Microcebus_murinus Locus ENSMICG00000009318
snOPY snoRNA Orthological Gene Database
Microcebus_murinus ENSMICG00000009318
Microcebus_murinus
ENSMICG00000009318
GeneScaffold_398
SNORD32, SNORD34, SNORD35
4003..4084, 5085..5155, 5368..5452
6969
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTTTGGAGGGGGGCCGGGCT
CCCCTTCCCATGCACCAAGAGCACACAGCCTAAGCAAAGTGCAGGAGTCCAGAAAATGAG
TGGTTCCTCTGGGACACACAGCATGATTGATGTGCAACCCAGGCATCTGCCAGTCATTCC
CTCACTCACTTCTTAGGTCTCACAAGAGATAAATTCCCTTCACTTATTTTACAGATGGGG
ACACTGACGCCCAGATAAGGCCAGGGGTTTGCCGGGGTCACGGTGAGGTCGACCGCACCG
GGGAATCCAGACTTCTAAGCCTAAAATTGAGCAGTAAAAGGCGGGGCTCGTTGCCCCCTG
CGGGCCACCACATGCCCTGCAGCCTTCTGTCGCTTCGGGGGGTAATGGCGCCTCCCCTCA
CAAACATGGCGGGAAAAAAATCGCGTGATCGAGATTAACAGCCCCTTAAAAATATGGCCG
CCCAGGCGGGACAGCCCCGCCCCAGCAGCCCCGCCTCCACGTCCCACGTGATCTCTCGCC
CCTCACTGCCGTGGCCGCCAGGGCCTATCGGAATGGTGTTCGGATTGGACAGTTAGATGT
CCCGCCTTCCAGTGGGGCATCTCTGCGCACGCGCACAACATTTCGGCCAATGAAGAGAAA
GCCGCCCGTGCAGCCCGTTTCGCGTCACTTCTGCCACCCCTGTTTCAAGGGATAAGAAAC
CCTGCGCCAAGACCTCCTTCTTTCCCAGGCGGCTGCCGAAGATGGCGGAGGGGCAGGTGT
GGGCTCCGCGCGGGCCGGGGCGGCACGGGGCAGGGTGGGATCCAAGCCAGAACCGGGTTG
GGTACTCTATCTTCTTCAACATGCGTTGTCAAACTTAGAGTCGATAAGTGAACAAAATTG
AGATCTTTGGGGGCAAGGGGAATCTGTAGGAAATGGTTAGGTTGTTTTTAGGCAGGCCTA
AGGTTCACTAAAACGCGGCATTTTATTCTCGAGGCGAGGGGTAGTTGTAGGAGCTTCCAG
CACAGGAAGAGGTGTTAGTGTTAGCACAACTAGACCTCGCTTACCTTGGTCTCTGGTAGT
GGGTGCGGGCGCTGGGGTCCGGTCTTGGCCGAATTGGACCATTGTGTGTCCCCAGCGATG
GCGAACTCGTGGAAGTCTGGGCGGCTTCGGGGCAATGAGAAACTGAGGATTAGCCAAATG
GAAGGTATTTCCATCCTGTCCAATGCGCGGGCTCCTTTAACCTCACGTGGGACTGTTAAT
CAGGGTTCTCCGCACCTCTGGTTATTTTAATATGAAATCCCTTTCCGCAGGGGGTCGAGA
GAGTGCTAAACTACGGACATTCAGGAATGAATTGCCCTTTTCTCATTGTTTCGGGGTTGG
CGATTGCCTGGGAAGGGTGTTACGGTTGGCAGCAGGGCTGTGATAAATGGTTCCACAATT
ATGGGACGTCCTTTAGCCATACGACCACCTGGGGCCCCTTAGAGAACACAGCAAAAGCTG
AGTTCCTGGCTCTTGGGGTAACTGCTTATATATGAAGGAGAGGCTGGCTCTGGGAAGGGT
TTCCTCGTGAATTCTTTTGTGTGGTTAAGATGGGAAATGAAGTTTTCAAGCAGGGCTGAC
CTAAGCAAATGGTAGAGTTCACTGAGCATGTGTCCCTGTACCTAGCACAGTTTGGATTGC
ATTGTTTGGTGTAGTTCAGCTAACTTAGTACTCCTGAGGCAGACCTTGTTTTTTTCATCT
TACAAGAAATTGAAATGTGGAAGGAAACTTAGATTTTTTTTTTTCTAGACAGTCTCACTC
TAGCCTGGGGTAGAGTGCCGTGGCATCAGCCTAGCTCACAGCAACCTCAAATTCCTGGGC
TTAAGCGATCCTCCTGCCTCAGCCTCCCAAGTAGCTGGGACTACAGGCATGCGCCACCAT
GCCCGGTTAATTTTTTCTATTTATTTTTAGCTGGCCAATTAATTTATTTCTATTTTTAGT
AGAGATGGGGTTTCCCTCTTGCTCAGGCTGGTCTCAAACTCCGGAGTTTAAGCGATCCTC
CCGCCTTGGCCTCCCAGAGTGCTAGGATTACAGATGTGAGCCACCGTTGCCGGCTGAATC
GTGGAGTGTTTTGGCAAAGGTCACATTGTCACAAAGTCAGGCTTTGGGATTTAGTGTTCT
TCTGAATTCCTTTCCAGCACTTACAAAGTATGTACAATAGGTTTTTTTGTTTTGTTCTCT
TTTTCTCGTTTTTTTTGGCACGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGG
TAGCTGGGACTACAGGCACTGCCACCGTGCCCGGCTAATTTTTTTCTATTAGTGTTGGCT
AATTTTCTATTTATAGTAGAGACAGGGTCTCGCTCTGCTCAGGCTGGTCTTGACTCCTGA
GCTTAAGCAATCCTTCCACTGCCTTGGTCTCCCAGAGTGCTAGAATTACAGGCATGAGCC
ACCACGCCCAGCCTACAATAGTTATTAAATGCATTATACTTTGTGACAGCAGGGGCTAAA
GTAGGGAGTTGAGGATTGGTGCCTGAGCATTTTACCTGGGGAGGCGGAGTTAGTAGCAGA
ATCAGTGTGGGATTTTTGCTTTTGCCTAACCTCATTCCACCTGAAACTTGGTTTCCTTTT
TTTTTTTTTTTTCTTTTTTAACTCCACTGACAGATTATGTGGTGAAACTTGGTTTTCTTA
GTTGTGAAATTAGCAGAAGAGAATTAGGTTCTGTTAGGAACCTACAATTTGTATCACAGA
TTACGGGGTTCTTGTAGCTGGGTGATGTGTGGACAGAGTGTTGCTGGTCTAGGTTCAATC
CTAGCTTGTACTTCATTAAATGCAAAATATAATCGCATAAAAATTCATACCCTTCAAGGA
CCTGAGACAAGAGTCTGGCATCTTATCCCATTCACTCACCTTTTGCTTTCTTGGCCTTGG
TTTCCTTTCTATAAAGTGGGCCTTGGCTAACAGTTCCAGGTCTGATAGCTGGGCAGGAAG
AACCCTGAGGCTAACCTGCAAGAGGAATGTAGAAAGCAATGATGGCTTGTGGGAAGAGTC
AAAGAAAGGCAGTCAATGCCCTCAAACCCTCTCACCTTGTCTCCCCAGGTCCTGGTGCTT
GATGGCCGAGGCCATCTCCTGGGCCGGTTGGCGGCCATCGTGGCCAAACAGGTACTGCTG
GGTAAGTCTCTGCCCACAGTTCCCGTAGTTAGCTCCACCCGGGAGGTCAGTGATGAGCAA
CAATCACCATCTTTCGTTTGAGTCTCACGACCATGAGATCAACCCCATGCACCGCTCTGA
GACCTACCAGCCTCTCCCTTTCCCACGGGTGGAGACTCCTGGCTGAAGTGACTTTCTGTT
AGGCTGGCTTTTAATTTCAACACGAATCCAGCTCTGCCTGGGACCTGGAGCGAGAGGCCC
TTCTCGGGGCTTTAGCTCTTCTACATTGTGGTTAGTCATGTCCCAGGGAGGGATGTGGCC
CTCTATGTCCAGACAGTGACTGGACAGGTGAGTTGTGCCAGGTGAAGGTAGCATGTTCAG
GTGGCATTGTCTGTATACCCTTGCCCTCTTTGAATGCCTCATTTTCCCTCTAGGCCGGAA
GGTGGTGGTTGTGCGCTGTGAGGGCATCAATATTTCTGGCAATTTCTATAGAAACAAGCG
TAAGTTGGGGCCTGGGAGGAGGTCTCCGTGTGGGGTGCTGAGGCTGGTGGGGTCCCCAAA
AGCAATTGTGGCAGTGGTGGGAGGGGCTAGTTTTGAGTTCCTGAAAAGGCCCTGGAGCTT
TGTGGCAGGGGGAGGGGGTTGGGATTCTGGGGACCAGTGGGTCTGGCAGAATAGGCGGGT
CTCATGCGTGCGCTCCTCCTGCTCTCCCCTCAGTAAAGTACCTGGCCTTCCTCCGCAAAC
GGATGAACACCAACCCTTCCCGGGGGCCCTACCATTTCCGGGCCCCCAGCCGCATTTTCT
GGCGGACTGTGCGAGGTGAGCTGGGCCTGAGGGCTGCATGTGGTGGTGACAGGCGGGTGG
CCAGTGATGAGGACTTCTCCCACTCATGTTCGAGTTTCCCTACCATGAGACAACTCTACA
TGCACTACCATCTGAGGCCACCGCCTGCCTGCCCTGGTGGGGGAGGGTAGGTGTCCCCTT
GAGCCCCACTGAGCAGGCCTGCCATCCCCCTTCCCTGCAGGCATGCTGCCCCACAAGACT
AAGCGAGGCCAGGCTGCCCTGGACCGCCTCAAGGTGTTTGATGGGATCCCACCACCCTAT
GACAAGGTGAGCTGCACCAAGCCCCCAGCACAGCGTCCACGCAGCCGGCGTCCATGATGT
TCTGCGATTACCTACATTGTTTGATCCTCGTGAAAACAGCACTGGCTGAGACGCCTGCGC
CTGCCCAGCTAGGCTCCTTCCCGTCTGTCTCTCTCGCCTGGTTTCTGAGCCCCTCCCTTT
CTCCGACAGAAAAAGCGGATGGTGGTTCCTGCTGCCCTCAAGGTTGTGCGTCTGAAGCCT
ACAAGAAAGGTGAGTGCCAAGTTACACTGAGTGGTCTAGCTTAGGGACTTCAGGCCTGCT
GGGGGGTAAACCTGAGGTCCCTGGTCCTGGCAGATGATGTCTTTCTCACGATGGTCTGCG
GATGCCTCTGTGGGCAGTGCCGATATCACCAATGGTTCAGCTGATGCCAGGACGGGTGGG
AGAATGTGTGCTTTCCTCACTGGGGCTTGATGAGGACAGTTGGATTGTGACATTCCCAGA
GTCCTCTAGGATCAGTGACAGCCTCCCCACTTAACTAACCCTGTGGCCTAGTGCAGGCTT
CTGGGACTGAGGCCATACGTCCTTACAAGTTTATTTCTCCCTAAAGTTTGCCTACCTGGG
TCGTCTGGCTCATGAGGTTGGCTGGAAGTACCAGGCAGTGACAGCCACCCTGGAGGAGAA
GAGGAAGGAGAAGGCCAAGATCCACTACCGGAAGAAAAAACAGCTCATGGTGAGGGCAGG
GGCTGGCACCCCGGGGCGCACTGCACCACTAGTCGGGCTGCTTCCAGAGGCCCAGAAGGA
TGGGAGGAGATGAGGGTGGTCCCGGGCAGCTGCCACTAACCATCACCTGTCCTTGTCCTA
CAGAGGCTACGGAAACAGGCCGAAAAGAACGTGGAGAAGAAAATTGACAAATACACAGAG
GTCCTCAAGACCCATGGACTCCTGGTCTGAGCCCAATAAAGACTTTATTCCTCATGCTTG
GCCTGGCCTGCCCTTCCTCCATCGCCACCCCGGGATGTGGGGGACCCAGGGGCAGCAGTC
CAGGTGCCACAGGTTACCTGGGACCGTAGAAAGCTGGGGACAAGGAAAGGACCTCAGACA
CTGCACATCTGTAAGGTTAAATCACTGTAGGACTTGTGCAGATGTTATTTATTAACCTAC
TTGTTCATGAGAGTTTTAGAAAAGCGAGAGAACCACCAGTTACTTGAGTTTCGATAATTG
GAGGGGAGCCCTGCCTTCTGAATGGGGCATCTGGTTTAACTTCCTACCTGGTCACATACT
ACACTCCACAGCTGGTAGAATGTAAGAAGGCGCTTAAGGGGGGACAGTATGAGCTTGGTG
TTGTACAAAGTATTTATAGATGCACAGATTGTGGGAAGATAAGATGTACAACCAGGGGGT
GACAGGCATCACCTGATCCTTCCCCTATATTTTGTGATCCAGAAACAAATAAATTGCTTT
CAAAGAATGTGGCTTCTTTGCGGTATGTGTCTGCTGCAGAGGCAGGCCCAGGGAAGGTGA
GGGGCTTGAAGAGGGTACAACTTGCTATGCTTAATTCTTTTGACAGATTAAGTTAATAAC
CCTATGGGAGAATTAAGAATAAGCCCTATGGGAGAATTAAGCTTTACAGAGACCACTTAG
CAAAGATGTTTCTGTAATTTCTATATTGTAAATGATCATGGTCTGCAGTGCCTGCAAAGC
TAGCTCATTCTAATTCAGCTGCAAAGTATGCAATTGCCAACGTTTTTAAGCCAATCCATT
GCCTGACATAGGGCTACTCAAGTCCAGGGGATGTGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 3888..3960, 4373..4438, 4653..4754, 4960..5045, 5229..5288, 5626..5748, 5883..5969
1001..1015, 3888..3960, 4373..4438, 4653..4754, 4960..5045, 5229..5288, 5626..5748, 5883..5966
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved