Microcebus_murinus Locus PAK1IP1
snOPY snoRNA Orthological Gene Database
Microcebus_murinus PAK1IP1
Microcebus_murinus
PAK1IP1
GeneScaffold_1164
SNORA23
8463..8642
13490
CTCAATCTCTGTACCTTCTGAAAATCTCAAATGTAAAAGGTTATCTTCGCTTTCCTTAA
TGTTTAACTTTGCACCCAAACGTGGGACAGCGGTGGAAATGGTAATAACGTGAGCTTTCC
TCCTGGGGCGCTCAGCAGGCAGGCCTGCGCCCTTCTGCCCAACTCAGTCCATCTTTAGTC
GCCTCAGGTCAGGGTCCTCCTCCCTCCCCAGGACGTGCCGCAACGCTGGCCACTCTGACG
CCAGTCAGACGGCGGACCAAGCTGGAAGGAAAGGCACGCGGGCAGCGACGGCGGGAACGC
GGGCAGCGGATCTCCAAGGCCCGGACTTGGGTCTCCCACACTCAGAGCAGTCGCTGCGGC
GGGGGAGACGATGCTGCCCTCTCCAGTCATCGCGAACACGAAGTCCCACCCCTCCTTGCC
CTGTCACAACCGAAAGTCCCGTCCCGAAGCTCTCTGCACAATAAGGACACCACCGCTGTG
TCACAGGCACTACAACGTCCTTTCCGCACCGCCAACAGCAGCCGCCGCCGGAAATTGCTC
CGCCCCTCCCTCAGACGCCATGAAACGAGGGGCTTACGCGAGGATGTCCGCTCACTCCCC
TCAGCGGACCTAGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGG
ATATGCCTGCTTGCCCATTTTTTTCTCTCTGCAATGGGAACTTCCTCATATAGCGCCCTC
CCTTATTCTCCTCTTTGAAAAGTACATGTGCTCTCCAAGCAGTGAAACTGTTTCCACAGC
TAATAATAAGGCGCCTAAAAGACAGCCCTACGGTCATGACGTGTACTTTGTGCGCCGACG
AAGGAAGGACCCGCCTCCCCCACCCCGTTTTTGTGTGTTTTTGCATCCGGTTCAGTCGTC
TCCTGTAGGTGGAGCTCTCCAAGGGGCACGTGCGCAGCTGCATGGAGCTGGTCGCTGGTT
GTTACGAGCAGGTCCTTTTTGGATTCACTGTACACCCGGAGCCCGCGGCGAGCGGCGACC
TCGAGGTGAGATGCCCCGCGCCGAGACACCGTCGGAGGCGGGACAGGGACTGTCAGGTTT
GGTTCCCACACCGCAGAGGTGAACATTGGAGCGCCTGCTGCTCTCCCTCTGATATCTCCG
GATTAATTGACGAATCAAACTCAGGGGACTCAGCATCTATAGCATCTATTTAAACCGTTT
AAAACACGGGATAGGCATTTTACCAAAATGAGATAATAATGTTTGCCTATTATAGTAGAC
AAAAAGTCCACAGGGCACGAAGGTAGCGGACATTTATCCACACGGACGAAAGAGTCATAG
ATACGGATTTAAGGGTTGCTCCCATAAGTTGACTGCCAGTGTAGGTATTCAGCGTTTAAG
GAAAGAACAATTCGCTATTTTGCTGAGTTTCTGTCCTGGAGTTTTACAAAACATTAGAGC
TAGATTAGGATAAACCTCTCTTAGGTGAAGGAAATGATACTAATTGGTTTATTATTAATT
GAGAACTGTGGGCTCGGCGATGCAAGTGCAAAGATGCCGGAGGTATGGATCTTGTACGGA
CGTTCCCGACATAAGGGGTGTAGGACTGAGAAGACAATACATGGAGAAAATTTACAGCAG
AATACGATAAAAATTTTTACTAGATGTGTGAATAAAAAGGTTAATTGCCAGTAGTCAAAT
AGGTAGATAGTACTATACCCAGGGTTAGAAATCTGGTCTCCTAACTTCTAGCCAGGTACT
GTTTTATTCCCTAAGCAATTCTAGGTACCTACTAGAAATTATATCTTAGTACAGTGCTTC
GTTTTAAAGAAGTCAACATGTCAGTCTGGAATTAGCCAGAAAATTGGAAGTATATGACTT
GACTAATAGTTTTTTTTTTTTTTTTAATTTTGTTTTCTACTCTAGTTATTTATCCTCTTT
TGGCCTTTGGCTGAAAGGTGACATGTTTTGAATATTCAAGGATGATATTATTGAATTTGG
TTTTTTGGTAGTAAAATTACTTACACATAATACACTTCACAGCAACCCTTTGAGACAGAT
ACAGTTATTCTCAATTTTCAGATGAGAGTTTTTCATAGATAGGTTAATTGACTGCTCAAG
GATACACAGCTAATAATTGGCAGAGCTGACGCAAGATGTCAGGGACCCCTGGTGTCTCTG
GCACTTGAAGCTCTTAACCATTACCGAATACTGCTTCTAAATCTAGACAGTAGCCTCAAT
AACCAACATTACTTTTGCATCATGAATTAACAAAGGGTATTCTTAGATTTAGGGCTCTAG
CAGCTCTTCAGGAATGTGTGCCTTGACACAAAGAGGCTCCCTTGGTCCTAATTGATGGAA
GGACTGTTTGTTGCTGTAGTTACTCGGGACTTAATTTGCAGTAACAAATTTTAAGTGTGT
TCAGAGGAGTTTGGTGGGTTTTTTCTTTTCTTTGGATTGTTTGCTGTCATTCTTTGCACT
CATCCAGTCACACTGCCCAATCGAAAAGTCACATGGCAATAAGCATAGAATNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACATCATATTTATTTTGTCTCTCCCACT
GGCATGGAAGCTCCATTACAGTAGGGACTTTTATCTTTTATCTACTGCTATATATCAATT
ACCAGAAATAGTGGCAAGCAAGTGGTAGGCACTCATTATTTAAATGAATAAATTCACATA
CAAATTTGAACATTTGAAAGAGTAAATGATGTGGAAGTTTCACATACAAGTAAATAATAT
TAAAGACTTAAAGATTTGGGTGGGTTCTAGAAGTCTCTCTAGTCCAGACTCCATTGCTGG
GTTCCAAAATACAATACCCAGTATTGCCTTCCTACCTCTTTGGTTTACCTTCCTTATTCA
ATTTTCAGATTCTTGTTTGTTTTAGTCTACACATAATTGCATAGATTTTTCTCCATTTGG
AGGATCCATTGGTAGTTTTCATGGATTGTGGAACCACTTACCTGTTTCTGGAGAGCTGTG
GTGTGACTGTGGCAATTGATTGTACATTTTACTCTTTAGCAGAAATGGTCTCCTGTGGCT
GACTTCACTCACCATGCCCACACTGCCTCCTTGTCAGCAATAGCTGTAAATAGTCGTTTT
GTAGTCACTGGAAGCAAAGATGAAACAATTCACATTTATGACATGAAAAAGAAGATAGAG
CATGGGGCTCTAGTGCATCACAATGGTAAGAAAATTGTATTCTTTAAGGTAGTAATGTGG
AGGTATACTTTACAATTTGACTTCAGTTGAACAATTCATTAAGTGTTTTCTAGCAGATTC
TGTGCTAGGAGATACAGAAATGAAAAAAAAAAAATCCTTGCCCTCAGGTTACTCGCAGTT
AGAATTGGTAGACAGAAAGGAGACAGTTAACTCACTTGGGGGCTGGAAGGATTGGAATGA
GGTTTCACTGAAACCTTGTTTAAAATGACATCTGAATTATCTTAAAAGAAATGTCAGTTG
TTAGCCAGGTGAAGTTTGCAAGGAGGGAGAAAGGGCATTCCAGGCAGAGCACGCAGTGTG
AGGAGTACAAGGAGCAGTATCATAACAATATCTAACTTTATTGAGGGTATATTATGTACC
CCTCAGTTTGGCAAGAAGGTACTGTTATATCTCTAGTTCATAGATGGGAACACTTAGGTT
CAAAGATGTTGCATGACTTGCCTAAGGTCACAAAACAGTGGAACTATTAATAGAACTTGA
ACCCAGGTCTAGAGCCTGTGTTTTTAGCCACTCGTGTGCATGGGAAACTAAGCAGTTCTG
TATTATGAGAAGGTTACATTGGAGTAGGTTGTGCCACGCAGAGGTAGATGGGACCAGATT
CTGGAGTCCTTGTGAGAAGGCACATAGGGATTGAATTGGAAGAGTTAGAGTGACTGAGCG
AGCATATGAGTGGTGTGGCTTGAGGAAAGTGCTGGCAGTTTGGATATGGGAGAGGTGCTG
GTTAAGAATAAGCAAGAGGACTGAGGATGACATGCCCCTTTGAAGTTGGAGGCTATGGAT
TGAGTAGAATCAGTTTGCAGTGTTTTTTGAGTTTCTTTAGCAATAAGCCACAGACATTTC
TGTAGAGAGAGCAAAGTTACTTAGTGTGTGTAGTAGAAGGATTGAGTTACAAGGGAATTC
AGGATTTTGGTGATTTTAGTGCTAAATGGCTCCCTTTTATTAGATGTTGTCTTAGTCCAT
TTAGCTTGCCATAACAAAATATCTTAGACTGGATAATTTATAAATGTTAGACATTTATTT
CTAGCAGTTCTGGAGGCTGGGAAGTTTGAGATGAAGGTGCTGGCAGATTTCAGTGTCTGG
TTAGGGTCTGCTCTCTGTTCCATAGATGATGCCTTGGTGCTGAGTCCTCACATGGTGGAA
GGATCAGGGAGCTCCCTCAGACTCGTATAAAGGCGACTTAAAGTCTCATTGTCGCGCCCG
CCTCGCCAGCAAGGAAGACGTGGCAACTGGAGTTCTTCTGACCGTGCTTTAATGGGGTTC
CCTTTAGACTTACATGATGCGGAAGACGCTGAGCACAAGCTCTCACACACTTATATACTC
TAAGGAAGGAGGGAAGTGATGGGGATAGGTTAAAAGCGCGCGAGGGTTATTACTGATAGG
CCAAGCTAAGATCCTTCATATGCATACTTATAGAACGGGCCAGGACTTACTCTGCGCATG
CGCTGAACTTGTTTACTACAGGCGGGCCACCGGAAATCGGCGCCATCTTGTAATGGCGTT
GTCACCGCGCCCCACATCTCATGACTTAAAGTCTTCACCCCCTAAAAGGCCCCACCTCTT
AGTACTACCACACTGGTGACTAAGGCTCAGCATGTGAATTTTGGAGGAACACATAGCAGA
CAGTCCTTAGCTACTTTGACAGGTGTCTTGCTCTTCATCAAAAGCTATGTTTTGAGTGAT
TTCAACATTCCTTTTCCCCTCTGTCTCCCAATTCCAGTTCATACAAAGGAGGCTTCTCTC
TCCCTGAAGCATGGAAGAAATAAGTGAAATCTGATCTGTTCAAACCCATTTGTGCAAGTG
TTGAACAATGAAAAAAGGACTTAATTAGTAGGAGGACTTTAAGTGGTGTTTGAATGAAGT
AGAATTCTTGGTTTCTTCCATTCCTTGTATAAGTCCTGTTTTTCTAACAGTTGGTAATAA
ATTCTTTTTCTAGGAAGCAGATGTGGAAAAGCAAACTTTCCAAAGTAAGAAGATAATAGG
AAGATGAAAACATGAGCAAAGATGGGGGCTAATGGCTCCCACTTTGAGAAGAAGGTGGTA
CATAAGCCCACATACTTTTGTTGTGTCTAAAATAATTCATCAAAGAGCTTTGGTTCTTTC
AATATAAAGGCTAGTGCAAAGGACTGACTAGGCAGTGTATAGATGGAAAATGACCCATAT
TCTGTAAAGGACCAAATAGTATATATTTAGATTTTGTGGGCATTATGGTCTCTGTTACAA
TTACTCAGTGGTGTCGTTGTGGTGCATAAGCAGCCGTAAACATTTCTGTAACTGACTAAT
GAGTGTGCCTATTTTCCAGTAAAACTGTATTTTATAAAAATAGGCCACCGACCAGATTTG
GCCAGCAGGCAGTAGTTTGCTGACCCCTGAGCGGTAGGGCAGTGAAGCTGGGTGACACAG
ATTCCAAAGGAATAGGGAACTTTACTTTAGGGCAAAGGTGTAAAGGTAGGGACTACTTTG
GAGAGCTGCGAGAATGCTGGATTCTTCCATCACCTCACCCTTGTCCAGCCTTTTAATACT
TGAGCCATAGGGGAAATTCATCAGAGAGCCAAGCCTTCATTTTGGTGGAGCGGGGAGTAG
GATGTTTTGTGAGGAAGTTGAAAAGATGTAGGAAAGTTTGTTAAATGTGGGAAGGAGATT
CTAGAGAGCATAGTTGAAGAGAATAACATTTTATTTAATTGTTTGAATAAATTCTTCTGA
CAGTGAATGTTAAGTGTGTATAAATTTAGTCAAAATATCTTTGTAGTGATAGTGATTGGA
TTGTGGCTGGTCGGGTGGCTAACTCAACTGTTTAGAAAGTGGAAGTCATCTTGGTTTGTT
CCCCAGATTAGCTGGTTAGTTTTGTTTGACTTCTGCTCAAAGTATTCTAGCTAGCCATGT
CCAAAATTTATAATTATAAAGAGGTAAGTAAAGCAAGAAAGTGAACTGATTANNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACTAAAGAAACTCTCTGAAATAGCCTG
TCTTGTTTTCCATAGCACAATAACTGCTTGAAATTCTATGGCAGCAGGCACTGATCAGTG
GAGCAGAAGACGGACTCATCTGTGTCTGGGATGCAAAGAAATGGGAATGCCTCAAGTCAA
TTAAAGCTCACAAGTGAGTCTAGCTCCTTCCCATTGACATTGTCAATGTGCTCGTCAAGT
TGGGAGCTAACTGTTGGTTTCATTTTAGAGGACACGTGACCTTCCTTTCTATTCACCCAT
CTGGCAAGTTGGCCCTGTCTGTTGGTACAGATAAGACCTTAAGGTAAGTCATTAACACCC
AAAAGAATCTTTATTAAGGTGTATCTTTTGCTGCAATACTTAGATACTATTTCTGTATTG
TTTCACAGCTCTCAACCATTTAAAGATACTGTGATATAAGGCAAAGGTAGAAAGCTAGTC
AGACTTTTCATAATGGTAGGATAAAAGAGATAAGCTCTATATTCACACATGCACTTATAT
CACAGTCATTGTAAGCTGTCAAGTGAAGAGGAGGATGGTCCTCAAGAGAAATGTTTTAGG
AGGGGAAATCTTTTGAAAATACATTGGATACAACATATTAAAGGGGTATGGGAACAGAAG
GAGCTTTAATCCTGCTTGATAATAAATATTTCAAGGACAGGCGTGGTGCCTCATGCCTGT
AATCCTAGCACTGTGGGAGGCCAAGGCGGGAGGATTGCTTGAGCGCAGGAGTTCCAGACC
AGCTTGAGCAAGAGTGAGACTTTATCTCTACTAAAAATAGAAAATTTGGCCAGTGTCATC
TTGTACACCTGTCGTCCCAGCTACTTGGGAGGCTGAGGTAGGATAACTTGAGCCTAGGAG
TTTGATGTTGCAATGAGCTATGATGATGCCACTGTAGTCCACCTGGGGTCGCAGAGTGAG
ACTCTGTCTCAAAAATAAATAAATACATAATTCAAGATATTGCTACACAAAGGATGGCAG
TTTGTTTGAATAGCCCATATTTAGCAAAATTGTCATTTGAGTATGTCTTCATTATGCTTT
TTTACACTTAGTGAAAGTTAATTGATGATCATGCTATAAGCAAGCTTCCTGTTTTGCAGA
ACATGGAATCTTGTGGAAGGAAGATCAGCATTCATAAAAAATATAAAACAAAGTGAGTAT
TTTCGTTTAATTTGAAAATGCAAGACGCTCAAAAATCCGAAACTTCTTAAGCCACTATCA
TGACGCCACAAGTGGAAAATTACACACCTGACCTCATGTGATGAATCACAATCAAAACAC
AGTCAAGGCCGGGCGCGGTGGCTCACGCCTGTAATCCTAGCACTCTGGGAGGCCAAGGCG
GGCGGATTGCTCAAGGTCAGGAGTTCGAAACCAGCCTGAGCAAGACCCCGTCTCTACCAT
AAAAATAGAAAGAAATTAATTGGCCAACTAATGTATATAATATAAAAATCAGCCGGGCAT
GGTGGCGCATGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGGATCGCTTGAGC
CCAGGAGTTTGAGGTTGCTGTGAGCTAGGCTGACACCACGGCACTCACTCTAGCCTAGGC
AAGAAAGCAAGACTCTGTCTCAAAAAAAAAAAAAAAAAAAACCACACAGTCAAAACTTTG
TTTTTTGTACAAAACTATTAAAAATAGTGTGTAAAATTACCTTCAGACTATGTGTATATG
GTGTATATGAAACAAATGAATTTATTGTTTATACTTTTGGGACTTATCCTCCAGATATCT
CATTGTGTGTAGGCAAATGTTCCAAAATCTGAAAAAATCTGAAATCCAAAGTACTTTTGG
TCCCATGCATTTCAGATAAGGGATTTTTAACCTATATATTTTATAATTACTTGAATGTGA
ATGTATAGGTAAACATTTTTATTTGTGTGCATATACACATTTATTTCCCTGCATGATGGT
GGTTAACTCTGAGACCAAATGTTTTAGGTTACTTTTTTTCCATTTTAGATGTGGGTGGTG
TCGATACAACCTTTAATGATTTTTTGAACTCAGATTATTATCTAAAATGTAACTTAAATG
GCTTTTGTAATGTGTGCATAGTTTTCATCTATGTTTGCTAGCAGTATCCATGTTTTGCAT
TCAGATCTTGCTATCCACACAGTCATCATGCAGCCAAAGAGTAACTTGGGATCATAGTCC
TGGTCTAGTGTTGTCTTTTCTGACACATCTGCCACTGGCCAGCCTCCAAATTCCTACACA
TAAAACTCTAGGAATAGAGATGAGCTTGGAGGAATTTAGTGTAATGTATCTATAGTAACA
CACTGCATTTTTAAAAAAGGAAAAAAAAATGAAATGTAACTCATAAAATACGTATCATCA
TGTATTATAAAGATTGGATGTGAAAATGCAAAGTATATATATTTGCTATTTTTATTATTA
CTCTGGTCATTTTATGTTTTATTCATAATATAAATTTTGTTTTTTTAACTTCAGATGCTC
ACATAGTGGAATGGTCCCCAAGGGGAGAGAAATATATAGTTGTCATACTGAACAAAATAG
ACATCTATCAGCTTAATACTGCATCTATTAGTGGCACCATCACAAATGAAAAAAGAATTT
CTTCTGTTACATTTCTTTCAGTGAGTACTCGGAAATCAGTGATAGAACTTTATGGTGATG
GTTGAAATTGTTGATGACATTCTAGATATTATTACTCTTTCTCTCTCTCAGGATTCTGTC
CTTGCAGTGGCTGGAGATGAAGAAGCTGTAAGGTTTTTTGACTGTGATTCACTTGTATGT
CTCTCTGAATTTAAAGCCCATGAAAACAGGTATTTTTGCCAATCTCTGTGTATGTATATG
TAGAATCTTAATAAATGTGATATATGCGGTAGTTTCATAAATCAGAGTATATGTTTTTGT
GAACAACTGCAGAAATAATAAGACATATCTATAGGTACAGTATATGATATCTGGAGTCTA
AGAAGATGGTAGAAAATGTTACCTTCCTGGCCTTAGTAATGCAAAAGTGGTGAAATTGTG
ATTAGGACTAGTTCTTTGTATAGGATATTTATTTTTTAAATAAATCTGTTAGACTTGGGA
CCTGCAGTTAAGCATACTTGATCAAATAAAAGACTAAACAGTCTTGAGCTTTGTCCCTGG
CCACTCTTGTCCTTTTACTTCATTCCCCTTGCCCACTTCTTCCTCCTTTCCATGTAATGT
TTTTTGTTTCCTGCAGGAGAAATGAAATGATATTATTGAATTCCTGTTTTGTGCCATTCT
GTTACTGCATTTCTAGGGGGTAGATACTGAGTCTCAAGTAGTTAAGTAACTTGGCCTAGA
TCACCCCACTTTTAAGTCATGGAGCTGGATCCAACCCAGTTCTGTCTCTCTTATACTTAG
CTTTTCGTATATTTTGGAAAGGTGATCTGAAAGGTACAGTTATATTTTACATGTCACGTT
TGCATGTCTTATGTCTCACATAAGTCTTAGTTCCTTATTTTTCTAAATAATGGTTAAGTT
TTACAAAATCTGTTTTGTAAATACTCAAGAGTACCATAGTGGACAGCCTTAGCCTTACTT
TTGACCTGTATTAGGAAGTAAACACATTCTTCAAGGAAGGCTATTCCAGATGTACTGACA
AAACTTTGGCTATTTGGCCATTTATTCATGTATTTATTCAACAAGTATTTGTTGAGCATC
TGTTGTAAAAAAATTAATACTACAGTAGGTGTTTGATAATGAACAAAAAAGGCAAGAGCT
TGTGTTTACGTGGCTCTTATATTATAGTGAGGCAACAAAACAGTTTATAAACAAGCAGAT
CATTATAACAGGATGGAAATAGAAAAGAGAGAGCCGTAGGCACCGGGATCCTGAGGGAGG
AAATAGCTGGGTGTATTTTAGGGACAGATAGATGACCTATGTGACTAGATGAGGTGAGCA
AGGAAGAGGATGGTAGGGCCAAGTAGTGCATGGCCTTGTGGGAGTTTAGATTTTATACTA
GATTTTGTTTTCTTTTCTTCTTATTATTGAAAAATTTAAAAGTGGGTGAACCAGTTTAAA
GAGCCAACCTTTACAGACCCATCACCAGCTTCAGCACCTATCATTTTATGGCCAGTCTTA
CTTCATCTATATCCCCAGTGACTTCCTCTCCCATGTTATTTTAAAGCAGATCCCAGTTTC
ATAGGGTTTTAAGCCTAGAAGTAACATCATCTGATTTACATTTTTAAAAATTGTTAGGGG
ACAAAAATGGAAGCAGAAAGGCCAATTAGGCTACTTCCATGATCTGCAAGAAAAATGAAA
GCGGATCACACTAGGGGTAGTGGAACTGGAGGTGAGGGAAAGGATGCATGACATTGTTTC
TGTTGTCTTACTTTTCTCTTCTTACAGAACTTGGAGTTTCTTTAGGTGAAGGGCTATTTT
ATACATCTTTATTTCTGTTGTGATAAGCTTGATTATTTATAATTACTATTATCTATTCAG
CTTTTCCTTAAGATATGATTGACAGTCAATTTTATCTTGTATTGTGGCTCTGAAAATGAC
TCACAGGAATGTGAAGCAAAGTTGTATTTTGTGACATTAGCCATTGAGCATTTTGGAAGT
ACTTGAAGCTTCACAAAAGCAGAAGACTGCGTATAAGTTTTATAACAGTATTGCACTATT
TTGAAGAAAAGGTCTTTTATGGTGTTAATATTTCTATCCTAGGGTAAAAGACATTTTTCA
GTTTTGAAATTTCAGAGCATCATGTAATTGTTACAGCATCGAGTGATGGTTTCATCAAAA
TGTGGAAGCTTAAGCAGGATAAGGTCAGTGTGTTAGCACAGTATTGCTATCAGTATTACT
TTAAGTGAAGTAGAATTTTTTTAATGGGTCATAAGACATAGATATTTAAATCTTTTCCAG
GTATGATTTATGATTGATATTAATGGTTTTAAAGTTAGGGTTCCCACAGAGCTGCTTTTG
GAGTTGGCAGTTTTGAGTCTGAGCTGGGAGGATCCCAGAGCTTTCTCTCTGCTCTTTTAA
TCATAGAAGCTCTACTTCTCTTTTGTATATTGGGGTTCTCTGAAAGATGTTAGGTAAAAA
TGCTGCCATTGCTAAAAATAATTTAGATGCTTCTGATCAGTTATGGAACTAATGATAATT
TTGAGCCAGATAATTAAACAATTAAATTCCCTTTTGTTGGCCAGGCACAATGGCTCACGC
CTATAATCCTAACACTCTGGGAGGCCGAGGTGGGTGGATTGCTTGAGGCCAGGAGGTCAA
GACCAGCCTGAGCAAGAGCCAGACCCCATCTCTACAGAATATAAAAAAATAAAAAAATTA
GCTGGGCTTGGTAGCACACCCTGTGGTCCCAGCTACTCAGAAGGCTGAGGCAAGAGAATC
CCTTGAGCCCAGGAGTTTGAGGTTGCAGTGAGCTTTGATGAGGTCACTGCACTCTAGCCT
AAGCAACATAGTGAGATTCTGTCTCAAAGAAAAAAAAATACCCTTCTGTAGTCTCTTTAT
AGTCTCTGTTGGCTTATTATTCTTTATTCTCTCATAAGCATTCTGTGAATATGGTTTGTA
GAATGTTTATTCTGTGTAAGGTTCTTTGTTAAACAAAAGAAATGAATAAGACATGGTCCC
TTTCTTTAAAATTTTTAATTTCTTGATACTTCTCAGAAATTGGCTCTGTGAACAACATAG
TCAAACCAGCTATGAATCAAGATTATAGATTGCTTCTAAACATCATATTTTATACATAAG
AAAATACAATAAATTTTAAATTAAGGTGGCTTGATTATAGAAAAATAAATATTCAGAATT
CACATTATGAATTTTTCTTTCCTCTTTTAGAAAGTTCCCCCATCTCTACTCTGTGAAGTA
AACACTAATGCCAGGCTGACTTGTCTTGGAGTGTGGCTAGACAAAGTGCCAGACATGAAA
GCAAGCCTGCCTTCAGCTGCAGAGCCTTCTCCTGGTAATTGAAGTTGGTCATTTGGAAAA
TTTGAATAATCTGTTGTCTCTTAAATTGTTGAAGTGAAGGAGATCCAGATAACTTTATTG
TTAGCCTGTGTTTATTTCATTCAAAGGAGAAAAAATGGTCTTTAAATGCACTGTCTCTTG
GTGTTTTAGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1084, 3162..3323, 6436..6444, 6447..6470, 6473..6552, 6628..6702, 7499..7551, 8874..9019, 9111..9208, 11082..11092, 11094..11182, 12210..12333, 12489..12490
1001..1084, 3162..3323, 6436..6444, 6447..6470, 6473..6552, 6628..6702, 7499..7551, 8874..9019, 9111..9208, 11082..11092, 11094..11182, 12210..12333
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved