Microcebus_murinus Locus ENSMICG00000012765
snOPY snoRNA Orthological Gene Database
Microcebus_murinus ENSMICG00000012765
Microcebus_murinus
ENSMICG00000012765
GeneScaffold_2228
SNORA64
1444..1575
2959
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCTTGGGACCTCAGATT
AGCCTCACCGTGGCTTCTCTTTCCTTGAGGGGCGCAACAGATCCTGGGCGTGGGTACTGA
GGCTGTGTGGGACCGCCAGCTACCTCACCATTTCTTTGCAGGCGTTTGTTGCCATCGGGG
ACTACAATGGCCACGTTGGTCTAGGTGTCAAGTGCTCCAAGGAGGTAGCCACTGCCATCC
GAGGGGCCATCATCCTGGCCAAGCTCTCCATAGTCCCCGTGCGGAGAGGTTACTGGGGGA
ACAAGATCGGCAAGCCCCACACTGTTCCTTGCAAGGTAGGCCAGGGGCTGGTGAGTGTTG
GGTCTGTGGAGCAGAGACTCCCTACCCTGGTCTCCTGACTCCTGCCCTTCCCAGGTGACA
GGCCGCTGTGGCTCTGTGCTGGTGCGTCTCATCCCTGCCCCTAGAGGAACTGGCATTGTC
TCAGCCCCTGTGCCCAAGAAGCTGCTGATGATGGCTGGTATCGATGACTGCTACACTTCT
GCCAGGGGCTGCACTGCCACCCTGGGCAACTTCGGTAGGTGATTTACACATGGGCTGGCC
ACAGCTTCTCTCAGCTCCGCTTGATCACACAGGCCTAGTGTGTGCTTGGCGTATTTCCAG
GGAGAGAGAGGAAGGCTCTCCTAATGCACGACAGAATGCCCACAGTGGCTTCTCTGTTCC
TAGGAGTGCGACATCTTCAGGTCCTGAGGTGGAAGACTTGTCTCAAGTCACACCACCAAT
CTCTCTCCTGATGTTTTCTGTCCTCCAGCAAAGGCCACCTTCGATGCCATCTCCAAGACC
TATAGCTATCTGACTCCTGACCTTTGGAAAGAGACAGTATTCACCAAGTCTCCCTACCAG
GTACTGCCAGCCTGGCCAGTGGGGTTTAGCTGTCCTTGGCTTTACCAACATCCAGAGACT
GGGCTGTTTTGGTCACTGCCTAAGCCAAGCACAGGGGGTGGTGGCATCTGGCTACAACCA
AGGCGCTGTTTCTTTCTAGGAATTCACCGACCATCTTGTCAAGACCCACACCAGAGTCTC
TGTGCAGAGGACCCAGGCTCCAGCTGTGGCTACCACATAGCATTTTTATATGAGAAAAAT
AAAGTGAAATTAAGTCTGTTAATGGTTGTCTTTTGTCTGTGTGACATGAATTTAGTGGTG
GCTTGAATGTGGAAGGGAGGTGGGACCTCATTAAAATGAATTAGATTCACAGGAACACAG
GTTGCATCAGTTTATTTCAAGAATACAGTCATAGTCATACATGGGGGGGGCTGCACGGCT
GCCTCAGGCAGCAGCAGCCTGTTTTGCAGCCTCTTTTGCAGCCTTCCTCTCTGCCAGCAT
CCTTTGCTTCTGTTTTGCCAGGCACTTTCTGGCACAATAATGGGCCCCCAGTTCATGATC
TGAGAAGAAAAGGAAACAGAAACAGACTGGAGACTCAGTTCTGTTAAGGTCCTTGGGGAA
TCAGTCTTTGTATGTGCAGAGAGGAAAGTTGATGGCTAAGGTCATAAGGGGACATAATGT
ACCTGTCCTGAGATGGACCTAACTGGTAGGCTCTGGGCAGTGGAGCTGGCCCACAGCTGT
GTGGAGACTGGACAGGCCAGAAGGGAGTGAGATGGCAAGAAACATTCGTCCAGGGTGGGG
GGCTCATTCAGGGCTCACTCACAGCGGTCCTGGTAGGCCTTGGCCACCTGGGTGAACTGC
TCCAGCTCCTTGGCACAGTTCTGCTTGTAGCTCTCTGCTTCCCTCTGCTGACAAGCCTTA
AGCCTCTCCTGGATAATGTTGACAATTTCCTGATCGACTTTGCTGAACAAAAAGGGAACA
AGAGAGTTTATAAAGAATTTTTTTCCTGTACCTGGGCAGACTAGAATGAAAGGGCCTTGG
AGCCCCGTGGTCTGCCTCCACATCACCCCCTATTACTCCCAAGGTGTGGCCCAACCCCAG
GAGGCACATTCTGGCTGGCTGAGGCCATCTCTGGGGTATCCCCAGGAGTGGCAACCAACC
AGCCAGATGTGCTGTGCAGGTCTCCACATTCCCTGTTCACGTACTAGTCCCTTCTCCACT
GCATTTCAGCTTCAAACATG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1174, 1254..1413, 1648..1737, 1877..1959
1001..1174, 1254..1413, 1648..1737, 1877..1956
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved