Microcebus_murinus Locus MTMR4
snOPY snoRNA Orthological Gene Database
Microcebus_murinus MTMR4
Microcebus_murinus
MTMR4
GeneScaffold_1482
SNORA18
14766..14907
24342
TCCCGCCTTCCCTCCCTCCCTTTTCCTAGGGCTGCGTGCCAGTGGGCGGTGAGGCAGCA
CCTCTGGCTTGCCTATTGCGGGCTCTCCCATGAGGGAGGGTGGTCTGGGAAGAAAGTNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCACTGCTCCTGAGCATAGCAG
GCATGAAGAAATGTGTGAGTGAAACCTGGGCCTGGCTCCCTAAGTGGGCCTAGAAGGCTG
CATCCTGAAATCCGTTACTTGGGTTCATTTGACATGCTGACTCCAAGGCCTAGGCTGGCC
TGATTCTGTTCCTGTTTTGTGGCCTCCTCCTCATAACCTCCGCCCCACTTGGTGTCAAGT
ACACTTAGCAGGACCTGTCCAGCCCTGCTGCCCTCTGATCACAGGTTGTGCTCCCCTCCC
TCTTGTCCTCTGGACTCTGCCCCTAGTAAACATGTCAGGTGGGTGTTACTCCCAGACTCA
GAGACTGGCAGAGCGTTCCTGTGGATTCAGGCCCTTACCAGGGCCAAAAATGAGTCCTAG
TTGGGCAGCCTTTGTCTCTTCAGAGTTGGCAGTTCTTTCCCACAAAGAACAGGGTTTGGA
GTGTTCTACTCCCGAGTCTGGGAATCAGGACTCTTGAGTTCTGCTGAATGCGCTCAGATG
ACACTCATTTCTGCTTTAGAACTTTGTGGCTGATTTCATGCCCTGCAGGATCACTTGTTG
CTTTCTCCACACATAGCTCCCATTGCCTCTCTCTGGCACGGTGAGTTGTCGAAGACTTGT
GGAGAGACTGTGAGGGAGGAGAATAAGAGTTGTAGAGAAGTTGACGGGTAGATGTGTAGC
ATTTGCTGATTTCATGGTGATGTTAATGGTGTCCTGAACTCTTATGTTCCTCTGACTCCT
TATAGAGAGAAGCAGGCAGCCAGGACCCTCACCACGGTAGAATGGTGAGTACTCTTTCTT
TCCTAGACCATTGTGTTTTCCTGTAATCTTTGTGTCTTTCTCAGTGAAGCTGCCCTACCT
CTCGTAGACCTGAAGTTTCAGGCTACTCTCTTCAGCTCCTAAACTGGTTCATCTGCCCAG
AGATAAATTAGGGTTTCTTTAGATTGCAAAACATTAGCCGGTATACAGCGCTGGGAGCCT
CCAGAAGCCTCTAGAAGTCTTTTTCTGTACGTACTATGCCACGCCTTCCCTACACTACCT
ACACACCACTGCCTCTCCTAGCCCTTCCTACAGCAATCCTCTTGCTTTTTGGAGTGCGGG
GGTGTGGGCTGTCTTTGCAAGAATTTCTGTGATCTGGACCGAAAAGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGGTTTTTTCCACTACCAAGGAGTTGCTTGTTTGT
TAAGCCAATGCAGGCAGCAGCTGACTGAATATCTAGCAGAATAGAATCTTCAAGATCCCC
AGAATATCACTAGAGGTGGTTTATAATGATTCTGTAAATTTTCCATTAACTGTAACTGTC
ATGTTCTCACCCCAAGTTCATGGAACCCTTTAACTCTTAAGAGCTAGGAGGAGGAAGCAG
TCAGATGAGAAAGGAGTAGAGAGATGTAGGCCCTGGCCTGGCCTGGGCCCTTAACCTGGC
TGCATCTCTTCAGTTTCTTTCCAGTGTCCCCTATGGTTAGGGACAGGTTAAAGATTTCCT
CCCTTTCTTCCACAGACATCTGGATCTATGGTGTGTGCTATATTGGTTCATTCTCTTGTC
AGCCTGTTGGTCTTGGCCCCCACCAACTGAGAGCGCCTCCCTTTTTCTCTTCTGGGACAT
CCTGAAAAGAGCATGGGCTTCATAGTCAGCTTTATCTAATTTCAAATGCTAGCACCACCA
CTTAAATACCACCACTTAGGTAAATTACATACCTTCTCTCTTAGCCTGATTCTCACCACT
AAAACAAGACAAGGCTTACTTCTTGGGGATTGAAAGGTTTTGGTGAAGTGACATTTGAAA
CTACCTGGCTCATTGTAGATGCTTAATAAAAAGTCAGGTTTTCTCTCATTCTTCCCCTCC
CCTCAAACAAAACAAAAGCCCTGGTTTCTTAAAGTTAATAAGCACAAGAAGTTTGGGGTT
CCAGTCAGCTTTTTCTGTGACTCTTGGTGACATTTTGAACCCCTTATCTCTACTCCTTAT
TCCTTGGCCCTCTATACAACTCCCCCCACTCCCCTACCCCTGGGTTTCAAGTTTTGTTTT
TGTATAGCTTCTGTGATCCATACTTCCAGCTCTTTCCTTTCCCAGACTAAGACATTCTTT
CTCCTCCAAAAAGGATTTATTACGCAGACATCAGAGAATGTTTAAAAAAAAAAAAGAGAG
ATGGAGCTGAAGGAGTTGGGTTGGGCAGAGGTTTTGGAATAAAAAACTCAAGAGGGTTTC
CCTTTTAGCAGTGAGTAAAGACTAACCTGGAACCAGGCCAGTGTCCATTCTAAGGGGCAA
AAAGGGTTTCGTGAAGTCACGGGAGTGAAGGACACTGATGGGCAGGGGTATGGTAGGTGG
TGGTTTTGGAGGGAAAAGAGGAAGCGCTGAAACTGGAAAGGGCATGAAGTGGAGGTTAGG
TGATCTCCATCTTGGAATGCAGAGTAAACGTTGGGGGAACTCAGAGAGGAAGAGAGGGCA
TGGGGATGGTTGTGTGACAAGACGGGTGTGGGGTGGCTCACCTGGGAAGAAGGGAAATGA
AAAGATGTAGGCGGTCTTGCCTTCTGCTCCCATGCGCTGTGAGGGCGGTCCCGCAGCCCA
GACTCACGAAAGCCCCTAGATGTCCCAGGGGATGCGGGGAGGGAGGAGCCTGGGTCTGTG
GGCGGGGCCCGCGGAGCTGCCCCGCCCCTGCCTCCGCCTTCCCGCCGCGGCCCGGGGCTC
TCCCCTGGCCTGGGTCCCCTCCCTTCCGCGCTCGTGCCGAAGGGCGGAGCTGGGCCCGCT
CCATTGTGGAGAGGAGGGGAGAGGCGCGCGGGAGCCGCGCCGAGGCCCCGCCACCAGCGC
TCTCGACTCCTGGCCGCCGCAGCTGCACCTGGCGGGCCCCGCAGCCGGGATGCGGCGGGC
GCCCGGTGCTGGCGGGCAGCGCAGCGGCTCCGGGGACATGTGCGCTGGCCCAGACCGCCT
GCGACCATGAGCCTGACCGCCCGCGTCTCCTGCTCCGTGCTTAGCTGCTTCGTAAGTGCC
AGCCCTGTCTGTGGGGAGCCTGGGGGCCCAACGCTTGCTGCACCCGCAGTGGCGCCCTGG
GCCAGCCCTCGAGACACCAAATTTCGGCCCATCCCCCTCCCCAAGGCCCCCGGCCCGGCC
TTGGGGAGGGGGCTAACCCTTTAGTTGCTTGGACTTGCTTCAGTCTTCGGGTGTCGGGGA
TTGTCGACGGCCAGAGATAGAAATTCTGTAGCCCATCCTGGCCCCGCAGCGACCGCCCTT
GACTGCAGATCTCCAGGCCCCGCCCTGCAGGGGTACATCACTTTACCTCCTCCTCTCCAT
CTTGGTCCCACCCGCTGCATCCTTGCTTGGGGATGTGGCTAATAAGCTGTATGGGATGTT
AGGGGGCTGGTCGGGGATCACCGGCTGTGAACTGTCTCCGGGGCTCCATCCCTCACCTGA
CATGCCAGTCTTTTCTCCTTGACTGTCCCCCAGACAGCCTCTTTTCTCCATCTTCCCTGA
GCCTGCGGGGCTCCGTACCTCTGCATTATTCCTGCTCCTCCCCTCCTCCCCCCTGGCTAA
TGCTGCTTCCCAGCTTCCCCCATCTGTCCTCTCAGATGTCCCCCGCCCGCCCCGTGGGTG
TCTGCCAGTCCTTCTCTCTCTCTCTCTGTCTCCCCTGGCTGTCCTTGGGTCTCCTGGTTC
CTCACAGGCGTGGATCCCCTTTTCTCTCCTCCCTGGTGGTTGGGAGGGGAGTTACTTCTG
CTTGCCGAGGGTATTCCTCAGGAATTTCCCTCAGATCAGCAGGCCAGCAGGGTGCTTGGC
AGGTAGTGGGGGCTTGTCAACAGCCTGAGCCTAACAGGAAGATAAGCCCTGCTCCAAAAC
ACATCCTCCTTTTGAAGCATCTTTGAAGGCCCTCTAGAGGCATGGGACTGAATCCCCCCA
CCCACTCCTCTTTGTCTCCTTCACCCTCCTGATTGAAGCTTCAGTGACTGCAGGTGCTGG
ATTTCCCTCCTTTCTCCATAACCAGCTGCCACACCTGGTGCTCTGACTCCTTTTCCTCAG
GACAGCACTTTCTCATCTCCACTCCTGTCTTACCCTTACATTAGTCTTTCTTTCCCTTAG
TTTCCTCTTTTCTTACATCTTTGAAATTTTGGTTCTATAGGAGAGTACCTCTTTGAAGAG
TGCAAAGTCCCAGTTCCTCCTTGGCCCTCTCTCTTCCCTTAGGCTTAATAGGCTTGAGAA
ATCCCCACATTTCACCCTTCCCTGTCTCCAGCCACATCAAGTCTCTTTTCCCTTTTCTGA
TGACCAGAACCTTTACAAGTATATGTCGGGTTTGAGACCAACCTGGGCAATGTAGCAAGA
CCCTGTCTCTAAAAAAAAAAAAAAAAAGTTAGCTAGGCCTGGTGGTGCATGTCTAGTCCC
AGCTACTCAGGAGGCCAAGGCATGGGGATCACTTGAGCCCAGGAGTTTGATGCTGCAGTG
AGCTATGAGCTGTTGCACCATGGCACTCCAGCCTGGGTGATAGAGTGAGACCCTGTCTCT
AAAAAAAAAAAAAAAAGTATATGTGGGGTGTCTTTGTGGATTTGTTGGTGGGGGAGGGGA
GCAGAATTAGCCTGGTGGGTCAAGTGGAGCCTGGTGACTTAGGACTGCGGCCTTTCTACA
GGGTGAGGAGGGGCCCCCCAGCCTGGAGTACATCCAAGCCAAGGATCTGTTCCCCCCCAA
GGAACTAGTGAAGGAGGAGGAGAATCTTCAGGTAAGGAGGAATTGGGGTCCAGGGTGGGT
GAGGCTCCCTGCCCAGTTAAAAAACACCCCCCCCCCCCCAAATCATCAAGGGAATCTAGC
ACTGGAGCTCTGCCTTCCTGCTCTCTGGTCTCTAGAGGGAGAGGAGGGTCTGTCTGTATG
TGCATAATGGAGCATTTGGCCCCAGGGAAATAAAGGCAGTTTTCCTATACAGCTGTTGCC
TGGTGCCCATACCGTGGAGAGGATTCTCCTTTCCTCCCTGGGTCCACCTTTCCCAGAGGG
CATCCCACAGAGCAGGGGCTGTGGAGGGGAAAGAGGAGGTGATTTACTTCTGGACTGAGG
GTTCCTCTGCCCCTTGGCAGGTACCCTTCACAGTACTGCAGGGTGAGGGAGTGGAGTTCC
TGGGCCGGGCAGCTGATGCTCTCATTGCCATCTCTAACTACCGGCTGCATATCAAATTCA
AGGACTCGGTCATCAACGTGAGTTTCTGTGTTGTTCTCCCATACCTAAGCCAGAATCCCT
GTGAGGTTTAAGGTGGGATTGTTCCAGTGTGCCCTCTGATCACATCTCCAAAAAAGATAT
TCCCTTCTCTTTCTCCCTAGCCTTGTATTTTTCCGCCTCATTCTTGCAAGTACAGGTCTG
TCTTTCTGTTTCTGGCTCATTGTCCCTTGCCCTCTTCTCTCTTCCCATTACTCTGTTGCT
GGCCCTTCTAAGGGGCACAGTGGCATTGTTGGAAGAGTGCAGGCTTTGGAGTCAGGCAAA
CTCCCTGGGCTCTTTTACTGTACTGCCACTCACCAGCTATGTGACCTTGGTTAAGTCACC
TGAGGCTTGATTTTTTTTCTCTTTAGTAATATGGGGTGAAAGCACCTGGTTTGCAGGGTC
ATTGTGATTACTAATTGGGGTCACATGTGGAGGTCCCAGCACAGTTACCAGGCACTTAAT
AGGCTCTCAGTAAATGCTGGTTTCCTTCTTGCTATTGATACATTAGCACTTAAGCTAGGG
TGGGGATTAGGGCTGGTGTCAAATGGGGGGGGGGGCAGGGTCTGAGCTTCAGTTTGCCCT
TCCTCTGAAGGTCCCCCTCCGGATGATTGACAGTGTGGAGAGCCGTGATATGTTCCAGTT
GCACATTGCCTGCAAGGACTCCAAAGTGGTGAGGTGAGAACTACATGGCCTCACTCAGGC
CCCCTGACCCTGGTCTTGTCCAGACCTGTCTGCTGCAGGGTCTGTCTGCACAAAGAGGGG
AAAGGATACTGCCTCACTTCCAGCCAATTACTGACCCATAATATCTTAACCTGAAAAAAA
TGGGTATAATGCTTAGTTCATGGAGTCATCATAAGGATTAAATGTAATGCATATGAAAGC
ACTTAGGATAATATCTGGCATAGGGCACTCACATCATTGTTGGTTCATTTATTTAATCAT
TTAACATATATTTATTGAATACTCTACTCTATGCCAGACTGTTTTAAGCACTGGGGATAC
AGCAGGGAACAATATACAAAATTTTCTGCCCTCATGGAGCTTATATTCCAATGGAGGGAA
ACCAACAGGAAATAATAAGTATGCTAAATGATAAGTGTAAAGGAAAAACATAGGGCGAGG
GGATATGGAGCACTATGGAAGTTAATATTGTAAAACAAAATGATCAGAGAAGCTGCACTG
AAAAGGTATCATTTGAGTCAAGACCTAAAGAAAGTGACCTTGTGGATATTTGGGGGAAGA
GTGCCAGACAGAGAGAACAGAAAGTGTCAGAGCCTTGAGGTTGAGGTGTACCTGTGCCTA
GAGATTGGAAGAATGGCAAGGAGGCTGGTGTGGCTGGAGTGAGTGCACATGGGTAAGGGT
CGTGGGTAAGATCTGAGAGCAAAGCGGGTGTCAGACTGTTTGGCTGTCATAATAACTCAC
TTTTACTTTGAGGGAAATGAGAAACCACTGGAGGATTTTTTGCAAAGGAATGACATGATC
TGCTTGATGTTTTGTAGAATTACTCTTGCTGCTCTATTGAGAACAGATGGAAGAGAATGG
GAGCAAGAGCAAAGGCAGATGATGGAGACTAGTTAGGAAGCTATTACAGTTGCCCAGGGG
AGAGATCGTGCTGGCTTACCTAGGTAGCAGTTGAAATGGTGAGAAGTGGTCAATTCTGGG
TATATTTTGAAGGTAGAGATGAGATTTACTGACACCCTGGATATGAGAGAAAGAGAAATC
TGGGATGAATCCAAGGATTATTAAAAGGATGCCCAGTTTAGAGCCTACCATGTGCTAAGG
TCTGTGGAGGATTCAGAAGAAGAATCCATATTGCCTTTCCCTTCAAGGAGGCTAAAGTCT
AGTTGCTGAATGAAGACTTAACATGTGGCAGTGTGCTGTGGAAAAATTTGTTGTTTAATA
CTCGAAGCATATTAAGAATCAATGTGTCAGGCTAGGCACAGTGGCTCATGCCAAGGCAGG
AAGATTGCTTGAGGTCAGGAGTTTTAAGACCAGCCTGAACAAGAGCAAGACACCATCTCT
ACAACAAATAAAAAAATTAGCGAAGTGTGGTGGTGTGTGCCTGTCGTCCCAGCTACTAGG
GAGGCTGAGGCAGGAGGATCGCTCAAGCTCAGGAGTTTGAGGCTGCAGTGAGCTATGATC
ACACAACTGCACTCTAGCCCGGGTGACAGAGCGAGACCCTGTCTCAAAAACAAAACAAAA
AAGAGTCAATGTGTCTGTGGAATGGAGTAGGCTGAGAAGGCTTCAAGGAAGAGATTGGAC
TGAAACTGTCTTCAAAGTATTAGTAGGATGTGGCTAGGCAGAGAGGAGACATTAGCAAAC
GGAAAAGGAAAACAAGGAGATAGGAATGACATAAGCAGGACTTCGGGCCTGAAGCGGAAG
GTCTGTGTTAGGGAATCATAGGAGATAACTCTGGTCCGGCAGGGTAAGGACGAGTGTAGA
CATTCAGGCCATGTGGCAGCATTTAGATTTGATATGAGAAATGAAGGCCTCATTAGAGGG
GATAAGTATATCTCAAACACAGGGCTTCTTAGGAAGAGAATTATTACAAGAGACAACTTC
TCTTGGGTGTTGGCCAGTGCCCCTGGTCCCCCTCAGGATCCCCATTGCCTTACCTCCTGC
TTTGCAGCCTCCTCGCCTCACAGCCTTCCCATGGCCATGTTTTTGACCCTTATGGCCCCA
TGGCCACCTGTCCCTTGCCTCACCCAGGCCTGTGGCTTCTTGCCTGGCAGGTGTCACTTC
TCCACTTTCAAGCAGTGCCAAGAGTGGCTCTCACGGCTAAGCCGGGCCACAGCAAGACCT
GCCAAGCCTGAGGACCTCTTTGCCTTTGCCTACCATGCCTGGTGCCTGGGGCTGACCGAG
GAGGACCAGCATACCCACCTGTGTCAGCCAGGTGAGGCCAGGCTATTTTCTCTGGGAGGC
TGCTTATCCCTTGGTTCTCATCCATCTTCCACCCCCTGACATTGGTGCTCTGGGAGGCTA
ATGGTCACGGTCACGGGGCCTCTGTTGCAGGAGAGCACATACGATGTCGGCAGGAGGCGG
AGCTCACGAGGATGGGCTTTGACCTGCAGAATGTCTGGAGAGTCTCGCATATCAACAGCA
ACTACAAGTGAGAGGGCAGGGGGTGGGGGACCAAAACACCAATCCAGACCCAAACCTCTT
CCACATTTGCCTAAGCGTGGTGGGCACAGCTCCTGGGTCTCTTCCTGGTTCCTGTCCACC
CCCTGGGGTCTTGCTGTCACATGTCTTAGACTCAGTCCGGTGACCCCATCTGGTCTCTTC
TCAGATTGTGCCCCAGTTACCCCCAGAAGCTGCTGGTTCCTGTGTGGATCACAGATAAAG
AGCTGGAGAATGTGGCTTCCTTTCGTTCCTGGAAGCGGATCCCCGTGGTTGTGTATAGGT
GAGGGGGCAGTGGCAAGCAGGCAGGCTATGTTTTATGCAGTAAGAGTCAAAATCAGAGGT
TTTCAGCAGCCTGGTTGAGCGGGAATTGACACCCGGTAGGGAAGTGACTGAAATATTAAA
ACAAAAGGTGCCTTAGTTCTCTCAACTAAGGATAAGGTTTTTGGAGTGTTTCTTCACTTT
CCCTTTTTTCGGGTATGTGTGTGTGCACGTGTAAAACATTGCATTAGTACAGGGGTTGGC
AAACTGGTATGCAGACCAAATCTGACCTATAGCCTATGAGCTATGAATGGCTTTTACATT
TTAGAAAGGTTACTTAAAAAACAAAAACAAACAAAAAAGAAGAATACACAACAGAAACTG
GTTGTGACCTACAAGGCTGAAAATTTATTGTTTGGTTCTTCACTGAAAATGTCTGCTGAC
CCCTGCACAAGAACATTATAGCTAAAATAGAGTGAGACAGGTAGTAACCCTGAGGTTTGG
AATTTTTCATGTTCTTGGCTCTGGCCTCATTTGCCTGCTGGGTGTCTGTACCTGGAGCAG
GTGCTGTGCAGATTTGATGAGTCAAGGTCACCTTGGGAATACAGAGTCCATTTGAGAAAA
TGTGTGTGGTAGCACTTTGTATACTGTAAAGTCCTCTAGAGGTGTTGAGGCTTTTGGTTG
CTATTATCATGGCCTGGACGAATTGGTAGCCCCTGCTGGTTCTGGAGACTTTGGTCTGGC
CCCCTGAGGGCAGGCCTCTGGAGTCTTCAAAATGCCAAGGGCATTTTGGTTTCTTCTGTT
TTGTCAGACACTTGCGCAATGGGGCAGCCATTGCCCGCTGCAGCCAGCCTGAGATCAGCT
GGTGGGGCTGGCGCAATGCTGATGATGAGTACCTGGTCACGTCCATTGCTAAAGCCTGTG
CCCTGGACCCGGGGACAAGGGCCACTGGGAGCTCCCTCGGCACTGGGAATAATGATACCA
GCGAGGCGTGTGACACTGACTTCGGTAAGGTGTGGGTGGTGCTAGCCCCCCAGGGAGCAG
GCCCCCTCCCTGGCCTCATTGGCTCCCAGGGAGTCCTCAGTGAGAGGATGGGAAGAAGGT
GCCAACACACAGGGTGTCTGGGTCCCCACCTTTTGGGAAGCTGTGGGGTGTGAGGGGTCT
CCAGTGGCATGTTCCTCTGTTCTGAGAGGGAGGTCCACAGGGTCAGGGTGAGGCTGGGGG
GCCTACTGACCCAGGGTCTTCTCTGACTGTGTAGATTCCTCTCTGACTGCATGCTCTGGG
GTGGAGAGCACAGCGGCCCCCCAGAAGCTGCTGATCCTGGATGCGCGATCCTACACGGCA
GCAGTGGCCAACCGGGCCAAGGGTGGAGGTTGTGAGTGTGAAGGTATTACTGCTGCTCCA
CTGTCTGTAGCCAGCCTATGCTCTGGGTGGTTTTGGTGAGAAGTGGGTTGGGAGCAGCTT
GTGTAGTGGAAAGAACCAAACAAACCTGGCTTGGAATCAGGATATTGCCACTTACTAGCT
ATGACTGTGCTTAAGTTACTTAATCAGTCTAAGCTTTATTTACTCATCTGTAAAATGGAG
ATGATAGATACCTTGCAAAGTTGTTGGGATGATTAGAGGTTGCACATATAGAATTATTGG
CACAGAGCAGCTACTCTTTATTGAGAATTTATTATATATTACCATTCTTAGTACTACTAT
CATCTGTGGTTAGTATTATTACTACTACTACTATTATATGGCACCTGAGTATTCAGAGGT
CAAAGTGTGATTCAGATTTCAAGATTATATTTAGTACCCGTCCTGTAGTGTGCTGCCCTG
CCAGGGAAGCTTTGTCTATTAGGACCACTCTTGTCCTGGATGTCTGTTTCCAGGACGTGG
TCTTATGTTCTGCTGTCTTCTCATGTCTATAGAGTACTATCCCAACTGTGAGGTCGTGTT
TATGGGAATGGCGAACATTCATGCCATCCGGAATAGCTTCCAGTACCTCCGGGCTGTGTG
TAGCCAGATGCCAGATCCCAGCAAGTAAGTGTTTGCTGCTCTGATTCTGTCATCCTCCCA
CCTCATCCCTCCCCAGTACTTCTCATCCTTCAAAGATTAGGTGGGGAGATGAGAAGTATA
GAGATCTCAAAGACCTGAGGGCCCGGGTGGAGTTGGGTGCAGTGGACCAGTTCCAAGAAC
ACTTCTTCCACTTCTCAGCCAACGCTTTGGCACAGTCACAGGACACTGGATTCCTTTTGT
TTGGATCATTTGTCCTACTCAAAGAACGCGGAGAACTGGGGAGAGAAACTGGCTACATGT
GCATGTGACACTTCCCAGTTCCTCTCTCTATCCTAAGAAGCTCTTATCTTCNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCCGGTGCC
CAGAGCCAGGAGTTCTCTGGCCGCTCTTTGGACAGGTAAGAGAAGCCATTCTTGTTCTCT
CCCCCTCTGCTACGAAGGCAATAATAACTGTTTCCTATCTTGCCTCAATGTCGTTCTCTT
TCTCTTATGAGATATTTAAAAGCAACTTCTTGAATCAGTTGAAGGAGAAACTTGGCTCAA
GACTTGTAGCTAGCCTGGGGCTCACTCTGTGTATTTTCAAGGTTTTCTCTTAAGATAAGA
TTGGATACTTGCTTTCTTGGAACTGCTATCACCCTGTGTGACACACCCATGCAGGGGAGC
GGAGAACAAATAGAAAGGACTATTTTAGGAAGGTTTATGGGAATGGTCTTGATTTTTGTT
CACTGATACATGGCATGATGAACTGGCTGTCTTGGTAGCAACCTTTGCTATGTCCAGCAA
TTGCCTCCAGAAGCATCTGACTCTCAGGGAAGTGGGTTCCCAGCAGGAGGATAGCCTTTA
CATTACTCTCTCAGAAAAAGGCCAGAATTTAAAGGGAGACATAAAGTTATCTTCTGACTG
AGTATTTTGCAGGGGAGTAGGATGAGGGTTGGTTAAATTATTAGGGTAATTCATGTTCTT
TATTTTTTAAAAAGCTAATATAAAAGTATAAAATGTAAATCTTCCCTTATCATCCTTGTC
CATGGTTAACACTTTGGTGTGTGTCTTTTCAGATGTTTATCTGTATAGATATAGCCACAC
TCTCACACACTTACACAGAAACATTTTTGGTGAATAAAACTGGAATTTTTTGCATGCTTT
TTTTTTTTTTTGAGACAGAGTCTCATTTTGTTGCCCAGGCTAGAGTGAGTGCCGTGGCGT
CAGCCTAGTTCACAGCAACCTCAAACTCCTGGGCTCAAGCAATCCTGCTGCCTCAGCCTC
CCAAGTAGCTGGGACTACTACAGGCATGTGACACCATGCCCGGCTAATTTATATATATAT
ATATATATATATATTAGTTGGCCAATTAATTTCTTTCTATTTATAGTAGAGACAGGGTCT
CGCTCTTGGTCAGGTTGGTTTCGAACTCCTGAGCTCAAACGATCCATCTGCCTCAGCCTC
CCAGAGAGCTAGGATTACAGGCATGAGCCACCACGCCCGGCCTTTTTGCATACTTTTAAA
TTTTTTGTGTGTTCTACAAATTGTTTTTCCCACTTTGTATTAGATTATCATCCCATGACA
GCACATATAAAGCTACTTTATTGTTTTTAGTGGCTTCAGAGAAGTCCAAAATTAGAGTGC
ATCATAATTTATATAACCAGCTTCCTATTAGTCATTTAAGTAGTTTTCATTTTTTTATCC
TTACATAGTGAGCATCCTTACTTGTATATATTTTTTTAAAAAAATTGTAGCCCTACATCA
TTGGAAACGCCTCGCAGAGTAACATTGTGGTTTTGCTTTCCTCACAGGACTATTTGTTAG
ATCTGTGGGAAGGAACTACCAGACAGTTGCTAAAAGTATAAAAGACCTAATAATTTGTTT
TTACCTTAGTAAAAACATAAAAAAATTGTAAAATATACATAATGTTTATCATCTAAACTA
TTTTTAAGGATACAGCTCAGTAATGTTACCTTATATGTATATCTTTGCATTTGTGCTAGT
ATTTCTGCCAGATAAATTCCTAGAAATGAAAATCCTACGTTTAAAGGATATATTTATTTC
AAATTTTGATATTTGCTTATCGACTAAAGGTTTTTTGTTTTGTTTTGTTTTTGAGACAGT
GCCTTACTCTGTCACCCTGAGTAATGTACAGTAGCATCGTTGTAGTCCACTGCAACCTCA
AACTCCTGGGCTCAAGTGATCAATCCTCTTGTTTCAGCCTCCTGAGTAGCTGGGACTACA
GGTGTACACCCCACTGTCCTGGCTGATTTTTCTATTTTTAGTAGAGACGAGGTCTCACTC
TTACTCAGGCTGGTCTCAAATTCCTGAGCTCAAGTAATCCTCCTGCCTTGGCCTCCCAGA
GTGCTAGGATTATGGCATTAGTCACCATGTTCAGCTGGCTGAAAGTTTTTAACATTAAAA
TATGTTATTGGTTGAATATTATAAAGGAAAACAAAAAACTAACATCCCAAATTATTGGTT
TTAGGGTGTTTTGAGCAGAGTCCAATTGTCAGGAGACCATAGATAGGCTTCAGGAATACT
GTGATTTTCTCCTTCCCTAAACTATGTAGAATTTGAGTATAGGTTCATATGCTTACTTTT
CCATTTGCAGTAAGTTCTGTGACCCATTTATGAATGACTGTCTTCAATTAGTATCTAATT
TATCAATTCAATAAATGTTTCTTTAATACCTTCAAGTGCCNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNATTATAGGAAGTCATTATGAACTGCTGACAATGGAA
TTTTTGGAGAACTAATCAGTGAGGAGGGTAGTAGGAGGCACAGATGCCAGCCAGCACTGT
TGCAATTCAGATGAGAGGGGAAGAGTCCCTGGAAAAGAGAAAGGATTAAATTCAGAAACA
TTGTAGAGAAGCTGTCAGCAGGCTGTGGAACTGACTGAAAGTTGGAGGGCAGAAGTGAAG
AGTAAGGAGTACCCAGAGTCTCTTCATAGTCAAAGACAGGGTCCAAGTCTCTGAACTTAG
AAACTAGGAGAATATTAATGCCACCAATAGACATTGAAAAGTTAAGAAGCCAAACTAGTC
TGGGGAGAAAGAGGAGATTGGGATGGAAATATTAGTTGATAGCAAAGGGGAGGTGTGGTG
TAGGCAGCTCAAAATGGAGAGTTGGATTTAGATGACTAAGTGGTGTAAAGATTTTAAAGG
AAATGGCTGCTGTAACACTTGACCTGACTTACCTTTGGTTCTACCTTTCCTTAGATCAAA
AATGTCCTGTTCTCTTTTTTGTTCGTCCATTGAAACCCAACATGTTGTTGGGTTCTATAC
TCAGCTCAAATCCTACCCTCTCTGTGTAGCCTTTCCTGCCCACCCCAGCTGGATGAGCTC
TCTCTGCTTGTTCTAAATGCAGGCATTATTGTCTATATGAGCATTATCAATTAAAGTTTT
ATTGAACACAGGAATCAGTTGTGGAGGATGGCAAAGTATTGCTATTTGAATTTGGCTTAA
GAGTGCATGGGAGTTAGATTCTTCTCTTCTTTTGTGTGCTTGAAAGTTTCCATAATAAAA
AGAAAAAAGAAAAATAAAATCAGCATAGTACTTTTAAAAATGCAGATGCCTAAGCCTCGC
TTGTGGCCATTCTTTTTTTTTTTTTTTTTTGGAGACAGTCTTGTTCTGTTGCCTGGCTAG
GGTGCTGTGGCATCAACCTAGCTCACAGCAACCTCAAACTCCTGGCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCTGGTCTCAACTCCTGACCTCAAGTGATCCTCCC
ACCTCGGCCTCCCAGAGTGCTAGGATTATGGGCAGGAGCCGCTGGCACCTGGCCCCCTCT
TGGCCATTCTTATTCAGTAGGTCCTAGATGGGCCCTGGTTGTTTGTATATCTAGAAGATC
CCACAGAGGCAACTGATGTATACCAAATATTGAACTCCACAGGTCTATTTCATTCAGTTG
GCACCTAGCAAAGGCACTTAAGTAAAGGGAGTTAACAAGTAAACACGTAAGTGCAGTAAT
GTGTTATAGGAAGCACTGAGCAATGAGCTTTGATGTGGACCATTTTGTTTAATCCTCAGG
ATGGCTTTGAGGTAGGTACTTTAACCTTTCTTCTATAGTTGTGGGAGTTGAGGTTTGCAG
AAGTTAAGGTCACACAGCAATGAAGTTGCCAAACTGGGATTAGAGCCTGGACTCCAGAGA
CTGTAATCATAACCTACTGCTGTTGCCTTCTTGGAATTTCATAACACACACACACAAAAA
AATCAAAATTGATCAAAAAAAGTCAAATCAAACATAAAAATATATTTACAACATTTATTA
TAATAGTTTCAGGAACCAATTACTTAAAATAAGCTACATTGTTACTTTGCCTTTGGGAGT
TTTTTCTATATGAGCTGAACTGACTGAACTGAGAATAGGCTGGTGAAATCTCCACTGTCT
CCTGCTGAATTTTCCTGAAGTTTTCATTGCTCTAAGCACTTTGAACTGCATTAAAAATCA
GGGCAGCCATTCTCGAAAGTGTCTGTTACCCATTTGGTGTGTACAAATGCCTCTAGAACT
CTTTGAGTTCTGTATACCAGGAGAAGTTTCCATGAGGTCTTAGGAGTCAGAGGCACACAC
TGCTGCTACATGGTTATAAAAAGCTGTGTTTAGGAGTCATGGGTGTAGTCTTGAGCATAG
TCTTAATAAGTTTGTGGTTGATTACCTATATCTGAATCCTCTGCCAGGTATGATTTGTTG
GGGTTTTTTTTTGAGACAGAGTCTCACTCTGTTGCCGACGCTAGAGTACAGTGGCATGAT
AATAGCTTACTGCAGCCTTGAACTCCTAGGCTCAAATGATCCTCTGGCCTCAGCCACCCG
AGTAGCAGGGACTACAGGTGCATACCACCATGCCTGGCTAATGTTTTTTTGTTTTTTGTT
TGAGTCAGAGTCTCACTCTGTTGCCCAGACTAGAGTGCCATGGCATCAGCCTAGTAGCTC
ACAGCAACCTCAAACGCTTGGGCTTAGGCAATCCTTCTGCCTCAGCCTCCCGAGTAGCTG
GGAGTACAGGCATGTGCCACCATGCCCAGCTAATTTTTTGTATATATATATTTAGTTGGT
CAATTAATTTCTTGCTATTTTTAGTAGAGACAGGGTCTCGCTCAGGCTGGTTTCAATCTC
CTGACCTTGAGCGATCCTCCCACCTCTGCCTCCCAGAGTGCTAGGATTACAGGCGTGAGC
CACTGCGCCTGGCCTAATTTTTTTGTAGAGAGAGGGTCTTGCTATATTGCCCAGGCTGAT
ATTGAAAATCTGGTCTCAAGCAATCCTCCTGCCTCAGCCTTCCATAGTGCTGGGATTACA
GGTGTGAGCCACTATGTCCAGCCTATTGTTATCATTTTATAAAGGAGGAAACCAAGTATC
CGAGAGGTTAAATAACTTGCTTGGAGTCATGTAGCTAATCAGTGTCAGAGCCAATATAAT
CTAGCTCCAAAATTAATCTTCTCTCTTACTGTGATAGAGTTAGAGGCAATAGATTACTAG
GTTTGAGCCTCAGATGTAGTTCTGGCTGGAATAGTAGATTTAGAAGGCATCCACATAGAA
CAGGGGTCCCAATCTATGATGAGTTGTATAATTTTCATTATATATTACAATATAATAATA
GAAATAAAGTGCATAATAATAGAAATAAAGTGAATAATAAATGTAATGCACTTGAATCAT
CCCAAAACCACCCCCCTCCAAATCTGCGGAAAAATCGTCTTCCATGAAATGGTCCCTGGT
GCCAAAAAGGTTGGGGACCACTGGTATAGAAGGCAGTTGAAACCATGGGAGTGGTGGAGA
TTGCCCAGGGAGATGGTGTAGGTTGAGTACTGACAAAATTTAAGGACAGATCCTGGGTTC
TTGAGGACAGGGTCCATGTCTTATGCTTTTTGCAGAGTAAGACTTTCAGTGAACATTGGT
TATTTGTAATCTTTCATGTTATTATTTCTTGTGAACTCTGGCTTTGATATTGCTCTGATG
AGCTGATTCTATACATTGTACTGGAGGTGGCTCCCATCTCCTGACCTGGATGTATTGTGT
TTGTCATTCTAGATTACCTAAAACCAGATCCATGGATGATCTTCTTTCTGCCTGTGATAC
AAAGCAGCCCCCTGACTCGCACATCCAGTGACCCTAACCTGAATAACCCACTGTCAGGAG
GTCAGAGTAGGTTTGGAGCCCTGGCATACCAATCCCGAGGGGTCAGAGACGGCCTTCATG
GAATCTGGTGTAGGAGGTCTTCAGCAGACTGTAGGAGAAGCGGGTCTTCCTCCCCCTCTG
CCCAGCTGCCAGAAAGACTACTTGAGCAATAAACCTTTCAAGAGTCACAAAAGCTGTTCT
CTAAGTTATAAACTGCTTAATACCGCAGTGCCACGGGAAATGAAGAGCAACACCTCCGAT
GTAGAGATCAAAGTCTTGGAAGAGACTAAGGCGCCAGCTCCAGCCCCTCCTGCCCAGGAT
GAGCCGGGTAGGACTTTAGATGGCACAGGGGAGCCACCTGAACATTGTCCTGAAACAGAA
GTTGTCAGCGCATTCTCTAAGGTCATTTCCAACAAGTGTGATGGAATTTATGATTCTCCT
GAGTCTTCCCAGGACTCCCTTACAGGTGCCCCCCAACAGGCCCAGCTAGACTCCGCAATA
GGTATGCCCTCCAGATGTACTCTCAGTCACAATCTCGGCATCCTTTGCAACCCACCGAGT
GCTGCCTGCCAAACTCCTCTGGACCCAAGCACTGACTTCCTCAGCCAAGATCCCTCAGGG
TCTGTGGCAAGTATCTCCTGCCAGGAACAGCCCAGTTCTGTGTTGGATATGATCCATGGG
GAGGAAGATATTGGTAAAAGAGGAAATAATAGGAACGGACAGTTAGTGGAAAATCCTCGC
TTTGGGAAAATGCCATTGGAATTAGCCCGAAAGCCAATCTCTCAGAGCCAGATCAGTGAG
TTCTCTTTTCTAGGGTCCAACTGGGACAGTTTCCAAGGGATGGTGACTTCGTTCCCCAGT
GGGGAGACCATCCCTCGGCGGCTGCTTTCCTATGGCTGTTGTGGCAAGAAGTCAAACAGT
AAGCAGATGCGGGCAGTGGGGCCATGCTTTGGGGGCCAGTGGGCTCAGAGAGAAGGTGTG
AAGTCACCTGTCTGTTCTAGTCATTCCAATGGACACTGCACTGGCCCAGGAGGAAAAAAC
AACCGGATGTGGTTGTCTGGTCACCCAAAGCCAGTCTCCAGCACAAAGTCTGTTCCACTG
AGCTGCCCTTCTCCAGTGCCTCCTCTGTATTTGGATGATGATGGACTCCCCTTTCCCACG
GATGTGATCCAGCATAGGTTACGGCAAATTGAAGCAGGGTACAAGCAAGAGGTGGAGCAG
CTACGTCGACAGGTGCGTGAGCTTCAGATGAGGCTGGATATCCGTCACTGCTGTGCCCCT
CCAGCAGAGCCCCCCATGGACTATGAGGATGATTTTGTAAGTATTCACCTACTGTCATCT
GCCCGTTTGTTTATTCTGTCCATCCCGCCTTCCATCCATTGAGCATTTATTCACTTGGTG
TTCCACTGAGTTAGGTGCTTGGGCTGTAGGATGAAAGGCTAGTAGACAAATAGAATGATG
TTCTTAAGTGTTATGATTGAGGGAGGAGGCATCAGGCATTAGGGAGCTGGAGTGGAGAAA
AATATCAAAGAAGGCTTTCCTGAGAAGACAATGCTTGATTCTTGCCTGCTGGTCCTTTTA
AAAATACACACACACACACACATAATTCTTGAGCTGAGTGCTAAAGAATGTGTGATATTT
AGCTAGGTAGACAGTGTAAAGGAAACACTATTTGCAGAAGCATGAAGGCAATGGGTACTC
CAATGGTATGGCTTAAACAAGGGGATGAGGTGTGTGTGGGTGTATGTGTCTGCACACAAA
CACACTTGTGCTGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
AGGCCAGCAAGTAACATAAACAGATTTGTAATTTAAGGAAATTATTCTAGAAACAGTGTA
GAATTTTGATGAGGCAGCAGAGACCCAGATTGGGAGGCTGGTTAGGACATTTTGGAATAA
TCCAGGTGAGAGATGATGAGGACCGTCTAGGCTTTGCTGTGTTGGGTGGCCTCTGGTTCT
GGCACCACAGTCCTTGGGAAACTTCTAGGAGCCAGCTTCTTCCCCATAACATCTTGCTGT
CTACACAGACACTTCCCTTCCTTCTGTTAAGGCACTCTCACTTGCCTGCTGCCCACTTCT
CTGATGCTTTAAACAAGAGTCACCACACTTTTTCTTGTAAAGAGCCAAATAAATATTTTA
AGTTTTGTGGGCCATGTAGTCTGTGTTGCAACTACTTAGTGCAGCACAAAAGCAGCCGTA
GACAACATGTAAATGATGAATGCAGCTATATTCCAACAGAACTTGGTTTACAAAACCAGA
CAGTAGGCTGGATTTGGCCTGTGTGCCATAGATTGCCAATCACTGGCTTAGAATGTTACA
AGAGTATCTTTCCACACTGCGGCATAGCATGTTGGTTAAAAGCGTGGGTCTGAAGCCAGA
ATACTAGGTTAAAATCCAAGCTTTACTTGGATCAGCTGTTAACTTTCTCTGTGGCTTAGT
TTCCTTATTTGTAAAATGAGAATAATAGTAGTATACCTCGTAAGACTTGAGAAATTAAAT
AAGTTCACATGTGTAATGCACTTAGAACAGTGTCTGACACATGTTAGCTGATGAAGATGA
TGTTGATATATTTGCCTTTTCTTCAGACATGTTTGAAGGAGTCAGATGACAGCGATACGG
AAGATTTCGGCTCTGATCACAGTGAAGACTGCCTTTCAGAAGCCAGCTGGGAACCTGTTG
ATAAGAAAGAGACTGAGGTATGTATAGGCAAATATGTGGTGGGTACTTATGTGAGTTATC
ACATTTCCCAGAGATGAGAGACATGCTATAGAATGAGCTCTCTCCCAAATGTGTGTCATC
TTGGTAGGCAAGTAGTAGCCAGTGTTGAAGATCAGCCTTGTCATTTTCTCCTGTGATTCT
TTCCTTGTTGCATAGTTGGTCTTCTACTCTGTTGACAAGGACCTGGAATTTTTCCTTGTG
CCTTCTGTTAGGTGACTCGCTGGGTTCCAGACCATATGGCATCACACTGCTATAACTGTG
ACTGTGAATTCTGGTTGGCCAAACGAAGACACCATTGCAGGTAAGATGTTTTGTATGATT
CATTATGACTCATAAAGAAGTACAGTGTGTGTGTGTGTAGAACTAAATTGAATTAATCTG
AAAATTGAGACATCTTTATAGGAACTATTTTTGTTCCCAACTTTTCATTTACTCATGGAA
AGGCTTTTAGACTATCATTTATTCTCAGTCTATTGGCATTTTTAATTTTTATTTTTTAGT
CCCAATACTGATAAAGGCATGTATTGGCATTTCTGATGAACTCTTCCCTCTTTGTGCTTT
GGCAGAAACTGTGGGAATGTATTTTGTGCTGGTTGCTGCCATCTGAAGCTGCCCATTCCT
GATCAACAGCTCTATGACCCAGTTCTCGTCTGTAACTCATGTTACGAACACATTCAAGTA
TCTCGTGCCAGGGAACTCATGAGCCAACATCTGAAGAAACCCATCGCTACAGCTTCCAGT
TGAATGCCAGGGGAGATGACCTGTCCAATTTCAGCAGGTTTGAAGGGAGGATCTGCTTCA
GGTGTAGTTTGGAAGGTTCCTTGGTATGGCTCATGGAATCACAGAGCTCAAAGATACCAT
CTTGAGAAATCCTCCTTGGTACCATGAAACTGGAGCAGAGGAATTCCAATTTGGCAGGAG
GTCCTCTACTGGTGAGACCCTCACCTTGGGGGTAATGGTCCTGATCCAGACCCAGTGTCT
GGAATCTTAACGTTGAGTTGGTGACTCCAGCTTCTTTCTCCTGGAGGTCACAAGATGATG
ATTTCATAGATATTGCCTGGTGCAAAGTGCCCCAAACAGCAATAGAAAGGCATATGTATA
ACCAAACTCCAAGTGATAACCAGACCCATCTCTCCTCCACCTTGGAAAAAGCAGATTATA
GTATACAAGATAGGAATTCCTGTCCTATTTGAGATGAACTATATCCTGTACCTCTGTGCT
CTGTGTCTGTGCATGAAGGCTCAGTCTTTAGAGGCACTCCCTCTAGTTGCATTAGTACTG
TCTTTTTGTGGAGTTTGGTTTAAAGACTGGTTCAGCAAGTCGAGGTTTCGATGTATTTTT
CACTTGGCTCATCGGCCAGCATCAGTGAATCTTCAGTTTAGGAGGGACAGTTCTAGGGAG
TGAGACATTTTGGGGAGTAGAGGAAAACTCTGCTGATGTTCAGTCCTGGCAAAAATCAGT
TATTTTGAGCTGTGAAGGCAGTCGTCTCTGTTACACGGTGGCAGCTCTTGAAGTATGCAC
TGTGAAGAGTGAGAAGGGAAAAGCAAAAGTTGTCCTTGTGAAATATCTGCTGATTGTGCC
CTACCCTTTGCGCCTGACTTTTCCTAGTTGTCCTGGTGCTAACGCGGGAGCTACACCTTG
ATCCTCTCCTGGCATGAAAATTAAACAAAGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 4921..5010, 5360..5476, 6070..6152, 8210..8370, 8490..8586, 8764..8877, 9667..9863, 10114..10241, 10783..10883, 11889..12084, 12185..12370, 12471..12641, 13321..13437, 13440..13474, 19692..19741, 19743..19787, 19789..21095, 22466..22576, 22811..22899, 23165..23342
1001..1003, 4921..5010, 5360..5476, 6070..6152, 8210..8370, 8490..8586, 8764..8877, 9667..9863, 10114..10241, 10783..10883, 11889..12084, 12185..12370, 12471..12641, 13321..13437, 13440..13474, 19692..19741, 19743..19787, 19789..21095, 22466..22576, 22811..22899, 23165..23339
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved