Microcebus_murinus Locus ENSMICG00000002326
snOPY snoRNA Orthological Gene Database
Microcebus_murinus ENSMICG00000002326
Microcebus_murinus
ENSMICG00000002326
GeneScaffold_3425
SNORA65
4481..4607
6365
AGCTGTGTGGGGAGGTGGCCAGGCCTGCAGAGCCAGCTCAGGGCCCTCTTATCAACTCA
CCTGCCAGCAAGGTTGGAGAATGGTTTGCAAACAGCTGGTCCCTATCCCTCCCTGATGAC
TAGTACTTACCCTCTGCTCCCAATGACCAGCCCTCTCTGCTCCCCAACGCCCCCACCCAT
GATCATCGCCCCCCATCCTTCCTGGAAGATCAGTTCATTCCAGTCTGTCCCCAGATGTCT
ATCCCTCATCCCTTCCCTCCCCGACGACGTCAGCCCAGATGGGGAGAGCCACATCCATCC
CTCCCTGACTGGGGTGGGCAGTGGCCAACCTGGCTTTGTGGATGGCCCCCACGTTGCAAC
CCTTGGGTGGACCCGAAGGCAGGCTGATCACTGGGAGGGCTTGGTCATGGACCCGTGATC
GCAGATCACCCAGCACGGACCCGGCAGAGCTGGAGTCTGGTCTTCTCCAAAGGCAGGAGC
TGGGTACTGAAACTCACAATTTCAGAAAGTCATGCAGCCCAGGATGACGAAGTCTGAGAC
TCTGGGAACCACGGAATCTCAGAATTAAGAATTGGACTGGATTTAGATTGGAATAGATTG
TTTTGAGAAGTAAAATACACACACCACGAACGGGATAGAGGGGGCCCAGGGTCCCTGGGG
TACTGGAATGGGGGTGCGGACTCCTCAGGGGAGGGGCGGGGCTCTAGGATTGGGTGACAG
GGACCCCAGGGTGACTCTCACAATAAGCGAGCAAGGGGATCAGCAGGGCCCTGGATCTCG
GGAGCAGACCCTTCTTCCCTGACTCTGCCAGAACCACACCCTCCCTTCCGAATCCCTAGC
CACAGCTCACCGCGGTGCCGGGCTCTCCAGCCGTCAGCCTCAGGCGCCTGCCCACAAGAA
ACATGGCGGCAACGGCGTCCCTAGGACACTGGGCGGAGACAGCAGTTCTCGCGAGAGCGG
CACTTTCCTGCCTATATCCGGCGTGGTCTGCACGCCTTCCGGTCTTTCGGTTTTCGGCTC
GGAGGAGGCCAAGGTGCAACTTTCTTCGGTCGTCCCGAATCCGGGTTCATCCGACACCAG
CCGCCTCCACCATGCCGCCTAAGTTCGACCCCAACGAGATCAAAGTCGGTGCGTGCTCTA
GCTGCGGCCTGGGCTGCGGGATGGAGCCTCCCTCGCTGCGGCCCACGCCGCGCGTGCAAA
GCTTTCCCGTGTGGAGCTCTAAAGCCTCCTAGAGGCCTTTCCCGTGCTATGCGGTCCTGG
CCGAGTCTCTTAGCCTTATCTGGGCCTCAGTTTCCCCGCTTGTAAATGGGGAGGGAGGAC
CATACGACCTGTGGCGGCTTGGCAGCCCGCACTCCCTAGGGTAAGGCTTGTCTCCGGGCG
TTTCTGCCCCGGGACTGGTTCGCGGCGCCGGGGCAGCCTCCAACGCTACCGCTTTGCGCT
CCGAGCTGCCCAGGCCAGAGTAGCGAACGCCGGGCGGCTTGGGGCAGTTTTGGGAAGGGC
AAAGGATGGTGTGACTTGCCGGGAAAGATGAGAAGAGAGAGCTGTGGCTCCCTCTGCAGA
GGCACTAATCCTTCGTTTCTCCCAGTATACCTGAGGTGCACCGGCGGCGAAGTCGGTGCC
ACGTCTGCCCTGGCCCCCAAGATCGGCCCCCTGGGTCTGGTAAGTCATCCCCGCTTAGGG
GCCTTTTCTTCACTTACTGTGAGAGCAAAGTTAACATATCAACTGCCACATGAGTTGTAT
TTAATTCATGCTAGAAGACTGGGACCTCGCGAAGCGTGTGTAACTCACACGGCTCTTCAC
CTTGGGAGCCGCGTGAACTGTTTTTCAAATTGCATATAACTCACAGAAAACAATGAAAAA
TAAATTTTTCATTAAATTAGAAAGGATCATATTCTGTTTTTGTAATTGAACACCGTGGTA
CCTGGGAGAAATTTTTTTTTCTAGTGTGGCAGTCAATGTGTTAAGCTCTGGCTGTACAGA
CACTCCTACTAGACTTGACTCGGAACTAGCAGGAGGTACCTTAGGAAGGTCATACCTGAA
AAACCGAACGCTGTCCCTTGAAGTTGGAATTTACTGTCCATGTGTCACTTACCTGCTGCT
TTTGGTGATCCTGAGGGATGGGCCCAAGGAGGTGAAGTCAGGAGTGGCTTAGTAATAGTA
GGCAGCCTGTTTGCATTTCCTGGCTAGGGAAATGGTGTGGGTGAAGATCCTGGTGAGCAT
TTTGAACTCTGTAAACATAAACCTAATGGTTACTATAACTAGGTTTATCTAAGACCTATT
TAGTCACCAGCCTCTGGCCTGCTTCACCTCCATGTTATACTCTTATTGAACTTGCAGTTC
CCTGAATATCACTGTGCCGTTATTCCTTAGGCAGTGGTTTCTTATCCCAAATGTTCTTTC
CCCTTGGTCTTGCTTAACCAGTGTCTTACTGCTCTCTACCTTGTCCCTTAGCTAAGGCAG
CACTTAAGGGACACTTAGCTTCCTGTTTAGGCTAATGGTAACTAGGAAATAGTTTCAAAG
TAGCAAGTGCCCTTTCCTCACAGATGGGCTTGTATTGGTCTGACATGTGAACCTAAGATT
CTGGAAAGTTCCCTAGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTGGGATTCCTGGAGAAAAAGCTGTCACGAGTCAGATTCTGTCTTAGTGGGAAGGC
TTTGTTAAAGAATGTAGACTTTAGGGCAAAGATGTGTCACTTGTGTGACATTGGGCCAGC
CATGTAATTTAATGTCTCCCAGGCTAGGAGCATTTTTTTTTTTTTGAGACAGTCTCGCTT
TGTTACCCAGGCTAGAGTGAGTCCGTGGCGTCAGCCTAGCTCACAGCAACCTTGATTTCC
TGGGTTCAAGCAATCCTCCTGCCTCAGCCTCCCGAGTAGCTGGGGCTACAGGCATGCGCC
ACCATGCCCAGCCAATTTTTTCTATATATATTACAGTTGGCCAATTAATTTTCTTTCTAT
TTATAGTAGAGACGGGGTCTCGCTCTTGCTCAGGCTGGTTTCAAACTCCTGACCTTGAGC
GATCGCCTGCCTCGGCTTCCCAAGTGCTAGGATTACAGGCGTGTGCCACCGCACCCGGCC
TAGGAGCACGTTTTTAGATGGTGAAAATTACTTGAACATGCGCAGTAAGGCCAGTGTCTG
GCCCATGGTCTCAGAGAGCTGATGTGCATGGCAGTATTGATTCTCATACAGTGGTGGTAT
TGTTCACTGGAGGTGGGATAGCTTATTCACATCAAGAATCTCTTCTGCAGATTGAAGTGG
TACCTTCTGCCTCTGCCCTGATCATCAAAGCCCTCAAGGAACCACCAAGAGACAGAAAGA
AGCAGAAAAACAGTGAGTTGCCTTTTCTCAGGATTTGTTTCATTACTGGTTTGTGATTGG
TGATCATGGCTATGCTTTCCCTTTAATGAAACCCGGGTTGGCATGGGGATTGGGTGATTA
TTTGGTTAAGGCTGTTAGAGCCAGGCACTACCAAATGGTGCCATGTAGCTTTCCCCAGTC
TTGTGGAGGGCAGGTCCCATTCATAGTGCATGCTGCAGGGAAATGTCAGCTGACAGGGAA
GCCACTGAGCACTGCCCCTTTAAGCAAGAGACCACATGCTACTGGCAGATACTTTTCTGG
ACAGCTTAAGCCATACCCATAGTTTAAACTTGTCATTTCTCATTTGTAAAACAAGGTCCT
TGCCATGTCAGATTGGCGAAGACTTGGTTTGCCCATAGCCACCCGCCACTGCACCTACCA
GTTCTGTTGGCTGGTGCAATCCAGTGGTGAGCTGATACTAAACCCCAGCTTAGGAAACAG
GGTTGTTCTTCATGTGGATGACTCTGTGCCGAAAGCATGGGAACAGCCTAGAAATGGAGG
AAGGATGAAATATGATCTGCTTTACAGGCTGTGACAGAGCTTTTGCTGTTTTTCTTCTTC
TTTAGTTAAACACAACGGAAATATCACTTTTGATGAGATTGTCAATATTGCCAGACAGAT
GCGGCACCGATCTTTAGCCAGAGAACTTTCTGGTAAGAACAGCATGACGTTGCAACTATT
TTGACTGTAGTTGGGTGTTTTCACTGAGTGGCTAGCATTCTTCCCATTTGAAAGGGACTC
TAAGACCCAGATTGGGATGTAGTGTTCCCTAGTGTTGAGGGGAGTGGCTTAAGATCTTGA
TCTGGTTGTGTCTGGGTATCAAGGGACCCATGGAGATCTTACATTCAGGGTTTATATGGC
TAGATGGAGTTCTAAGCTTTGTATTAAGGGGTCAGGGATGGCATCCATTCCCTGCCTGCT
GAGAACTCAAAAGCAGCCCCCTACCACATGTCAGGGTTGTGAGGGATAAGAGGCAGCACC
CAATGCCACTTTTTCTTTACTACAGGGACCATTAAAGAGATTCTGGGCACTGCCCAGTCT
GTGGGCTGCAATGTTGATGGCCGCCACCCACATGACATCATAGATGACATCAACAGTGGT
GCAGTGGAATGTCCAGCTGTGAGTAATTCTTGTACCAGTTTCATTTGGTTGTGATAGGGG
TGAATGCTGGGGAGAGGAGAGGTACCTAATGTATTTGGAGATAAGCTGATAAGTTATAGA
AGTGGTTAGTTGGGGCTGGAAGATAATCTTTTTAAATTCCCCTTTTACTGATAGAGCTTT
TTTTCTTTCCTACAGAGTTAAAAAGTACAAAGGAAAATATTTCAATAAAGGATCATTTAA
CACCCACTGGGCTTTTTGATGTGGTGTCTTCCCTGAGGAAGCTGGCTCCTCCTTGCAGTG
TGTAAATGGGTCAGATGCAGAACTGTGAAGAAGTATATCTGGGTATCTGTGGGTAATAAG
AGACCTGGAAAGGAAATGTATTTTGTAGACACTTAGATAACCTGTAGTTCAGCATGAGCA
CCCAGAGAAAAAGCAGCTCTCCATCCCAGACCAACTGAGTCTCTGGGTGGGCTGGGGCCC
AGGACCCACATTTTAAGCCTTTGCTAGCCACCCCAGTGCACAGCCAGGGTTCAGAACCAC
TAAGATGACAACAGAAACCTGACTGTCAGTCCTTGACTAATCATTTCCTCATGGGAAAGT
GAGGTTTAGGTTATTTGTTGCAGTAATTGTAGCTTACCTCTGTAGTTCCCAACATTTTCT
CTAAACTTACTGCTATAAGCCACCAGACTATTTTCTGACTTTTCACATTTCCCAAGTCTC
ATGGTCGCTTCTGTTCCTCCTGACTAACTTACTGGAACTTAGGTTTATCATTCCCTTACA
TTTTTTTTTCCTCTCCCCCTCTACTCCCTTAGATGTTGGATTGAACCAACCTCAAGACAC
TTGAATAAGCTGCACCCTAAGCAGCTTGATGAACTACCTGGATAGGGTTTCTGGGTACCA
GACTAAAGGGAGTTGGAAGTGACTGCCCCAAGAACTTGGATTTCTCCCACATCACTCATT
TCAAGTCATTCATTTTTTTTTTTTTTTTTTTGAGACAGAGTCTTGCTTTGTTGGCTAAGC
TAGAGTGAGTGCCGTGGCATCAGCCTAGCTCACAGCAACCTCAAACTCCTGGGCTCAAGC
AATCCTGCCTCAGCTTCCAGAGTAGCTGGGACTACAGGCATGTGCCACCATGCCCAGCTA
AGTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1127, 1585..1658, 2932..3030, 4010..4091, 4685..4771, 5125..5264, 5267..5283, 5294..5312, 5317..5325, 5332..5349, 5352..5358, 5361..5365
1001..1127, 1585..1658, 2932..3030, 4010..4091, 4685..4771, 5125..5264, 5267..5283, 5294..5312, 5317..5325, 5332..5349, 5352..5358, 5361..5362
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved