAGGCCCACCCTGGTTGCGGGGGAAACCAAGCCGG
AGGAACGGTCCTGGGGGAGTGTGGGGGGAGGTCCATGGTCAGTGCTGCCACCAGGGCCGA
GGCGGAGGGCGAGGATAGCCCCGGTAGGGCCGAGTGTGCGAGGTTCGTTACGAGGGTTCG
GCCTATGGCGGTGCCGTGCGAGAAGTCCCGGCGCTGAGTGGTGAAACGAGGTCGCGACTT
AGCGTGGGAAAGAAAGGCAGAGACCGCCGCAACTAGGTGGCCCAGAGCCGGCAGGCAGGT
CCGGTTGCCTCGCTGTGTTGGGGGGAGGCCTCGCGCTGGGGACTGCGAAGGATTCTGACG
GTACCACTCAGGAGAGGCGGGGGTGGCTGGGTGTTAAGATCCAGTCGCTTCGTCGCGGTT
GAAATATGGGTCGGGGGAAAAGAAACCGGCCGTTCAGTGTGCTGGTTTTCTTGACGGCCA
GGACTGAGCCTAACCCCGAGGAGCAGCCGCGTGAGGCACCAGGAGCCCACCCGGCGCCGG
GCGGGCAGGTCCATTTTTCCGCACAAGCCGGGCAATTGGCAAACTGCGGATGGGCAGGTC
CACTTTGCTTCGGGGGTGAGCGGCCAGAGGTATGGGGAGGGGCGACGCCATTTCGCGACG
GGGGCGGGCGGGGATGTGGATTGTTCCATGGAGGTGGGGGGGCACGCTGCCGGGTGGTCG
AGGGAGCGAGCACATGGCCGTCTGAGGTTTTCCCCTCCCCCAGTCTGCTTCGCTTCTAAG
TGTTGTGCAATGTCCCCCTTTGCTAGCTCGGCTGGGGCTCATTGTGCGCGAGGCCGCCAC
CGCCCGCGGCCTCCCACATCCGGGCACCGTGAGGGGGGGAGATCGGCTGTAGGGGTGGGG
GAGGGCGCGGGCGGGATGACGTGGGGGGAAGGGGATGTCCTACCCTCGGATCTGGGAGGT
GAAGGGCGGGACTTCCGGCGCCCGGGTGCTGCGATGGGAGGTGCACGCGCTTGGGCTTTG
AGCGGCCAGGCCCAGGACACGTGGGCCCGGTAGCCGGCACCACATCCGGGCACTGAGCGT
GGCGGCAAGCCCTCCAGCCTTTGGGTCTTTAGGGAAGGGTTATCCCATCATTTCCATGGC
GGCCTGGCCTGAGCTGCTGCAGGGATGGAACAAAGACTTGGTTCAGCTTTTTAAAGTAAT
TTACCTGGATGTGTTTTGAGAATTGGTGGGGGTAGAATCTGGGAGTGAAGGTTGATGACA
TCATGCAGGGCCAGTTGTTGACAGAAAGAGTCTGGCTGTCGGGATTTGAGTGCTTCCTTT
GGGCAGGAGACAAACCTCATGCTTTAAACCAACAGATCCAGAGACAATGGCCCTGATGGG
ATGGAGCCCGAAGGCGTCATCGAGGTGAGACTGACCCCCTACCACCAATGCCCTTCATCT
CTGAGAAATGCAGTGCTACTGTGACCCCAGGTTTCTGGAGTTGTTCCATGATTTAAGTAT
AACAGAAGGTTCATCTTAAATGCACACTATCTGGCGCTAGTAAAGGCCCCTTCTGTGAGC
ATCTAACCTTTACAGTGGTTTGTTGGAAATCTTATTTATGTTCCTGAGGATGTCTGTAAA
ACATGACATTCAAATTGAGTCCTGTTCTCCTCTCCTACAACCCCCAGCCTCATAATAGTG
TGAAGTTAAGTAGACTGGCCTCTTAGAATGACTTCCCAGACCATCTGTAAGCAGCTGGCT
TCACTAAAGGGATGGGGGCTTTTGGGTGTTGAAGGTTTGGTGTAGGCACCAGATCCTACT
TGCTACAGTACTAGAGTCCAGCCCACCTCTAACACCACTCTTAATTTCCTTGCGTCCTAC
AGAGTAACTGGAATGAGATTGTTGACAGCTTTGATGACATGAACCTCTCGGAGTCCCTCC
TCCGTGGTATCTACGCCTATGGCTTTGAGAAGCCCTCTGCCATCCAGCAGCGAGCCATTC
TTCCTTGTATCAAGGGTGAGACCTTTCAGCCCCAGAACAGATTCTGGACTGTCCCAGCAC
TGGGTAGAGTGGCATCTGGTTAGTGGTGCCCATCTCATATCAGCCAGGGACAAAGCAACC
CCTTGTTTATCCCAGCTTGGCTTCTGGTCTGTGCCTATGCCTGGTTCATGCCTTGGTCAC
ATGAATTGCTGGTTTTCCTTTAATGAGTAGTATGGTAGCTGGCTTGTGCTTCGTTTTATA
GCTTTATTTCTGTCCCAACTTGGCATAATACTGATGAGTTAATAACATGTTTTTATTTTC
TGATTTGTTTCCATTGTGGTGATTGGTGAAATAAAGTTTCTGAAGCATGTTAAATCTGTT
GGTTTCTTATGAATGTTGGTTTCTTATAAATATCACTAAGGCTTGAATGTCCCATGAGCC
CACAGTATACATGCTGTATCCCATTTAACTTCTGTTTATCTGTTTAGGTTATGATGTGAT
CGCTCAAGCCCAATCTGGGACTGGGAAAACGGCCACATTTGCTATATCGATTCTGCAGCA
GATTGAGTTGGATCTAAAGGCCACCCAGGCCTTGGTCCTAGCACCCACTCGAGAATTGGC
TCAGCAGGTAAGAATGTGGTTTTTCCCTCCTGAAGGGCTGATTTGGGGATGATAAACAAC
CAAAAGTCAGGGAAGTCAACTACTCCCACCTTGGAGGAAGAAGAGATAGATGCTCCTTAA
TAAAGGAAATGAGTTGATGACTTTTAGCTCTTGATTTCTAGACTTGTTGGGTTAATTATA
AGCCATTTCTTACCCAAACATAGCCACCACTTCACCCATTTCCTGCATCAAATGGGAAGG
CTGTTGGGTGGAGCCTGGCCGGCTGGGCGAGTTTGGTGGCTGCTTTATGAACATACCCCC
TGGCAATGGGCAAAGAGACACCTCATTGGTGGTGGTGCTCTTATATCAGTCAGGGGCAGA
GCAGACTGACAGTCCTTTGTTCATCCTAGCTTGATGCCTGGGTTGGTGGCCAGAGCTGTT
TCATGCCTGGGGCACATAAAATTCTAATGCTGGACTCCCATTTTCTTTGAGTCTTAGAGG
GGAAAGAATCACAAACACTAGTTTCATAAATACTGAGGCTCAGGTAATATTTTTAAATGT
TTAGCAGCTGTAATGATTATTCTGTAAACAGGTAATGTAAGCAAGAANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGTTCTGTGGCAGGGGTGCAATAGGATGTGCGTA
TGTGTCATCCAGTTCATAAAACTGGTTGCTGGGAAATGAAATAAAAGATCACAACTGGCT
TTCAGTAAAGTTAAGGATTCTATCTAGAATGGGAAACTATTAAAATTATTTTAGGGAGGC
ATTGTGAATCAGTGTACACTGGGAAACCAGACTGGGTTTGAGTCCTGTCTTTGCTATTTA
TTGGCAGAATGATCATAAGTGGGTTATTTAAGCTTTGCCTGTTTCTCACCGGGAAAATAA
GTTTAGTAATAATGCATATCTCAAGATAGTTGAAAACAAATATATAAGAAGCATTAAAAA
CTGGGGCCTGGACAGTTCTAGCTGGCATGTGAACACCTATCTTTTCTGGGCTCAGATACA
AAAGGTGGTCATGGCATTAGGAGACTACATGGGTGCCTCCTGTCATGCCTGTATTGGGGG
CACCAATGTGCGTGCTGAGGTGCAGAAACTGCAGATGGAAGCGCCCCATATCATCGTGGG
CACCCCTGGCCGAGTGTTTGACATGCTTAACCGGAGATACCTATGTAAGTAACTTAATTT
TCCAGCCCTCCGGGTCACACTTTCCTGTGCATGCTTTCCTAGTCTTGTAGCTTAAGCCAA
TGCCATTCCCAAGGATGCTAGTTTCCCCTTTAGTGAAAGTTGCTCTGTGATGAACCCCAT
GCGTGTCATCTGAGCCTGGCTTCCCTGCCATCTCAGCCCAGGGTAGTGTTCTACTTCCCA
GGGCTGTTGTCTGGCTTGGCAGGGAGGTCCTGGGCAAAGGATCAGTCTCTGTATTCTGAG
AGCAGACCACCTGTACCCTCTATTCTTTACCAGCAAAGAATACATTTAACATTTCCCTTA
TTACTATATACGTTGGTATTTTTTTTCTAATCTAGCTCCCAAATACATCAAGATGTTTGT
TCTGGATGAAGCTGATGAAATGTTAAGCCGTGGATTCAAGGACCAGATCTATGACATATT
CCAAAAGCTTAACAGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTATAGCCCCTGACTGATTCTTCTCCCC
CCCACCTCCAGGAGTAGAAAGCTAGGACACACTGTGTGACTTGTATGAAACCCTGAACCA
TCACCCAGGCAGTCATCTTCATCAACACCCGAAGGGAAGGTCGATTGGCTCACTGAGAAG
ATGCACGCCCGAGATTTCACTGTTTCTGCCATGGTGAATTTTCTTCCTTGTTAGCAGTTT
ACTGTGTATCTGTCAGAGTCCTGTCTGAGGCCAGTTTTGCTGGTGCTCATTTGCCTACCT
GCTACACGCTTCTCTCTTTTCTAGCATGGAGATATGGACCAAAAAGAACGAGATGTGATC
ATGAGGGAGTTCCGTTCTGGCTCTAGCCGAGTATTGATTACCACTGACCTGCTGGTGAGT
AGAGGCGAATTTAGAGCAAACAGGAAAGAAGGGAGAATCCAAGGTGATTCCCTCTCCGAG
GGGCCAGCTAGTGCCCGCCTCAGGAAAGTAGCAACTTGGAATAAAATCAGGCATGCCTAA
GGTCTCTTTGGGGGACAGAGGATGCTTGTTTCCTTTGCCTTCCCTTGGCTGCCTACATGT
ATACCCTAAGTCCCTTGGGGTAGATTTTGTCCTCTTATTCACGTGCTGATGTTGTTGTCT
TTCTTGCCATAGGCCAGAGGCATTGATGTGCAGCAGGTTTCTTTAGTCATCAACTATGAC
CTTCCTACCAACAGGGAAAACTATATTCACAGGTAAGCGTAGATCAGGAACATGTGCTTG
TCAACCTCTGGCTGAAGCTCTTGGTGTTCCTCATCCTCATCCCCTTATCCTGTTTTTCAG
AATTGGTCGTGGTGGACGGTTTGGCCGTAAGGGTGTGGCTATTAACATGGTGACAGAAGA
AGACAAGAGGACTCTTCGAGACATTGAGACCTTCTACAACACCTCCATTGAGGAGATGCC
CCTCAATGTTGCTGACCTCATCTGAGAGAGGCTGTCCTGCTACCTAGCCCCAGCCAGGGT
TCAATCTTGGGGGGCTGAGGAGCAGCAGGAGGGGGGAGGGAAGGGAGCCAAGGGATGGAC
ATCTTGTCATTTTTTTTTTTCTTTGAATAAATGTCACTTTTTGAGGCAAAAGAAGGAACC
GTGAACATTTTAGACACCCTTTTCTTTGGGGTAGGCTCTTGCCCCAGGCGCCGTCTCTGC
TCCCAAAAAACACTAATCCATTTCCCTAACCTAGTCACCTCCAGATCTCAGAGGCTCTCC
CTGCCCCAGCCAGATTCCTTTGAAAATGATTCAAGGGGCCATATATGTCAACCTCATTTG
CTGGACCAAATCTGGAGGCAAAACCCCTGAAACCCCCAAGTGAGGTCCAGGGGATTGTCC
CCAGGTGGAGGGAGCAGGGGAGAGAAAATGGTAGCCATTTTTACATTGTTTTGTATAGTA
TTTATTGATTCAGGAAACAAACACAAAATTCTGAATAAAATGACTTGGAAACTGCCTGTT
TGGGCTTCTCATTTCTTAACCTCCCCTTCCCTCTCCCACCTGCTACTGGGTACATGTCAG
CTCCCCTTCACGAGGTAGTATCTTGGCTATGTTGCGTCTTTCTGAATATCATCTAAGTTA
CAGATGATCCCTTTCCTCAGTTCCCCGGACCTGCAGCCCTGAGAAAAGTAAACAGAATGA
CCCCCTGGGGGGGGTTGGGTGTGCACTGTCATAAGTGCCTCACGTGCTTGGGCTAAGAGG
AAGTGATGGGTGGGAGAGTCAAGGGGAATGGAAGCAGAGATTGACTTTCTAAATCCTGCT
GAGCTCACTTCCTGGGAGGCCACTGAGGGAGGGGCTTCCTGGTTCTCAGCAGGCCTTAAC
GACTGCCTGCCACAGCTGCTGAGCAAGTTCTGCTGAGACAGACAAATGAGTCCCCATGGG
TCAACTGCCCCAGAACTCTCCATCTCATTCTGTGTCCACGTGATATTCTTGACTTTGCCC
TGAGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 2435..2483, 2942..3074, 3527..3666, 4735..4903, 5255..5364, 5686..5829, 6191..6193, 6197..6198, 6200..6202, 6204..6235, 6237..6274, 6276..6332, 6444..6533, 6792..6871, 6960..7104
1001..1023, 2435..2483, 2942..3074, 3527..3666, 4735..4903, 5255..5364, 5686..5829, 6191..6193, 6197..6198, 6200..6202, 6204..6235, 6237..6274, 6276..6332, 6444..6533, 6792..6871, 6960..7101
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved