Microcebus_murinus Locus ENSMICG00000006915
snOPY snoRNA Orthological Gene Database
Microcebus_murinus ENSMICG00000006915
Microcebus_murinus
ENSMICG00000006915
GeneScaffold_493
SNORD105
2336..2419
6299
AGAGAGGGGAAACCTCATCAGTCACAGAGAGGGGCTGACAGAAGGCAGAGAGTCACAGA
GACAGAGGAGGGAGAGACCTGGGGAGACACAGGAGACGGAGAGACAGGAGAGGGAAGAAA
CGAGGAGACGGAGACGGCCGAGAAAGGCGGAAAGTTATAGGTGATGAAAGAGACGACCGG
TGACAGAGACAAAGCCTGCCCGAGGGAGACGAGACGGCAGACCATGGAAGGGGACACGGT
GGGGGGTGGGGGTAGACTGGGGCTGGGAAGAGAGCTGGGGGAGGGGAGGGAGAGGCTCAG
CCCAGGGAGGGGGTGTCCCTTCCCCCTGCTGCAAGGCTTTGGGGTAGAGGCCAGGGGCCT
GAGGCCAAGACTGTGGCTTTGAGCGGAAGAGGAGAGGGGGCGAATTATTCACGAAGCGCC
CGCCTTGCCCTGAGTTTCCAAAAGGTGATGTGGAGTTTCCATCCCTCAGTCTGTCCGCAG
ACGGGGTCCCTGAGGAGGACAGCTGGCCCTCAGGAGCTGGAGGACGGAAATGAATAACTG
TCACAGGGCCTATTTCCTGCTGTGGCTTCTCCCCAAGTGCCTGGCATCCGTGTGCCAAGC
ATCGTGCATACAGTCTCTTTCTTAATTGGCGGGCCCCGGGGACATGATCATCTCACTCTG
GGATACTTTCAGCGCCTCGGAGTGGAGAAAAGCGGTTATATGACAGCTGGAGAGGAAATA
GGCCTTGGCTGGATTCGAACACACAGATCGGTTTCTCCAAAGCTGGGAGCCGCATAGCCC
CGCCCCCGGTTTCCGTGGAAACAGGCATCCGGTGTCTCCATAGCAACCCTTCCAAAGATT
CCACCTCCACCCCCTGCTGTCGGAGGCAATCTGATGCGTAGGCCCGTTTGGTGACGTCAT
CGCACCGCGCCAGTCTCACGTGACACCTCCCAGGCGCCGGAAGTGAGTAGAACCGGGCCG
GAAGTGGCAGACAGAGGCGGCCTCGTGGAAGAGGCAGCAGCATGGGACAGTCCGGGCGGG
TGAGACGCGGCGGCCGGGGAGGCGGGGAGGGAGGACAGGGTCCCTGCGGAGGGCTCGGGG
CTCACCGCGCGTCTCTTGTCCCCGCAGTCCCGGCACCAGAAGCGCGCGCGCGCCCAGGCG
CAGCTCCGCAACCTCGAGGCCCTATGCCGCGCAGCCGCACTTCGTTCGTGTCCACGCGGG
GCTTGCCGGGGCAACAGCATCCGGCAGCTCAGCCTGAACTTGCGGCGGGTCATTGAAGCC
GCTCACTGGCCACGCGCCTTGCAGGTCGTGTAACCACGCACTCCGTCCTCCACCACGCCC
TGGGCCCCATTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCGGT
GCTGACCACCCGCTGTAAAGTCGTGAGAGGCCTCAGTCTCCCCAGCTGGAGAAAGGGACC
CTCGCGGACCATTGTCTCTGCCTCTCAAGGTTTTGTGGGGCTTAGTTGGTTGCCTGAGCC
TGACGGTTAAGACTGGTCTCTGAGACCGGGTGCGGTGGCTCACGCCTGTGTTCCTAGCAC
TCTGGGAGGCCCAGGCGGTAATGAGCACTGCTCGAGCTCAGGAGTTCCAGACCAGCCTGA
GCAAGAGTGAGACCTCATCTCTACTAAAAAGATAAAAATTAACCGGTGTCGTGGTGTGCC
CCTGTAGTCCCAGCTACTCCAGGAGTCTGAGGCAGGAGGATCACTTGATCCCAAGAGTTT
GAGGTTGCTGTTAGCTAGCCTGAAGCCACAGCACTCTATTCAGGGCAATGGAGTGAGACT
ATCTAAAAAAAAAAAAAAAAAAAGACTAGACTCTGCAGACAGCAAGATTGGAAACTTCAC
TCCTCCCAGAGGCCCTGGAGCAAGTTACTTAACCTCGCTGGGCCTCAATTTGCTCATCTG
TTAAATGGGGAGATGCACCTAAGCAAGGGGCAGTGGTGGTACTCAATTCAAGTCTGATTG
ATTGGCTCTAGGGACCAGGGTAATGTCACTCCCTTGGGCCTGTTGCAAGGGTCAGATGCA
AAATAGAGCATATAACAAGATCTTTGCCTTAAGCTTATAGCGTTTGCTCAATAAGGGATA
GCTACGTTTGTCCTTTTTCTTTTTGTAACTTTCAGATTCATAAGAAGAACTCACTGAAGG
ACTGTATAGCGGTGGCTGGACCTCTTGGGGTCACACACTTCTTGATCTTGAGCAAAACAG
AGACCAACGTCTACTTTGTAAGTGGACACCCTCACCCTTCATAGGCCCCTCAACTTTGCC
CATCTCTTATGATGAAACCGTTTGCCTCTGAGCTGCCATGATTTTGGCTTCAAAGTAAAC
GCTCTGAAGAAGAGTCAGGACGGAGGTTCTCACTCCTCAGCTCCCTAAGTAGACACCTCC
ACCCTCACTCATCCTTTGTTCTCTTGTAGAAGCTGATGCGGCTCCCAGGAGGCCCCACCT
TGACCTTCCAGGTTAACAAGGTGAGGGGTAGAGGTGGTAGGAGGGCCACATGGGGTGGGA
ACTGGGCTTGGAGGTGGCTCCAGTGCGTGTGGTGGGTGGTCACTCACTCCTCGCCCTGCC
CTGCAGTACACGCTAGTGCGAGATGTGGTTTCCTCCCTGCGCCGGCACCGCATGCACGAA
CAGCAGTTTGTCCACCCCCCGCTCCTGGTCCTCAACAGCTTCGGCCCCCATGGCATGCAC
GTGAAGCTCATGGCCACCATGTTCCAGAACCTGTTCCCCTCTATCAACGTGCATAAGGTA
GGCTGGGCTTGGCGAGATGGCAGGCGTAGGGTGGGGCAGTGCGTACCGCAGTCCCTTGGC
TTAAGAGCTCTTGCTCCGGGGTGCGCTGAGTGCTGAGGTCACATTGCCCTCGTGTTCAGT
GACGCTGAGCAAAAGTGTCCAGGGTTTTACTCCTAGCCCCATGAGCAGCCTTCTCATCTG
GCTGATGTGAAACGATGCCGATGATTTTTTTTAAGAGTCAAGTTCTGAGCCGGGCGCGGT
GGCTCACGCCTGTAATCCTAGCACTCTGGGAGGCTGAGGCAGGCGGATTGCTCAAGGTCA
GGAGTTCGAAACTAGCCTGAGCAAGAGCAAGACCCTGTCTCTACTATAAAAATAGAAAGA
AATTAATTGGCCAACTAATATATATAAAAAAAATTAGCCGGGCATGGTGGCGCATGCCTG
TAGTCCCAGCTACTCGGGAGGCTGAGGCAGCAGGATTGCTTGAGCCCAGGAATTTGAGGT
TGCTGTGAGCTAGGCTGACGCCACGGCACTCACTCTAGCCTGGGCAACAAGCGAGACTCT
GTCTAAAAAAAAAAAAAAAGAGTCAAGTTCTGGTCTCGTATTGTCTCCCAGACTGGAGTA
CAGTGGTATAATCACAGCTCACTGCAGCCTTATACTCCTGGGCTCAAGTGATCCTCCTGC
CTCAGCCTTCCGAGTAGCTGGGACTACAGGCATGTGACATAGCACACCTGGCCAGTCCTG
GATTTTTACATCTGTCTGGCTCCATAGCCCCAGCCCAAATCCCCTGCCACCATTGATGTT
CGAGTTGGGTTTATTATAAGGTGCCATCAGGAAGTCTGATGCGGGTGGCCTCAGTGGGGC
CGGCACCCCAGGCCACGCATGGACACCACTTGGCAGCCCTGTAACCCCTGCCTTCCCCCA
CACTTGCCCTGTCTGCCGGAGCATGCGGTGAGGCCTAGCAGCCCACGCCCTCTCCCTCTC
CCAGGTAAACCTGAACACTATCAAGCGCTGCCTTCTCATCAACTACAACCCTAAGTCCCA
GGAGCTGGACTTCCGCCATTAGTGAGTGTTCCAGGACGGAGGGGGTGCGGGGTGGGGGCT
TCCCAGTGCGGCTGATGACAGCACTTCCGCTGAGGCTCTGTGATTGCTCAGTCTCAAAGT
AAACGCCCTGACGCGCCCTGGAAGGGCAGGGGGCTGGAGCTGATCTCTGACCCCATGACC
CTAAGCGCCCCCCTCCCTGCCCATTCCTGCCCTGCAGTAGCATCAAAGTCGTTCCTGTGG
GCGCCAGTCGTGGCATGAAGAAGCTCCTCCAGGAGAAGTTCCCCAACATGAGTCGCCTAC
AGGACATCAGCGAGCTGCTGGCCACGTGAGGAGGGCATAGGACGGGAGGCCACCACAGTG
TTATCCAGGGCACCCTAGAGTTGTCCTGGAGCGTGGGATTCCCCTGCTGAGCCCCGTGTG
TCCCCAACACAGGGGCGCAGGGCTGTCAGAGAGCGAGGCGGAGCCCGACGGTGAGCACAA
CATCACCGAGCTACCCCAGGCGGTCGCGGGACGTGGCAACATGCAGGCCCAGCAGAGCGC
CGTGCGGCTCACGGAGGTGAAGCCTGGTGGCAGAGGTGACTTCCTCTGGCAGCCCCCAGC
CGCAAGGAAGGCTGACTGTTTCTTCTCCCACGTGTCTCCCAGATTGGTCCTCGGATGACG
CTGCAGCTCATCAAGATTCAGGACGGCATCGGGGAGGGCAAAGTCATGTTCCACAGCTTC
GGTGAGCTGGGGCTGGGTCACAGTGACGGGAAGGGTCGCAGGCGCCGGGTGCACTCGGTA
ACCACACTCTCTGCCCAGTGCACAAGACGGAGGAGGAGCTCCAGGCCATCCTGGCAGCCA
AGGAGCATAAGCTGCAGCTCAAGGCCCAGCGACAAGCCCAGCAGGCCGAGAACGTGCGGC
GCAAACAGGAGCAGCGCGAGGCCCACAGGTCTGGGTGGCGGGCAGTGGGCGGGCAGGGTC
CCCGGGTGCAGGCGGCCACACGGATGGACTGACTGACGCTGCCCGCAGGAAGAAGAGCCT
GGAGGGCATGAGGAAGAAACGGGCCAAGGCCGAGGGAGACAGTGATGCCGAGGACCCTGG
GCTCCCCCTGGAGGACAGCCAGTGGGAGGAGGAGGAGGATGAAGCTGAGTATTTCCGCCA
GGCCGTGGGCGAGGAGCCCGATGAGGGTGCGTGGCGGGGTCTGGGGCTGGGCGCCCAGGG
TCCGTGCTTGTTTCCTGGGGGCCCTGACAACATGGTCTCTCCCCGCAGACATGTTCCCCA
CGGTGCCCAAGCGGAGACGGCCCACCTGGCCTTCGGTCAGGCTGCATCGGGGAAGGGACC
GAGGCAAGGGCCGCCACAGTGACCGGAGACTTACACACCCCAAGGACAGGTTTCAGGGAG
CCCAGACCAAGCTGGGGTCCAGAGGGGCTGCCCGGGGTCGCCGGCGAGGCCAGCCACGGC
CACCTAAGAGAGTGGCCTGAGCCGAGCCGCGGACAGAATGCCCCAGATTGGGGTCCGAGA
GACCCGGCCCTGGGGCTCCAGGTGCGGCCTCGGTTTCCTTTCATAAAGGAGCTGTTCCCC
CCCTCCCACCGCAATAAACGCCCGACCCGGCCTTGTGTCTGTGTCTGCTTCCGGGAAGGG
GTCCACCCAGAGCGCCCCGGGCCGCGGCACCCAGCAGTCTGCCCTGGTTTCTGCCCTGAG
GCGGGGTGGTCTCACTGCGGCACAGCAGGCAGGGCTGGCGCCATTTGGCAGTCCTGGGCC
TGTCCCCAGCAAGGGCCCTGTTAACCTGTGTGACTGGGAGGCTGAGGTGTCTGAGGAAGA
AGGAAGCGGCGAGGTTGCAGCTGCGGCCAGCCAGGGAGGGGCCAGCCACGCTGAGTGCTA
CCTGGGGAGGGGCCTGGGCACTGCGTGGGTGGCAGCCCCAGAGGCTGGGCGTGTGCGAAG
CATGGCGGCCACCATCTTGGGTAAGGAGTCGGTGATGGGTCGGTTAAGGAACAGCCACTG
GTTTTCAGGAAGTTCGGAAGGGAGTTGGGTTAAAACCCAGGTCTGGGCCCAGCAGTCCGG
GTGGGGCAGGGGTGTCCCGGCTTGCGCGGCAGGGAGTGGGTGCCAGGGAGGAGGGAGCTG
GCCCAGTGCTGCTGGGCCCTGCCGTGGGCAGGAAGGGGACCCTCCTCTGCTGAAGGGTGT
GTTCTCGGGTCACTCGGAGCTGGCAGGCTGTGGAAGAAAGCTTGGCAGGGAGGCAGGCCT
GAGGGTGCACTGTCAATGTCGGGGTGGCCGGGGCAGGACCTCGGGATGGCCCGGAGACAT
GGAGAAGTGGGAAGGGAACCTTCAGGAGGTCTGGTGGGTGACTCAGGCAGAAGGAACAGC
CCCTGCGATGGGCCCTTAGGGAGCTGGAGTGGCGAGGCTGTAGGGAGTGAGTCAGGGAGC
GCAGGAGGAGGTGGCAGCGTGTGGGGTGGGGCCCCAGGGGTGGCCCTGTAGGATGAGTGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1018, 1107..1160, 1162..1180, 1182..1202, 1204..1252, 1254..1267, 1269..1278, 1280..1283, 2195..2296, 2489..2539, 2646..2816, 3784..3860, 4057..4164, 4272..4395, 4482..4560, 4638..4767, 4848..4922, 4924..4942, 4945..5005, 5088..5131, 5134..5136, 5141..5269, 5271..5282, 5285..5299
1001..1018, 1107..1160, 1162..1180, 1182..1202, 1204..1252, 1254..1267, 1269..1278, 1280..1283, 2195..2296, 2489..2539, 2646..2816, 3784..3860, 4057..4164, 4272..4395, 4482..4560, 4638..4767, 4848..4922, 4924..4942, 4945..5005, 5088..5131, 5134..5136, 5141..5269, 5271..5282, 5285..5296
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved