Microcebus_murinus Locus GTF2A1
snOPY snoRNA Orthological Gene Database
Microcebus_murinus GTF2A1
Microcebus_murinus
GTF2A1
GeneScaffold_747
SNORA79
2251..2394
25682
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAAAGGGATTTATCAATCCTTGGCATAATG
GAAGAAAGGGAAATTTCAAGAAATGTGAGGGATTGGGAAAACCTCTAAGGCCTTCAGGCA
TTGCTATTTCTTTTTTCTTATGTAGGATTGGACAGATGGAAAGTTGGGCTTTTCTAAATC
AGGGATTGCCTCTGTTTCTCATTTTCTAGATGGATTTATGTTCTGTCTATGTTATTTAGA
GGCAGAAAATTCTGTGTTAAGGAAAGAGTTCCATAAAAATACTTACAATAATGTTTTTGA
TATTATAGAGGATACTCTTTAATTACTAAAAAAGTTGCTTATATGAAACTCTTTGCTAAA
TAATATCTGATAATTAAGGGATTACTGTAAAAAGATTGTCAAAGATAAAAATACAAAAAT
TCTCCAGTATCTGAAATGGCAAAAATGAGATTTGATACTTTAAAAATTTGTTTTCATTAT
TGTTTACATTGGGGTAAGAATTAGAGATTGATTATATTTTTGTGGCTGTATCAGCTTTTA
AAATGAAAGAATTTTATAAACAGATTAATTAAAAATGTTTTATCCATATATCCAGAGTTA
TTTTTTTTCCACTTAGAAATCTTTAATATTCTTTGCCTTAGTTATGGGAGAATAAACTAA
TGCAGTCTAGGGCAGTAGATGGATTTCATTCAGAAGAGCAGCAGCTTTTATTGCAAGTTC
AGCAGCAGCATCAACCCCAGCAGCCACAGCATCATCACCATCACCACCATCAGCAAACTC
AACCTCAGCAAACGGTACCTCAGCAAGCACAGACCCAGCAGGTCCTTATTCCTGCATCAC
AGCAAGGTAAGAATGGATTTGTTTTCCTTCTTAATGATTTGGAAATTACATTTGTTATTT
TGAAAGATGAGAAGTACTCTGGGTTTCTTGGACCTTGTTTTTAAGGAATGTTTGGTGTAC
CTTAAAAAAAGAGACTATTGATTTTGGTTTTTTCTTCCTCTTTCTGTTAGCTGAGAAGTA
TATGTATGTATAAATTTGTATAAAATGTGGATTCTATTTACCAAGGGCTTTATATAATAA
AATAGTTGTCTACTTTCTTTGTGCAACATGCTCCTTCAAAGACATGTTTTAGTTTAGTTT
TTATGACTATATTCTTATTTTTTTATTTTTATTTTTTGAGACAGAGTCTTGCTCTGAAGC
CCCACAGAGAGTGCAGTGGTGTGTTCATAGCTCACTGCAACTTTGAACTCCTGGGTTCAA
GTGATCCTTCTGCCTCAGCCTCCTGAGTAGCTGGGACTACACGGGCATACCACCGTGCCC
AGCTAATTTTTTCTATTTTTAGTAGAGATGGGATCTCCATCTTGCTCAGGCTAGTTTTGA
ACTCCTGACCTTAAGCAATCCTCCCACCTCAGCCTCCCAGAATGTTAGGATTATAGCTAG
ACTGTGTCCTCCTTAGTGCTTTGCATTCTGCAATTCATTTTATAGATACTGTTTTACTGA
TGCCTTGTAAGAGCTTGTAAAATAGCCCTTGGCTCCATTTTACAGCTGAGGAAAATCTGG
GCCCTGAAAAAGCTAAGGAGCTTTATCCATTACATGTAGCAAGTGTTTTCCTGTGATGAC
AAACATATATTCAGTTATAAAACTTTCTAGTCCTTCTAATTCAGTGAATCTACAGGTACT
GGAAAGGTTAATGAAGGTAATTGAAAAGTTTAAGATAATCATTTAGTTACCATTTGCCCC
ATCTCAGAGTATATCTAAGACTTAAAATTGATAGTAATACACAAGAGAAAGAGCTGTTTG
GGTTATTTCACTGTTTATGTCAAATAAGACTTTTAATACCAGATTTTAATCTGTACCTTT
TATCAAATAATTTTATGCTTTAATCATTTTTTGATGACTGTTCCTCCTATTGCCTTCAAG
CCTGGCACTAGGATTTTAGGTCATCATAAATTAAAATTTGATTTTCTTCACTCAGAGAAT
ATTGGGATAATGGGATTATCTGTCTGTTCTCTGAAATTTGCGGAATCAAACAAATTCCTG
TTTCCCTTAAATAATATTACCATTATTTCTGATTTGTATTTTTAAAACAGCTGATGAAAG
TAGCAGGCTTCTTTCTGGCAACTGTCATATGGGGAGAAAGGACTATGTAGGTTAAGAAAA
AAACCAGTTGTAACTTCTTGAGTTTACTCGTTTTTTTTTTTTTTGTTTTTGTTTTTTTGA
GACAGAGTCTCACTGTGTTCCCCCCGGCTAGAGTGCTGTGGCGTCTGCCTAGCTCATAGC
AACCTCAAACTTCTGGGCTCAAGCAATCCTTCTCCTCAGCCTCCTGAGTAGCTGGGACTA
CAGGCATGTGCCACCATGCCCAGATAATTTTTTCTATATATTTTTAGTTGGCCAGCTATT
TTCTTTCTATTTTTAGTAGAGACGGGGTCTCACTCTTGCCCAGGCTCAAAAGATCTGCCC
TCCTTGGCCTCCCAGAGTGCTAGGATTTCAGGCGTGAGCTACCCCATCTGGCCCTTGAAT
TTACTCTTAACGGATTAGTAACTCATTCAACAGTGATATTATTATGTCAGTATAACAGTT
AATCTGAATTAGCAAGACAAGATTAAATTGCGTGGGCAAATGTACAGTTTACTTAATGCT
CAGAAATGCATTAATGTGTTAGGTATCTCCACTACTTCACGTTCCTAAATTGTCTTGCAT
CCATAGGAATTGTCACTTACATTGTTTTTGTTGTTTTCCAGTATAGGGTGGGCACATCAC
AGCTGTTATTTGCAGTAGAAATTTATAAAATTTATAACATTAGATATCAAATGATTGAGA
GCATTTGAATGCAGAAAAAGTGGAAAACATAAAAAAGTTTTCAGCATTGTATAGCATTCT
TGTGATTATAAAATAGCCTCATGGTTTCTTGTTTGCATGTTTCTTTTTTGTAGCCACAGC
ACCACAAGTTATTGTTCCTGATTCTAAGCTGATACAACATATGAATGCATCAAACATGGT
AAGACTCAGAATGTAGCACTTTGATTGGCTCTGCTTATTCTAATCCTAATCGAGATTATA
CCTATGTATAGTGCATATTAACTTGAAGTTCATTGAAGACTTGAATGAAACAGCTATTTT
ATTTAGTTTTCTGAATATTGAATTTAGCAGCAAATATAAAGTTTAGCTTGCTACTTATAC
ATGAAAGTTTATAAAGTTATGCAGTTCTTTGTTTAAAAATACCAAAGAAATGGTGCTTTG
TGAGAGCTATTTCATCTCCTACTATGAAAAGCAGGTTTAGGACCTAACCTATTATGCTAA
GTATAGTTCTATTTCAGGAGACCTATTAATTGTAAGAGATCAGGAATGCTAAGAATNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGTCTGTCTGTCTGTCTTTTTTTTTTT
GAGACAGAGTCTCGCTGTTGTTGCCCAGGCTAGAGTGAGTGCCATGGTGTCAGCCTTGCT
CACAGCAACCTCTGTCTCAGCCTCCCGAGTAGCTGGGACTACAGGCATGCGCCACCATGC
CCGGCTAATTTTTTCTATGTATATATTAGTTGGCCAATTAATTTCTTTCTATTTATAGTA
GAGACAGGGTCTCGCTCTTGCTCAGGCTGGTTTTCAATTCCTGATCTCGAGCAATCCGCC
CACCTTGGCCTCAGAGTGCTAGGATTACGCCTGGCCCATATTTTTCTTTTTGATAATATG
GCATCTTAGAAGAAGTGAAGATACAGTGTTTCTATAGGTACCTGTTGCTTCTAGTAGAAA
TTTAAAAAGTTAAGAATTCTAAAAAGAAAATACTTACACTTTTGCCTCAAGTGTATCGAT
TGAAAACAAGGGATTGAGGGTAAGGAAACAAAGAGTGGGAAAGGAAGCAATAATGGAATA
GTTAGCATTGTTTATGTGCCTGTTTTCTAAAAATGTATAGGTTAGATTGAGTATAGGAAG
GTTTGGTACTTTAAAGAAGATTGAAGGGAAGGGGAAAAGAGAACTACAGTATTTGTAAGT
TTTCTTTAGAGCACATTCTCTTGGGAAAAAAACAATTATTGTTCTATTTAATTGCTGGAA
ATAACTAGGTCTTTTTTGCCATTTTATAAGATAGGATTTGGTCTTATTGTTGGAACTTTT
CATTTTGGTATATAGTAAACAAAAAATTTCATATACTATTAAAATAGTCTAGAGGTAAAC
AATGAGATACTGCTATGTACATATGTGGCTTTGCTTTGATTTTTTTTCTTTTGTTTTTGT
TTTTTCAGAGTGCTGCTGCAACAGCTGCTACCTTAGCACTCCCTGCAGGTGTGACTCCTG
TTCAACAGATATTAACAAACTCAGGTAATTAGGAATAATGGAACCATTTTCAAATATAAT
TTAGAAAATTGTGCCATCTAGTTCTTATGTTTTATCTTCATTGAAAGATGGGAAATACTA
ATATTTCTTTTACCATTTGGTTTAGGTTATTAAAATAACTTTATTTGAGGGCTGTAGCAC
ATGCAACTGTAATCATTATTGAGGATGCAGTAGAGAAGATGAGAATTGCACTTGAGCTTT
TGATCCGAGAATGATAACCCTGCTATTGAATGGAAGTATGATTACATAAAAACACTTGTT
TACTTAGTTTTTCACTATACATATTTAACCTGCAAGTTAGTTAAACTTGACTCATTTTAA
CTGATTTGTGATATCAAACTAAATCCTATAGTATCTTAAGAGCAAATTTATTGCATGCTA
TTATTGTACGTAGTATCTCTTCATTGACAAAAGTCTGATGTCTAGCTCCTGTGTTTTGGC
ATATTAGTGTTTGAAAAATTTATTTACATGGATTTTAAGAGTTTTCTGTAATCTTAATTA
CATAATTTTTTTATTTGTTAATTTCTAAATTTGTGAACAAATTAGGGACATGTCTTGCTA
CATATTTTAATGATATAATTTGTTGACTTTTTAATTCAAGATTCTGGATCATCTAAAGCA
ACACATTAGGGGGTTTTGGTTCTTTGTAAATAAACTAGTCATACAATTAGTGTTATGTGG
TGATGATAATTAGTTCAGCAAACTTTTATTGCTTTTAAGGAATTTTGAAGCAAAGTACTG
TGGTGCTTTGGTTTAGGATATTAAATGAATTATTATGCCTTCACTTCTTTAAAGCTTTAG
AAACCAACAGCCCCTGAAATGTCTGATCTTACTGCTCTTTCTTGACTCCTACCATGTTAG
CAAAGATAATTTAAGCTTTTAATCAGGATTCATAATCTATTGTTAAAACCTTATTGGAAA
ACAGCTGAATGAGAGTGATAAATAAGGAAAATAAAACATTGTAAGCAATATATTTGACAC
ATGGAGGGAAGTCAGGGAAGGGAAGGATTATAGTTTACTGTGTATGGATGATAGCCCTTA
ATAAAATTGTTAGACTTCCTACTTGATAATTTCTAAGGCCTTCGGTGGTTTGACATTCAA
TATGAATTCGTTTATTTTGAGATAGTCACTGCTAAAGTGGTAACTTGGAATACATGCTTT
TTGCTTTAGGCCAGCTTCTTCAAGTGGTCAGAGCAGCCAATGGTGCCCAATATATCATTC
AGCCTCAGCAGTCAGTGGTTCTGCAGCAACAGGTTATACCACAAATGCAACCAGGTGGAG
TACAAGCTCCTGTTATACAACAGGTAAAAGAATCTTCCCTTATGATCACCATGGGATTCT
TTTTTCTTCTATATGAATTCCCTAATTGGTTCCCCTTTCTTTCCCCATGGCTATATGTAT
ACAATTCTTAGACTCTTCTCCATTGCTACAGACCCTGTCATTTTAAATTTCTTTTGTATA
CCTCATAGCTTAACTCAGATTCAGTGTGTTTAAAACTTAATTATTATTGTCTCTGCACAT
CTTTCATCATCCCCCTGAATATACTTTTTTTGTCAGTGGCTGCACTCTCCATCCAGCCTT
CTAAGCTGGTCCTTTGGCCTTTATTCAACAAGCAGTTACTGAATATTGAGGTTTTCATAA
GGGGCTGGGGATTTAAGAGTGAACAAAGAAAGGGACTCTAGTTTCATGATGCTTATGAAT
TTTTGGAAGGGGGTGTGTGGAATCCTCTCTTTCCCTTACCTCCAGTATCCAAGGTATCAT
TACTACCAATTCTTCTTAATAGTTTCTCTCTCTCTCACTTTTCTTGTCATTGCCTTAGTT
CATACTGTCATAATTTGTCATTAAAAAATAACTATTATCCTCTTAACTGATTCCCCTGTC
TCTAGTCTCTTGTCCTCTTAACCTGACTGATTTATAGTCATCTTTCTAAAAAACCTTAAA
ATTTTATAGTGACTTCCCATTGCCTATTGGCAAAAGTCTAAACCAGGCATCCCTACCCTT
TCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGATACTGAAGG
GAGGAACTTAAAAATATCTGGTCTGTGGTCTCAGCTATAGTTTCATGATAGAATCACCTG
GAGTGCTTTAAATAAAACCTCCAGCTTTTATCTCACACTAATTAAATCAGAATATTAGGG
GTAAGGCTTAGGTATCAGCATTTTTTTTTTTTAAGCTATACCAGATGGTTCTAATTTGCA
GCCAGGGTTGAGAACCATTGGTTCTAGTCTAACAGTGAAATGATGATAGAAGCCAAGAGA
GGTTAAACGATTTGCCATTGCTGTGTCAATATTGCCTCTTCCAGGTCTTCAGATTCTCAG
TCGAGTGTTCTTCATGTGAAGGCACTGTAGCATAACAGTAAGAGCATGGACTCTGGACCA
GAAAGCTAAGGTTTATATTTTGCCTTTTAGTGGCTGTAAACTTTGCAAGTTACTGAGCTT
GTATTAACTAACCATATCCTCCTCAAGCAGATAAACTTGTGTAAATCTTGGCCTGATGTC
TGGCATATTCCTAGTAAGTCCTCAATAAATGAAGCGATATTGTTAGAAAATCTTTTTCCT
TCAGAAATTTGAATGGTAAATTGGAAATTTAGTGGATCAGTGTTACTAGTTAAACATTAC
CTTTGTACTGTGGTAGATTTAACTGTGTATGAGATGTGGCCATTTCTGGTGAATCTTAAG
GCTATTTCTGTGTACCATATTTGATCCTCTTATTCCTATTATGTGGTTTTCTTTTGCCTT
AGGTACTCGCTCCTCTTCCTGGAGGGATTTCACCACAGACAGGTGTCATCATCCAGCCAC
AGCAAATCTTATTTACAGGAAATAAGACTCAAGTTATACCTACGACAGTGGCAGCACCTA
CACCAGCCCAAGCACAAATAACTGCAACTGGCCAACAGCAACCACAGGCCCAGCCTGCTC
AAACACAAGCTCCATTGGTGTTACAAGTTGATGGAACTGGGGACACATCATCTGAAGAAG
ATGAAGATGAAGAAGAAGACTTTGATGATGATGATGATGAAGAGGAAGACAAAGAGAAAG
ATGGAGCCGAAGATGGGCAAGTGGAAGAAGTAAGTTTCTAGTAAAAGAATTGAAATAATA
ATCTATTCAATTACTTGGTACCAAACTGACAAATTTTATCCTTTTTTCCCCAGAGGCTGT
TAGATAGTATATAACATAGGATTTTAAAGATCAAGTTAAATTGTTCTAACTTTAGTAAGG
TTTTTAGATTATCTGGCTATATTTATCTTTATAAAATATAATTGCTTTTATAGCTGATAA
AAAAGAATGTTTACCAAACTATTAATAAATTGTATTAATAAAGGAAATAGAGATGGTGCA
AATATTTCTAACTCTTTGGCTTATGCATTTATGTGGCTTCAAGGTAAGACATTGGTAGAA
CAGATAGACGTTCTACCAATCTTTTGCTTCAGTAATTCCATATCAGTACTATAATAACCT
CACCTACTCGTATCTATCTTCTAGAAACATGTAAATACGTCTTTGTTTTCCTCTTTAAAC
TAGACACGAGTAACTAAACTAGAACAGTTACTTGTGTCCAAGATGTTTGTCTACCACAAT
TTTCATGTTGATTGCGTTTTGTAGCCTAAGATGTGGTAGTCTTGTTTATCTTAGTACAAA
GTTTTCTAAACTATCTAAGTAGTTTTTTAAAAAATAATTTCTTATTAAATATTGAATTAA
GAATAAAGGAATAAAAAATATTTTAAGATGTAAGTACACTAGTGCTCACTATCTAGTTAA
AAAATAAATCCCATTACTTAAAGTCCCCTTGGTTCTTCTCCCCAATCCCATACTCTTCCT
TCTGCCATCAGAGTACTCATGCTCACTCCTTTTGTGTTTATCATTAATTGCCTTTATATA
TTATCATAAGTATTTATATTCCTAAACAGCATATTATTTAGTTTTATATATTCATTTATA
ACATGAATGGCATAATTCTGTTATCTGTTCTTCGGCAAGTTGTTTTTTTTACTCAAGATG
GTATTCCTGAGGTTCATCCAAATTGTCACATACAGCTATAAATATTTTTACTGCTGAATA
TACCATAATTTATTTAACAATTTTTCTGATCTGGTGGACATTTGGACTGTTTCTAATTGT
TTACTGTTATAAATAGTTATGTTTTATTATGTGTCTTCTGGGAACATGTATGCGAGAGTG
TTAATACCTAAACATTGAACTGCTGATCCTAAAGCATGTACATCTTCAACTTTGCAATAA
AATACTACATCACTCGAGCCATTCAGTATGTAATAATAATTGTGCATATGTCCACACATC
CTCACCAGTACCTGATATTATCAGGCTTCTTAATTTTGGCTAGTTTGGTAGGTAGAAATG
GTGTCCTATTATGGTTTTAGTTTGCATTTCTTTGATTACTAATGAGTTTCAGCCTCTTTT
TATATAATTATTTGTTTGTGTCTTATGTGGAAGTGCTTATTCAGGGCTCCTGTCCATTTT
TATTCCCGTAATTATTTATAATTTTGATGCTGCTCTAAATGACATGTTTTCATTATGTTT
TCCATTTGTTTTTTGGTAGTATGGAAATGTGTAGATCTTTTATTTTTTATAGATATATAA
ATTATGGGATACTAGTACAAATATGGTAAATATCTTGTGGTCCCTTAGGGCTTTTAGGTT
AACAAATGTGTAGAGATTTTAATATTCATCCTTGAACCAGCCACTTTACTAATGTCTTTG
TTAATTCTAATAATGTATCTGTAGACTTTTGTGTCTCCTATGCAGATAATCACATCACAT
GTGAAAAACAGCAGTTTTTCTTGGCCTTGTAGGCTATGCCTTCTAGAGCTATATAGATTA
GATATGGTGATAGCAGGTAGCCATGTCTTGTTCTTAAAAGTAATGTTTTCTGTGTCTGAC
TATTAAGTATAATGTTTGTTGTAGGTTTTTATGAATATGTTTATTGGGTTAAGGAAGATT
CTCTTTGTTTTATTTTTTATTTTTATTTATTTATTTATTTTTTTGAGATAGTGTCTTGCT
TTTGTTGCCCAGGCTAGAGTGAGTGCTGTGGTGCGCAGCCTAGCTCACAGCAACCTCAAA
CTCCTGGGCTCAAGCAATCCTTCTGCCTCAGGCTCTCAAGTAGCTGGGACTACAGTCATG
CACCACCATGCCCGGCTAATTTTTTCTATATAAATATATTAGTTGGCCAATTAATTTCTT
TTTATTTATAGTAGAGATGGGGTCTCACTCTTGCTCAGGCAGGTTTTGAACTCCTGACCT
TGAGCAATCCACCCGCCTCGCCCTCCCAGAGTGCTAGGATTACAGGCGTGAGCCACCCGT
GCCCGGCCTGTTTTATTTATTTATTTATTTAAGTTTTATTTATTTATTTATTTTGAGACA
GAGTCTCACTTTGTTGCCCAGGCTAGAGTGAGTGCTGTGGCGTCAGCCTGGCTCACAGCA
ACCTCACTCTCCGGGGCTCAGCGATCCTACTGCCTCAGCCTCCCGAGTAGCTGGGACTAC
AGGCATGCGCCACCATGCCCAGCTAATTTTTTGTATATATATTTTTAGTTGGTCAATTAA
TTTATTTCTATTTTTGGTAGAGACAGGGTCTCGCTCAGGCTGGTTTCGAACTCCTGACTT
TGAGCAATCCTCCGGCCTCGGCCTCCCAGAGTGCTAGGATTACAGACGTGAGCCACCACA
CCCGGCCCAAACAAAAACTTGTATGTGAATGTTCATAGTAGCACTGTTTACAATATCCAA
AAGGTGTAAACAATCCAAATGTTCATCAGCTGATGAATGGACAAATAAAATGTGATATAT
CTATATAGTGGAATTGATACATGCCACAATAGGGATGAACCTTGAAGACATGCTAAGTGA
CAGAAGCCAGATACAAAAGGCAACATACTACATGAACAGGCAAATCTAGAGACACAGAAA
GCAAATTAGCAGTTGCCAGGGGATGAGGGGAATGTGGAATGTGTGAGTGTTTAATGGGTA
AAGGTAATGAAATGTCCTGGAACTCGTTAGTTTAGTGATGGTTACATACATTTTGAATGT
TAGTGTACCTGCATTGTACATTTTAAAATGTTAAAATACTGAATTATATGTTATATGAAT
TTTACCTTAATAATTTTTTTTTATTTTATATTGGTGATACCTAATTTAAGTTAAAGAATA
TATACACATACAGACCTGTGTGTGAGTAGGTAATAGGCTTAGACTCACTTTATTTTTCAT
TCTACTTTTGTCTTCTCTATCTTCATTTATTAGAAATAGCCTTTATCTTCTGCCACAATT
GAGGTGAAGTTTAATGTAGTCAGTCATTGTATGGTCTAGTTAGGTTTTACCTTAGCCCTT
AATTCTCTTTGATACTGAATTTCCTACCCCTTGCTTTTTTTTTTTTTTTTTTAAATTTTT
GACAGGCTCTTTCTCTCTGGTCTCTCTCTTTTGTGTCTCTCTCTCTCATCTCTCTCTGGT
CTCTCTTTCTCTCTCTCTTTCCCCCTTCCTCTCTCCATTGCCTTCTCTCTCCTTCCCTCC
CTCCCCCAGGCTGTAGTGCAGTGGTGTCATCATAGCTCCTACAGTCTCAAACTGAAGCGA
TTCTCCTCTTTAAGCCTCCTGAGTAGCTGAGAGTACAGGCACATGCCACCATGCCTGGCT
AATTTTTTTTTTTTTTAATTTCAGAATATTACGAGGATACAAATGTTTTCGGCACATGAA
TTGCTTTTGTACAATTTGAGTCAGAAAGTTATTTGTACAATTTGAGTCAAAGTTATAAAT
GTGCCCATCACCCAGATAGTGTGCATTGTACCTGTTAGGTGTGATTTTACCCCAAAATCA
CACCCCCACTCCCACCTGCTTGATTCTGTTGAGTTTTACTTCCATATGTNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCTTTTTTTTTTTTGAGACAGAGTCTCACTTTGTTGCCCGGGCT
AGAGTGAGTGCTGTGGCATCAGCCTAGCTCACAGCAACCTCATCAAACTCCTGGGCTCAA
GCAATCCTTCTGAGTAGCTGGGACTACAGGCATACGCCACCATGTCCAGCTAATTTTTTC
TATATATATTAGTTGGCCAATTAATTTCTTTCTATTTATAGTAGAGACAGGGTCTCACTC
TTGCTCAGGCTGATTTTGAACTCCTGACCTTGAGCAATCCGCCCGCCTTGGCCTCCCAGA
GTGCTAGGATTACAGGCGTAAGCCACTACACCAGGCTGCCTGTGTTGCCATCTACTTTTA
AAAAAAAAATCTGTATCTTTTTTTTGTGTGGGGGGGAAGGACAGAGTCTTGCTCTGTCCT
TTGGGCCAGCTAGAGTGCAGCAGAGTTGTCATAGCTCCCTGTAACGTCTGTAACCTCAAA
CTTCTAGGCTCAAGCGATCCTCCTGTCTCAGCTGCCCAAGTAACTGGGGCTATAGGCAAG
TGCCACCATGCCTGGCTAGTTTTTCTATTTTTTATAGAGATGTGGGTTTTGCTCTTGTCC
AGGCTAGTCTCAAATTTCTGACCTCAATGGATCCTCCTGTCTTGGCCTCCCAAAGAGCTA
GAATTACAGGTGTGAGCCACTGTGCCTGTCCAAAAATTTGAATCTTAATTTTACTTCATG
CCTTTGCTGTAACCATCGTCAGGGTATAGATATACTGATTTGTATTCAGAGACCTAGTTC
TTAATGTAAATGATACAAGCCAGACTATAAGCAACAGCTAGTTTATTGTATTTTTATTGT
TTATTGTATCTTTTCTAACTTCACCATTGTTTTCCTTTTCATACTATTTCTGGTACATAG
TGCCATTGGCTCATTAAAGTTTCATATTTTCTTAGGTCTGCTTCTAGACATCTTAAACAG
TTATTGTAGAAAATTATCTTCCTGTGTTATTTTTAAAGAATAAAGGGAAATAAAATTGAA
CATCTTTTCAGACTTACAAGTTATAAAGTTATATAGCCTATTTTAACTTCTTGCTGAAGT
TTCAAAAATGTTAGCAAACTCTGAAATCATAGCTGATTAACATTATTACATTTCTGGTGT
ATGTATATATGTACCTTTGGCACTTGGTTCTCAAAGAACATCTAGGTCATTGTATTTCTT
TTCTGTTAATATTAGAAAGGCCTTTTATAATAATACATTAATAAATTCTCCTCTTCTATT
TGTAGGAGCCCCTCAATAGTGAAGATGATGTGAGTGATGAGGAAGGACAGGAACTCTTTG
ACACAGAAAATGTTGTTGTATGCCAGTATGATAAAGTAAGGACTTCATCCTCGTATTACT
AATGTTGTTTCTGTTGTAATTTCTTCCCTTTCCTTTCTGTCTTACTGAAACATTTGGACA
GCTAATTAATGCCTCTTGTACTCATTATGAATAGTGTGAAAACATTGTTATAGTTTTGTA
GATTAGTTTAATAGGATAAAACAATTTCTTAGCTTCACATTTGAAAAAGACGTTATGAAT
GAAATGAAAAAGAGGTATGATCCTTTTTCTGTTTAGACTGTCTCCACTTGTAAGCAAAGT
AAACAAAGCCACTTTGGGGTTGTCCTTTAACAATAGCTAACTAAATGGAATAATCCTATT
TTCTGTTTGGCCACAAGTATGTCAAAACCAGAGGGTTTAATTGAATCTCTATAATTGTTT
TTACTGAAAATTTATTAAAATGTTACTTTGCTACACTTTGGTAACATTAGGAATTTTTAA
ATCAAGTTCTATGACAATTAGCCATTGACTTCTTGAATTCTTAATTTTCAAGCAGGATTT
TTTTTCCCCAAGTATTTTTGTTATGCTTATTGGTGTTGAGATTTTTGTTATCAAGACATT
TTAATTGGGATCAAATTTTGTTGACTGTAATTTTTAAATTTGTCATACATGCACATGTTA
CATGGAATTTATAATTTTAGCAGAGGTCTTTACCAATGCTGAAAACTCTGATGGAAGCAG
TTGAGTTTTGTTTGTAATTATGAATTCAATTTATTCATTCAACAAATACTTCTTAAGTGA
CTAAGTGTACCAGGCACTATTCTAGGCACTGGAGCTGTAGTCATGAACATGCAGAATTCA
TGCCCTGCAAGAAGTTTCCTTTGCAGATGAAGAAAATCTTAAATATATGTTGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTTTTTAAAGTATAATCCCAGTGTCTTT
CAGGTTCCAGTCACTTAGTTCATGCTGGAGATAAATTTTTATTCACATTTAGGGTACATA
ATGCTTGTGAATAGGGAATTAAAAGGGGAGATAGGTCTTTTCATTCAACAAACACTGAAT
GTCTATGATACTCCAGGATACTATTCTAGGAGCTTGAGCTACACTAGTGAACAAAACAAC
ACACTCCCTGCCTTCCTGCCTTTGAGAAGCTTATTCTAGTTGGAGAAGACAGTTGCAAAA
ACATAAGTCAATTACATGGTGTTATTAGAAGCTGGTAATTGGTGTGGAAAAATACAGAAC
AGGGAAAGGGAGGGGACAGGTTTCAGTTTTGAATAGGGTAGTCATAGTAGGTCTTTGGAG
AAGGTAACGTTTGAACAAAGACTTGGAGACAGTTCTGCTATTATCTGGTGGAAGAGTCCA
CCTGTGTGTGTGTGTGATGAATGCCAGGGAGGTCCAGTGTGGCTGGACTGGAATGAGGGA
AGGGGAGAGTACAGTACTGGATTAAGTCAGACGGAGGGTCGGGGGTAAATGTTGTGGATC
TCTGTAAGGATATGGGCTATTGTTCTGAGTGAATCAGAAAGTTGTTGGAAAGTTTCAAAT
AGACAAGTAGCATGATCTAATTAAAATTTTAAAAGGATTACTTTGCTGCTTTCCTGGAGA
AGTAGAGTGTAATGGAGGAAGCAGAGGTTGAAATAATGAGACTAGGGGTATGTTGTGGCA
TTCCAACTGTTAGATAATGATGACTCAGACTATGGTAAGACTATGGTGAGAATTAGTTGG
ATCTTGGATTTGTTTTGAAGAAAGAGTGGCTTACTGGGAAAAGAAAGAAAGGTCACTTCA
GTTAATTAAGTTTTACAATTGTCTTCCCCCCAAATCTGTGGGATTGAACATAATTAAATG
CTTTAAGTGAAAGCAAGGATGGAAGTACCCAGAGCCTGCCCTTCTCCTTGGGTTTAGCTG
TGGATGTGCATAGTTTTTGAAATCTGCTGTAAGTGACTGGAAGATCAGTATTCCTTTAGA
TGTTATTTTTTAAATGGCATTATGCATAAAGTTCTATGTTAGGTCTTGAGAACACTATAA
GGAGCTTTTATTTTAGTAGAAGAAATGAGTCTATAATTGTATTATGTAACAAATAATGCA
AGAAATGTCACTGAGAATGCCACTGGGAATTTAGAAGTGAGAAAGAATAGTGAAAGCTTT
GTGGAGGATGTAGTATTTTTGAGGTAGACCTTAAAAATATATGTGTAAACCTGGTAGAGA
TATAAGATACTTTACAAAGAAATATTTTTAACTACATTAATGACCACAAGTAATAAAAGC
TGTAAAATAATACTAATTATAGATGAATTAATTTTTTTAAAAACCTACCTAGTAAGTAAT
TTTGGTTTTGATCAAACTACATTTTATTAAGAAGCAAATTGGCAAATATAGTATTGTATA
AGACAAAGTTTTGTGTTGGTATTTTGTGAATTTTTTTTTGGTTTGGTTTCTGTTTTCTGG
TTGTATATTAATTCTTTTTGTTTTTGTTTATTTAGATACACAGAAGTAAAAACAAATGGA
AATTTCATCTTAAGGATGGCATTATGAATCTTAATGGGAGAGATTATATATTTTCCAAAG
CCATTGGAGATGCAGAATGGTGAAGAATTGCTTCTTTTCTTTTATAAATAAAACAAAGAA
ACTCGAAAAAAAATTTAAAGTGGACAGTTTGAAACTTGGGACATACACCAACCAAAACTT
CATTTCTGCATGTCAGAAAAGTACAGTGGAAACAAAGCTACTGGAACAAAGATAGACCTT
GACAACATAGACACTACTTCTAACTGGCAAGCCATGGAACTGTAGCACCGGGGGTTGTTC
GGGTGGGGGCTTGGGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1205, 3293..3357, 10988..11063, 12249..12382, 14642..14968, 20405..20494, 24575..24682
1001..1205, 3293..3357, 10988..11063, 12249..12382, 14642..14968, 20405..20494, 24575..24679
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved