Microcebus_murinus Locus RPL5
snOPY snoRNA Orthological Gene Database
Microcebus_murinus RPL5
Microcebus_murinus
RPL5
GeneScaffold_2998
SNORD21, SNORA66
6897..6991, 9899..10031
12054
CTCTATAATATTTGCACAACATGAAATCGCTGAGGAGCATTTCTCACAATGTATCTGAG
TCGTTAAGCAACACAGGACCATAGTTCCTAAAGAAAGGGAAAAGTTGAGCAGCGTGATGG
CTTTTGCCTGTAATCCTAGTACTTTGGGAGGCTGGGAGGATCCCTTGAGGCCTGGAGCTA
AGCCTGGGCAACATAGCGAAACCCTGTCTCTACTGAAAAAAAAAGGAAAAAAAAGGAAAA
AATTAAGCTGGAGCCAGAGAAAAGGAATAGGGGTGCAGTTAGGGATCAGGGATGCGATGG
AGGTAAAGGGAGACATGAAAGAAGGAGTTCTTTCACAAGTTACCAAATACCGAACATTTA
CCAAATGCACTGTGCGAGGTGCTGGAGATTCAAAGGGGCACATGCCAGCAGGGCCTTCTT
CAGAAAGCTCACAGTCTACAGCTGGCTGAAGCAGGTACGGAGGGGCTGTGGTAAGGCAGA
GGAGTGAGCCCTGTTCCAGGCTTGCGACTCTCAAGCAGGACTTCCTGTTGGGTCCCTGTA
TGCACTGGGCGGGGATGAGTGGTGCAGGAGGTAGAGTCCTGCAGAGGGCAAGAGGGCTCC
AGAGCAAATTCTTCTTAACTTTATATGTTTTTTCTGTCTTACAACAGTAAAACATGTTTG
TTATGAAAAAAACGTTGTGGCAAAGAAAGCGAAAGCCTCCAGTAATTCTCCCTTCTCCTG
CTCTTGCCCAACCTTGTCGGGTACTGTACCCGGAGCGTTAGGACTCAGTGGCATTGAGGA
TCTCTGACGACCAGGCGAAGCCTGGCATTCACCCTCCTGCCAGCAGGGGGCAGCAAGCCG
CACGCCTAGTGGCGGCGCCCTCTCTCTTCCACGCGTCGCTCGCGTAATCGCCGGTGCTAC
ATACTGCGCCTGCGCAAGAGCTACGGCCTTTTTCCCCCCCCTAGCGCTGCTGGGCCTGCA
AGTCAGTGTGGAGCCGCAAAAGCGGGTCTCTGTTCGGCAGGATGGTGAGTGGGTACCTTC
ATCTCGGGGCTTTGGATGCACGGGGGTTCTTTTTCCTTGCTCGAACGACAGCCTATGGCC
CGTCTCGCGCGGCGCAGGGGTCGGATGGCATTAGATTGCTTGCTCTACCATGGTCGGTTT
GCCGCTCCCAGCGTGGCCTTAATGGCTGCCGCCCGGCGTGCGAGCCTGGGGGGAGGGGTT
GGCGAAGAAGGGTAGCGAGAGCTTGGGTAGTAGATTGGGGAGAAGGGTGAGTTTAGTAGG
CAGCCTGCGATGATAGTGCCGTTTCGTCTGAGTGGGCACTGGTAGACGGCTGGGCGGAGG
AGGTTGCATGTAGTCGGCCTCAGACTAGCTGGAGGATGCCAGAGTGGAGGCGGCCTGCGG
GTCCTTCGACCCGGCTCGATCCCGCCTGCTTCGTGGGCTTTCCAGGAGAGTCTCGGAGTC
GGCGAGTCTTCCAGGAAGCTTGTGCTTGTGGGCCAAAGACTTGGCTTTTAAGCCAAACCC
GTCAGTGGAGCTTGGAGGCCGAGGTGTCCCTGGCCCCCGGAAGGAAACTGGTTTAATTTG
GAATATGTGCCTCCTGCTTTCTCCATTCCGTCCCTGGCTCCAGTTTTTAATGATTGTCAG
GATAGGGCCCCAAAGGAGAGGTGGAATGTTACTTTAGTTGGTGGGGGAACAGTGCTGTTT
TAATGGGGAATAATTGCTGAATGTGCTCTTGCCCGATTCAGTATTGTGGCAGGTAATCTA
GGGTTTTGAAAAATGTATGTGATAAGTGAGAAAAGTATATAGTTATCTGAGGTTAGATTT
TTGAAGGGGGACATACGGTTGTTACGAACAGATTGACGTTTGGAAGCAGTGCTTCCCCAA
AGTTTGGCACAAGGATTGGCACTGGTCCTCTAGGAAACAAGTACAGAAATTGAGAGTAAG
CATTTAACACTTTTGCGAGCAAGGCGACAGTAACTTTATACCAGTTAAATCTCATGGACT
GGGGCCTGCATTTTATTTGTTTTTTTTCTTTCGTTTCGTGTTTTTCTAATGATTCATTTT
TATTGTGTTTTATAAAACCATCAGTTTGACAGATGGAAAATAGAAGAAAAAGTGGTTACT
GACCCCAGTTGACTTGCAAAACATGAGACTCTACAAAAGTGACAGTTGTGTGTATTCTCA
AAGTTCAAGTGTTATTTTTGTTACATGTTAAGTCAAAAGTATCATTGGCTAAAACATTTG
TCCAAGTTTTAATATTCTTTTTTCTTTAAGGGGTTTGTTAAAGTTGTCAAGAATAAGGCC
TACTTTAAGAGATACCAAGTGAAATTCAGAAGACGACGAGGTATTGTCAATTTTTTGTTT
GTTTGTTTACAGTATTAAAAATCTTCTTTGCAGTGGAGTAGCTTTTCTAAAGTTATTTTT
TTCTTCCAGAGGGTAAAACTGATTACTATGCTCGGAAACGCTTGGTGATACAGGATAAAA
ATAAGTACAACACACCCAAATACAGAATGATAGTTCGTGTAACTAACAGAGACATCATTT
GTCAGGTAAGTTGTATTCTAGATGCAAGCATTCCCCTTTACTAACTGTACTGGAGGAGGG
AAGCAAAGCACATTGATGTACGTACAGGCTTGAGGGGCTAATATGACCAGAAACATTGAA
TAAGTAGTTCTTTTCCTCTTCGGAGGTCTAGAGCTGGAGCCTGGGAAATTGGTACATTAG
AAAACATTGACTGAAGATCAGCCCTGTTTGGAATTCCTGACCCAGTTTAATCCCATTTAT
TTTATAATTTGGGGGAAAGAGGCTAAGAGAAATCTCTTAAGAGGGTGGGTGGGAAGATTA
GAAACTAGGAGAAGGTTCTTACCCATCCCAATTTCAGTAGAATAACAGTTTGTGGTTTGG
GTGCCCTCGCTCATGTCTGTGATTCTAGCACTTTGGGAGGCCAAGGTAGGAGGATCGCTT
GAGGCCCTGAGTTCGAGACCAGCCTGAGCAAGAGTCTACCAAAAAACAAAACATAGAAAA
ATTAGCTGGGCAAGGTGGCATGTGCCTGTAGTCCCAGCTACTTGGGAGGCTGAGGCAAGA
GAATCCCTTGAGCCCAGGAGTTTGAGATTGCAGTGAGCTACAATGATGCCATTGCATTCT
ATCCTGGCTGACAAAGTGAGACCCTGTCTCCAAAAATCAAAAAAGAGTTTATCATGGACT
AAGACCTGATTCTTGCTACATGGCCTTACATTGTCATTTAACCACTCCTCACTGAAGAGG
TAGGTAATTCTGAGAGTTAAATGGAATTCCTAAGATTGTCCTTATTTCTGCTTATTGTTT
GAAATAGGTTTTAATAAAATATACAAAGATACCTCCCACATAAAAGTCCTTTGGAAAAGA
GGCAGTTCGTCCCTGGATGCTAGTATTCTGGGCTTTTACAACTAGGGGAAATTCTGATAC
TTGAGATTGGATGATCTTCTACAGTAGGCAAGCACACCTGTTTCCTGCGCATATTTAGTT
TGTTTGTTAAAGCAGTATCTAAGTCTGTACCCAAGTTCAGATAACTAATCATTGGGTACC
TGAAACTTTGTTGAACTTAGCTTATGCTTTGTTAAAGAAGGTGCTTGAAATAACTGGGTG
TTTCTCTTTGGCTTTTTATTTTTATTTATTTTTTTAGAAGTCCTTAGCAGTACTGCCCTC
ACTACTTGTTCATTGGACACTAGCACTACCCCAAGAAAAGGATGGCTATCTCTTTGGCTT
TTTAAGTGCCTCTTGAATTCACCAGCTAACCTGGCTAAGAGTCTTTTCAGTATTTAGAAG
TAGGGAACCATGGTATAATTTATTCCACATACATCCTAATATTCAATGTCTATTTGGCAA
TTTTAGCCTTGGATACTCTGACATTAGTCAAACATACTTACACTTAAACCTACCTACTGT
ACAATTGCTTAATTGCTGTACAGTTGACCAAGTCATAAATTATAGTTGGAGGTGTGTAAG
TTTAGTAAAGACAAGTTTTAAGTGATGCAGATCTCTGTCTATTCAGCTTTTTTTTATTCG
TTTGAAAGAAGGCACTTACGACAATTAATTAAGCAGTGAAAGCAACAGATCACTAACCTG
GCTTTTCTCTTACTATAGATTGCTTATGCCCGTATAGAAGGGGATATGATAGTCTGCGCA
GCTTATGCACACGAACTACCAAAATACGGTGTGAAGGTTGGCCTGACAAATTATGCTGCA
GCATATTGTACTGGCCTGCTGCTGGCCCGCAGGGTATGTACAAGGTGACTTTAATTGATG
TGCTTTGGGTTTAGTTCACTGCTTGCAGAGTTGTCTTTGAGATGTTTGTACATGGATAAA
ATACACCCTGCTGTGGCTTCAGGAGAGTGCCTGCTTCCTATTTTCTGCCCTGTTTATGGG
TGTATTTAGACCAGCTTTGTCCAGTAGTATTTTCTGCAGTGATGGAAATCTGTAATCTGC
TGTCTGGTTGGATTTACACCTATGGCTATTGAGCACTTGAAATGTGGCTAGTGCTACTGA
GGAACTGAATTTTTAATTTGAATTTCAAAAGCCACTTGTGGCTATTGACTACTTAATTGG
ACAGCAAAGACCCTACTCCAGAACTCCAGAATCTACATTATGATTCTGTGTCCAAAGTGA
TGTATATGCACATTAAAATTTGAGAGGTGATGTCTTAAACATTTTTGGGGGTTATCATTG
ATGGGAAGATTCATTTTTGTTTTAATCATTTTTCCATCTTTTGGCAGCATTTACTGTATA
TGCTATGTTAATGTTGGAGATGAAAATGTGATTTTGCCTTATTTTTGTTACCTCTCAGTT
ACCTTGTTTTACAGTGGAATTGTTGAGTTTATGCATCAAGATTTAGGATTCACATCTTCA
TTGTTATAAATATATTTGAATGGGGGGAACATTGTCATTAATGAGAACAACTTGGTACAA
AGGTGCTGCTTGCAGAAAAACCATAGTTAGGTGACTATACCAGCAAAGGAGTGGCCCAGA
TTAACATGTAGTTGGAGAGTAGAGCCACAAATGATGTCCCCTCAGTCCAGGATCCTAGCC
CTACAAATTTTATTCCAGATTAAACAAAACTACATGTGATAATGTGTAATATTTAGTTCT
TAAATTATTATAGCCAAATATGACTGAAGAAATGCAGCGAATATCTCCCTTGAGTAAATA
TAAGAATCAAATTAAGTTTATACATTCTAATTGATTGCTACATGAATCAAGTATGGACAT
GTAGCAAAGATTCAGAAGCCATAAAACAAAGTTATAGTTGTGGGTGATATTGAACATAAT
GCAGTTTCTTTTTGAAGCATTTAAAAATTGAATTACCTTTTAAAGCGCATAGTAGTAAAA
GGGATAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATTTATTAGGCATATTTTTAGT
GGTGGTAATTACACCAAAATAATAATTTTTGACAAATAGATTTTTATTTTTGGTAAGCCT
AAAATACACCTAACTGGAATTTTGCTTTTATAATGTAGAGTTGAGGGAGGAGTATATTTT
TTTGAGGACCCGTTAGATCTTATGTACAATTCCTTACTGTGAGGTGCAGGTGCTCCAAGA
GTATTCTCACTTGGGGATTTCATTAACTGATCTTGGACAAGTCACTTATTCCCATGTAGC
ATAGCCTGAGGCACCACAGAAACTAAAAGATTTTGGGGGATGACTTTTGAAACCCCTTCC
TGTGCTGATATGCAATAGAATTAACTTTATAGTGGTAGAAGACTTTTTTTTTTCAGACAG
AGTCTTACTCTGTTGCCCTGAGTAGAGTGCTGTGGTGTCAGCATGGCTCACAGCAACCTC
AAACTCTAGGGCTCAAGTGATTTGCCCTAGCCTCCTGAGTAGCTGGGACTATAGGCGTGT
GTCACGACGTCCAGCTAATTTTTCTGTTTTTAGTAGTGACACGGTGTCTTGCTCTTGCTC
AGGCTGGTCTGGAACTCCTGAGCTCAAACCATCCTCATGCCTCAGCCTTGCAGAGTGCTA
GGATTACAGGCCTGAGTGACCACTCCTAGCTTATAGTGGTAGGGAACCTTGGTAATTGTT
TTTTAAAGGTGTTTGTGGCATGAATTTCTTTTCCATCCTGGAATTCAGAGATAAGCTGCC
AAATGATGATACCCTACTAACTGAGCAGTCAGTAGTTGGTCCTTTGGTTGCATATGATGC
AGTAATTGTTTCAAGACGGGACTGATGGCAGCTGACTGAGGTGAATACTTACTAGTGAAC
TAATTCCAGTCTATACTAAAATATGAAAAACTTTATTTTAGTACCAAACGATTCCCTGGT
TATGATTCTGAAAGCAAGGAATTTAATGCTGAAGTACATCGGAAGCACATCATGGGTCAG
AATGTTGCAGATTATATGCGTTATCTAATGGAAGAAGATGAAGATGCTTACAAAAAACAG
TTTTCTCAATACATAAAGAACAACGTTACTCCAGACATGGTAAAAAATTTACCTAAAAAT
GCCTGTATTGGTTAATTTATCAAAATGGATTTACTGCTTGTTTTTTTTGGGGGGGGGTTA
CGTTCTTGTGTTAGATGTATTTCAGGTTGGCAATTGAAAGGTGAATGGGCAAATTTGTAA
GTATAGATAGGCTCACATAAGATATTCTTGGCTTAAATGAAATAAGAATGTTCTGGATGA
AAATAGGTTAACTTACTGAGCTAGACTTGTCAGTATGGTTTTAGGAATCTTAGTTGCTGA
CGCACAGCAGGCTTCAAGCATCTAAAGCCTTTGTTGCTTTTTGTTCTTTGGCTGTTCTGT
ATTTTTAGATGTCATTCTTGTGGTCATAGTTACAAATCTGCTTGAAATGAGGTGCTAGAT
GATTCACTAATTTTGATGCCATGGGAGAGGAAAGTTCATAGTAAATATGTCCTACATTCT
GGGCTTTCTGAATATCTCAGGCATGCACACAGGTACATATTTGATCACTGGTTCTGCATG
ATGTTGCAGAAACAAGAGGACTATGTCTACAAAAGTGAGTTTGGCTAGGAGCAGTGGCTC
ACTCTTGTATTCCCAACACTTTGGAGGCTGAGGTGGGAGGCTCACTTGAGCCCAGGAATT
TGATGTTACAATGATCAGGACATTGCACTCCAGTTTGTGTCACAGAGTGAGACCATGTCT
CTTAAAAAAAAAAAAAAAAGTGAGTGTATTGTAATTTAGTGGCCCTAAAGTTGGATCTCT
GGGGCTAACTCTGTTAAAGACATTGAAGTAATTGAAGGTTATAGTATTGATTTTGAAATT
ACAGTGAAAATGTAGGACACAAATCACATTAAAAAGAAATTGGGAAAAGATCACTTAATG
TTATTTATATGTTTTGGATACCATTCTAAGGCCGAGTAAAGCATAGATTGTTTTGAGATA
GGAAAGGAATTAAGGGTAGTTTTTTTATCAGTAATGTAGATGCACGTTAATTTTTAATTT
TTACTTGATTATTTTCCTTTGTGTTACTACTGACTTTCATCCTGGTAAATCGTTCTTTTA
CTTTTAGACTTTGATTCTACTTGGCCTGCAGAATGTTTCTTCCTTAGTCATGTCATACTT
GGTCAAAACTTTTGAGAGTCCCTTTCTGTGCCTTCAGATGTTTATTTCCTAGTGGTTTCC
TGTATACAACCTGTACTTCAGCCAGACTGCTTTTTGGGTAAAACTAATTTTCTAGCTAGC
TCGTTTTGTCTGTGGTGTTCTTTCCTCTTGTGTGCCTGCTGAAATCCTCTACAGATATCG
GATATATCTCTAACAGGAAGTGGTCTTTACCTAAATTCATGGCTTTATCTACATATGTGG
TTGTACTTCCTACTTGTCTGTTGTCTTGAGCAGGAACTTTATTGCTTAGATTTATTAAAT
ACAGTGGATGGCTATAATAGAGTCTTCAAAGAGGTGTAGAAGTAAACTTTTTAAAGGGAT
TTAGGTAGTTGAGGTTTCGAATGCTATGAACATTCTTGCATTATTTTCCTTTACTAAGCC
TTATGCAAATGCATGCAGTAATCACTTTCTCCACATGGAATGAGTAATTTTAGAGACCCA
GATTACCATAACATTTTTTAGGGGGCTGCAATTGTTACTAGATATTCAGATTTGCAGTCT
TTTTTTTTTGATGAGTTTTAGAACAAAATTACCCAGTAAGGTATCTAATTAAATAGCTTT
TCAAGAAAAATTCAGACCACCTCTTGGTTCTAGAGGCCTTATATTACTGCCAGATATTAG
TGACTGGTGGTAGGGAAAGGTAGAAGAGGTCCCTAGTACATAATACTGAGAAATGCTTTG
AAAGACTTATCTGGCAAAGATAGAAAATGTAAATCTGGGGAATATGGATGACAAATGAAT
TTGGCAGTTGCTGCTCGGCCCTAGTGTCCAGTCCTTGGTCTCAATTAGACAATATCATTG
TTGTAACTGTCTTCATACCATATATTCTTTATCTTACTAACATCTTAAATATTTTTGTTT
TGGCATGGATCATCACTTGTATGAAAGTGTTTAGGCTGAACAGTATTTTAAATAAGCAGT
GCCATGTGTGTTTCTGTAGAAGTAAATTTGCTTTAGAGTGACTTGAAGTATGGCTGAATT
CCTCAGAAATACAGATTTTTCTTTAGTAAGACAAAGGTTTTTTTTATTATAAATAAATTT
AAACAACTTCCTTTTTTTTTTAACGCATATGAACTTGCTGCCATTAAGACAAAGTTTTCA
GTTGTGTGAATAGTGTCAGTTCACATTGCATAAGGTAAAAATTGGGAATCTGTTAGGAAA
AGGTGGATTACATTTAGAAATTTAAGCACTTACCAACATTGACTTAGTTTAGCCCCTTTT
GAGAATCTAGCTTAGAGGGACAAAATAAAACAAGTAGTTATAATAGTTACATTAATATAG
TAGGGCATATGAAATGAAACCAAGTACTGTTTGCTTTCCTTTGTTTCAGATGGAGGAGAT
GTATAAGAAAGCCCATGCTGCTATACGAGATAATCCAGTCTATGAGAAGAAGCCTAAGAA
AGAAGTTAAGAAGAAGAGGTATGTGTCTTACTATTGTCTTTTCAAGAGAAACAAGTTGGG
AGTGGTTCCCATACTGCTTGCTCTAGTCTTATCTAGTGGGTCAGAGTCTCAGTGAAGTAG
TGCAAACTCGATCACTAGCTCTGCCTGATGTGGCAGAAGCTAAGGGAACCAGGTTTGCTA
AAGTAATTATGGTGATAGAAATGTACTAGCCTCAGATGTTACTGAGGTTGCCCATTCTAT
CTTAGTACAGTATAAGTACCATTTACTGCATTTTTTATTGGCTACCTTTAAAAAGTTGCT
TTTTGTTGGTCTTTCATGGTTTGATTTTGTTAATGGAATAGAAAATAATATTTAATGAAC
ATCTAAAATTAAAAGCATAACTTCATGCTTTTAAATTTTTAGAACATTTTTATGTATTTT
TATTGTAAGTAGGCAGTTTATATAAATCCATAGGGTTCAAAGTGATATAATTTGTGAATA
TAATGTTCATTAATGAAATCAAGCTAGTTAACCTAGCACCTAAAATACTTAATATTTCTT
GTGGTGAGAATATTTAGAATTTATTCTCAGCTATTTTGAAATGTATAATACTCTTTATTA
TTAACTCTATTCACCACACTGTGCAATAGAACTAAAAAAAATCATATTCTTCTGCTTGAG
ATTTTGTATCCTTTGTCCGTCTGCCCATTCTCCCTACCCCTCCAGCCTCTAAAACCAACC
ATTCTACTTTCTGTTTCTCTAAGTTTGATTGTGTTTGATTCCACAAATAAGTGAGAACAT
GTGATATTTTTCTTTTTGTCTGTCTTATTTCACTGAGCATATCGTTTTCCAGTTCCACCC
ATGTTGTCACAAATGACAATTTCATTCTTTTTAAAGGTTGAATAGTATTGCATTTTGTAT
ATATACTGCAGTTCCTTCATCCATTCATCCATTGCTATTAGGAGTAGTGTTGCAGTGAAC
GTGGGAGTACAGATCGATTCTCTTCAACAAATTGATTNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTATAGATGGAACCGTCCCAAAATGTCCCTT
GCCCAGAAGAAAGATCGGGTAGCTCAAAAGAAGGCAAGCTTCCTCAGAGCTCAGGAGCGG
GCTGCTGAAAGCTAACCAAACTGCAATTTTTTATGAGGATTTTTGAGAAATGTCAGACAA
TAAACTTATTGAATAAGCAGCTAGTTGTGTGTCAAGCTCTTTTTGTTATGGAACTACAGA
AAATATCCTAAAGTATTTTTATAAAGGCAAAAGAGTTCACAGGGTTTTTTTCTACAAGAA
AACAGGTGTAGCTTTTTCAGAAAAAAGTGGTCTTGCATGTTTCCAACACAGTTCACACAT
ACTTGGGCTTCTGTTCTCCCTGATAGGAGTTGTTACCCCTCACATTTTATGATGTGCAGC
TCTCCCTAAAAATCTGGTAAGCAATAGACCAACCATCACTGGGAGATACTTCCATCCATT
TATTACAACCAGATGATTAGTGGGAAGAGAAAAGTACCTTGAAAGTACAGTCTTAAAACT
GGTGCTGATCCATGGCTTTAATTTTTGAGAGAAAGCCATCTGATGAAGGTTACATAGATT
TAACACATTGACTGCCACACTAGGAAAAAATTTCCCTGGGGCCAGGGTATTTTATTACAA
AAATAGAATAAAAACTTTGAAGACAAAATGATCCTTTCTAATTTAATGAAAAATTTGTTA
TTTTTTATTTTCTGTGTGAGTTATATGCAATTCAGGGTGCACTAGAATTAATTTTTACAC
TGCCACTTGAGTTGTATATGACTCATGACATACCTCATTTGTTTGGGAATTGAATCTTCA
TATGCTTCACAAGGCCTTGGGCTCAAAACTAGCATGAATTAGGCCGGGCGAGGTGGCTCA
CGCTTGTAATCCTAGCTCTCTTTGAGGCTGAGGTGGGCGGATTGCTCAAGGTCAGGAGTT
TGAAACCAGCCTGAGCAAGAACAAGACCTCATCTCTACTAAAAATAGAAAGAAAATTAAT
TGGCCAACTAAAATATATAGAAAAAATTAGCTGGGCATGGTGGCGCATGCCTGTAGTCCC
AGCTACTCCAGAGGCTGAGGCAGAAGGATTGCTTGAGCCCAGGAGTTTGAGGTTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 2250..2319, 2409..2524, 4098..4232, 5651..5853, 7061..7238, 9709..9797, 10955..11054
1001..1003, 2250..2319, 2409..2524, 4098..4232, 5651..5853, 7061..7238, 9709..9797, 10955..11051
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved