Microcebus_murinus Locus ARHGEF4
snOPY snoRNA Orthological Gene Database
Microcebus_murinus ARHGEF4
Microcebus_murinus
ARHGEF4
GeneScaffold_1996
SNORA16
19288..19411
42620
CTCCCCCACACTCTTGGGGCCATGATTCTTCTGGCTGGTCAGAGAAGGTTCCAGTCCCT
CAGAGTTGTAGGTGCTGCCTGGCCCCCACTGCTTTTACTAAACTGGGACTTCTGGGCGTG
GGGAGGAGTGGAAGATAACAACATCCAAATACAATGGATTTCCCCCATTCCCTTAGGGGA
CGGACCCCTTTTTCTTCTCTTCAGATCAAGTTCTGGTTGCCCCCCCTCCACTCTGTCCCC
ATCCACCTGCTACCATTTACCTCCAGAGTCCTCAGACAGCTGATCTACACATCCTGTCCA
CGTTTTTAGGTGCATTCAAATGGAAGAGATGGGGTACTGATCTTATTCTTTGTTTGTATA
TGGACGTTACCAGAAACAACTAAAGGAATTATCTCTAAGCACTATTTGCCTACTAGTGTG
AGGAATACAAAAGCAAAAGGAAAGGGAGCAAACATATGAATACACACTATGATTTTTAAG
TTAACACAATAACCTTATAAGGTAGAAAAAACCAGGAGGGGCCAAGTTTATCTCTGGGCA
ATGGAATGGCCATCCCAACCCCACGCAGCACTGCCCTTACAGTCTGAAGGTAGTGTCTGT
GTCATATCATGAGATGTCAGGGACTGCATGGGTTGCATTTTAATTAAGTGCCCCCAAAAG
AATATGCTTTAGCTAAAAGTATCAGTCTTGCTTTTGGGGAAAATACCAGGCTGTGAGGCT
GACCAAGGGGGGTTTGGGAGTCTGAAGACCTTCTTGACAGTCCTCATGTCATGTTGTGGA
ATGACAGCCTGTCCACATGGCCACACAGGCTGCACACTGCAGACCTCGGGAGGAGTTGTT
CTCTTGAGTTTTAATGTGAATGCCCCCTAGAGCTGTGCACACTTTGGCTGTGTGCTCTGC
TCACAGGAAAAGTCCTGGGCAATTAGAAAAATTAGGGGGTAACAACAATAGCCTGTCATT
TCCTTCTTCATCTACCCTCTGCCTGTTTCCTCCTCTCCCAGTGCTGGAGGAAGACGATCA
TTACCTCTGCAGAGTCTTTGGATCTCTCTAGAAGAAGCTGCCCGCTCTCCCAGAGTGCAC
CAACAGGACTGAACCACGTGGGCAGGCCCGAGCACATTCCTGAGACTGGTGAGTTATGTG
CCTCTCTCTTTTGTTATGTTCTCTGACACCCTGGCAAGGACAAGAAGGGAGCATTGCTAG
TAGCTATATCCATTTCTCTGGTGTCAGTAGCTTGAAGATGAGAGAAATAAACATCTCGTC
CCTTCAGTTGGGAAGGAATACTAGTACCTAGAGAAAAGGAATTCTAAGCCTGGGGCAGAT
TCCATTATTGAACTCCCAGGCCTGGCTCCATTAGTTAATTTTGAGCAGAACTACTGACTA
TCCTTTGCCCTTGTAATAGGATATAACCTCTAGAAGAAATAATCATGTAGTGAATTGTCT
CTAATATAATGATGGAACTTGGGTGTTTTCCCCTCTGAAGAACAACAGCCTCTTCCTTGA
GTTGTATGACAGCCTCTGTGAGTTCTTTTCCCAAAACTATAGCAAACAGCATCACATCAC
ACATTTGTCCATAAAAAGGTTGGTTCTTTGTGCCAGAAGGGAATTGGGTCTCATGTAAGA
GCCAGGACGGGCCTCTTCGTGCACAATGACCACCTTGCTCACACCCAACCTGGGAGGGCC
GGACGTGCAGAGAGACATGCAAGGCCCCAGGTGGAAGGAAAGATGTCACATGTCAGGTCT
TGAGCAGGCGCAGACTGTGCTGGTGGTGACCTTACAGTCTAACTTACAGTCTAAAGCACT
CAACTGGCTGGAAAGAGGCCACATCTGGTGTTTAAGAATGGTATACAAGAAGAAAGCCCT
AAGCAGAGTTGAAAAAACAAACCAGCCACGCATGACGAACACACACTTTGTCCAGGCTTG
GGGAGGAAGAGCAGGCTGGTCCTCAAAGCTGTTAGCAGTTTGGTCCAGTTGGAACTGAAG
AGCCTAGAAAGCCAGTGAGGGGAGGCAAAAGATGACGGCGCACGGTAGTCAGCCAAGCAC
TAGAGTTTGGCATGTGCCATGCTAAGGAGTCAGCCCCGATGCAGACCCTGAGTCTTGAGC
CCTGAATCTGACTCTGCACACTCCGTGCTGGGCCCTAGGGAAGCTGGTTGCCCAGATTAG
CTGGTGGACGTGATGGTTTTCCATTAGCAAATGAACATGCTCAGGCTGCAGTGTGAAGTG
GACTTTTATTCTTTCCTACACATGTCCAAGAATTAGCCTGATATTGGAGCATGCCACCCT
CTGCGCCACCAGCCAGTGCCCAGGATAAACCCCACCATATCCCCTCCTCTCCCACTCTCC
CAGTGGAGTCAGCAGGGCCAGACGGGACCCGCCAGGTCCCTGGCACCTCCAGATTTCATG
CCTGTGACTCTGGGAGGGTCTGCAGGGTTTTACTAGACATTTTCTTACTTCCTTCTGATG
GTATGGTTACTTCACAAGCTGTAGGTCACCACTTTCTTCAAGCCAGTTGTATCTTTGTTG
CATCTTATGGCTGATATCCTTCCCCAGTTTCTAGTGCTAGTAAAGGATTTTCCCTAATTT
TTTTTAAAGTTTTACTGAGATATAGTTCACATACAGTTCAGTGGTTTTTAGCATATTCAC
GGATATGTGCGGTCATCAACACAGTCAATTTTAGAACATTTTCTGCACTTCATAATAAAT
TCTACACCCTTTAGCTACAACCTTTCCTCACCCTAAGGAACTATTAATCTCTTAATACTT
CCTATATCTGTAGATTTTTTGCATTTGCATATGAATGAAATCATGCAGGGTGTGGCCTGG
TGACTGGATGCTTTCGCCTGGCACAGTGACCTCAAGGCTCATGCAGTCCTGTGGCTTACG
TCCTTTGTGGACAGGATATTCCATTGTGTGGATTTCCCACAGTTGGCTTCCTTAGTCATC
TGCTGATGAACATTTGGATTATCCCATGTGTTGGCTACTGTGAATGATGCTGTTATAAGA
TGGTGTGTGCAAAGTTCAGTGATGACATCTGTCTTCGTTTCTCTTGGATGTGGACCTAGG
AGTGGAAGTGTCAAATCATCTGAGGAGGTGCCAGGCTGTTTTTAAAGCAGCTGTGCCATT
TTATACTTCAGTGTAATTTACACCACCAGTGTAATTCCTCCACTTTCTCTGCACCTGCAC
CAACGTTTGTTATCTCACTTTCGATTCTAGTAGAACCAGTGGGGGAGGGGGAGAGTTGTA
TCTCATTATGGCTGGGTTTGAATTTCCCTGATGCCTGATGATGCCGACATCTTTCTGTGT
GCTTATGGTCATCTGTATGTCTTTTCTGAAGAAATGTCTATTTGAACTCCTTACTCGTTT
TTAAATGAGGTTGTCTTTTTTACTGAATTATAAGTGTCCCTTATATTCTGGATAGAAGTC
CCTTATCAGATACATGACTTGCAAATATTTTCTCCATTGCTGTGGGTTATCTTTTCATTT
TTTTATGTTGTCCTTTGAAGCACAAAAGTTGTCTGTTTGTTTAATTTTGATGAAGTCCAG
TTTACCTCTTTTATCTTTTGTTTCTTGTGCTTTTGGTGTCCTGTCTAAGAATCCTTTCCA
AGTTCATGAGGATATGCTCCTGTGTTTCACCTAAGAGTTTTATAGTTTTAGCTCCTACAT
TTGGTGCATTTGGGGTTATCTTTTGTATGCAGTGTTAGGTGGGGTTCAACCTTCTTCCTT
TGCATGTAGCTACCCAGCTGTCCCTGCACTATCTGTGGTGAGGACTGTTCTTTTCCCTTT
GAATGGTCTTGGCACTCTTGTCAGAAATAAGTTGGCCATAGGTCTGTGGGTTTATTTTGG
GACTTTCAGTTGTATTCCATTGATCTGTCCCTTGTGCCACTACCACACTGTCATGATTGC
CATTGCTTTGTAGAAAGTTTTGAAATCAGGAAGTGTGAGTCCTTCCACTTTCTTCTTCTT
TTTCAGTATTGTCTTGGCTATTCCAAGTCCCTTACAATTCCATAATCTGATAGGGATTGT
GTTGGATCTGTATATAAGTTTGGGGAGCATTGCCATCTTAACAATATTGAGTCTCCTCTT
TCGTAGATCTCTTAATCACTTTCAACAATGTTTTGTGGTTTTCAGAGTATAAACTTGTAC
TTCTTTTTGATAAATTTATTCCTAAGGATTTTATCCTTTTTGATACTTGTTATGCACTGA
ATTGAGTCCCCCCAAAATTCATATATGGGAGCCCTAATCCCCAATGTGACTAAATTTGGA
GATAAGGCCTTTAGGGAGTTAATTAAGGTTAACTGAGGTCATAAGAGTGGGTCCCTAATC
TAATAGAGCTGGTGTCCTCATAAGAAGCAGGGACACCAGCTCTCTCTCCAAGCATGTGCG
CAGGAAAGGTTATAGTAAACATGTCAATGTCTAATTAAGCAGAAAATTTTATCTGTATTG
TCGGGGAGGTGTTTGCTGTCTCTGATTTTTCTTCTGGGAAATCCATTTAGAAGGACAAAG
TGGATTGTAAGGTTGAGCTGGTCCGGAAAACTCAGCTTCCAAATGTCAGCAGGGAAAAAA
AAAGAACACTTCTTTTCTCCTTGTTTGAAAATGACTGTATTGGCTGGGTAGACTGTGTGT
GTGCGTGCACGCATGCATATATATTTCATCAACACACACACAAAATAACATGAATTATTT
CCCAACTTCTTGCTAAGTGTCAGGCATGGTGCTAGGCCCCGAAAACACTGAGATGAATAA
AACCCAGTGACACCCTCAGCCAATTAAGATGACAGAAAGCCCTTTGCACCCCCCCAGCCC
CAGACTTCTTCACTTGCTCTACACGCATGTGTGTGCACATGCAAACACACACTTTATCGC
TGTGATCATATTGCCCACAGGTGTGGTCGCCGTGTGTCTGCATTAGCCTGGAACAGTCCT
GCCTAGTGCTTGGCAACCCAGTGTATGTCTTAGAGTAATAGCACCCTCTTCATTCCCAGA
AGGGACCCTATGTGACAAAATTTTCCTGATTCTTTGGAGTATTATCCTTGCCCCAGTAAC
AACTTTTGTTTATTAATTTTATATCATAGACTTTCTCCATGAACCTAATGGGATAACTAT
TTTTGAAAACATGCAAATTAACCCAGAAAAAAATATGATGATAATAACAGAAATAGTCTA
ATTTTGTTATTTTAAACTTACAGTTTTCTTGCAAGTAGTAGTGACCACGCCGTACGTGGG
AGCGACTGGTCTGTAAGCCAGGAAGAGAAGCCTCACCAGAACCCACATGTTCCAGCACCT
TGATCTTGGGTGTCTAGCCTCCAGAACTGGTAAAAAATAAATATTTAAGCCACCCAGTCT
GTGGCATTTTGTTTGTTTGTGACAAGCTCTCACTATGGAGTCTGTGGTATTTTGTTACAG
CAGCCCAAGCAGACTTATACAATGCTGTTGTAAATGGAATTATTGTCTTAATTTCATTTG
CAAATTGTTCATTACCAGTGTATAGAAATACAATTGATTTTGGTGTATTGGTTTTATATC
TTGCAACTTTGCTGAACTCACTAATTGGTTCTAGTGATTTTTAGTGAATTCCTTAGGATC
TTCTACGTACAAGACCATGGCATCTGTAAACAGATAGTTTTACTTCTTCCTTTCCAATCT
TGATGTCTCTTATTTCTCTGTTCTAGCCTAGTTGCCATAGTTAAGACCTCCAGTACAGTG
TTGAATGGAAGTGGCAAGAGTGGATGCTCTTGTCTCGTTCTTAATTCTAGGGAGAAAGCA
TCCAGTCTTCATCAGTAAGTGTGATGTCTTATCAGGCTGAGGGAGTTCCCCTCCATTCCT
AGTCTGTCGAGTGTTTCTGTCACGAGAGGGTATTGGATTTTGTCAAATCCTTTCTCTGTA
TCTATTAAGATGATCATGCAATTTTTTATTCTTTACTTTATTGATATGGTATTTTACACT
AATTGATTTTCAGATGTTAAACTACCCTTGTATTCCTGGGATAAATCCCACTGGGTAAAA
GTGTGTAATTTTAAAAATATTTTGCTGAATTTAGTTTGCTAGTATTTTGTTGAGGACTTG
TGCATTCATATTTATAAGCGATATCAGTCTATAGTTTTCTCATGACCTTTCTGTCTGGTT
TTTGTATCAAGGTAAAATAGGCTGGGAAGTGTTCTTTCTTATTCTATTTTTTGGAAGAGT
TTGCAAATAACTGGTATTAGTTCTTTTTTTCACTGTTTGGTAGAATTCAGTGGTAAAGCC
ATCTGGGCCTGGGCTTTTCTTTGTAGGTAGTTTTTTGATTACCGATCCAGTCTCTTGATT
TGTTACCGATCTATTCAGAAGGTCTGAATTTCTTCTTGAGTGAGTTTTGGTAATTTGTGT
CTTTCTAGGAATTTGTCCATTTCATCTAAGTCATCTAATTTGATGGCATACAACTGTCCA
TAGTATTCTCTTATAATCCTCTCTATGTCTGCAAAGTTAGTAGTAATGCTTCCTATATCG
TTTCTCTTATTTTGGGTCATCTCCTTTATTCATCAATTCAGCTGAAGATCTATTGATTTT
GTTGATCTTTTTGAAAAATGGCTTCTAGTTTCACTGATTTTTTCTATTGTTTATCTCTTT
TTTAAAATTTCTCATTATGCCTATTTTCTATTCTCTATTAATTTCCACTCTAAACTTTAT
TATTAAATATTCCCTTTCTTCTAATGCATAAAGTTTAATTTTGTTCTTCTTTTTCCAGTG
TCATACGGTGGTGATTCAGTTGTTTATTTAAGATATTTCCTCTTTCTTATTAAAATATGC
ATTTACAGTTATAAATCTCCCTCCAAGCACTGCTTTGTCTGTGTCCTGATATTTTGGTAT
GCTATGTCTTCATTTTCATTCATCTTAAAGTATTTTCTGATTTTTCTTTTGATTTCTTCT
TTACCTTATTGGCTATTTAAGAGTGTGTTAATTTCCACATATTTGTTGTTTCTTTGTTAT
TAATTTCTAATTTCCTTGTTATTTCCTCTGTAAATTTTCCCTATTTATTTATTTATAATT
GAAATTTATTTATTATTGAAATTTATTTATAATTCATCCACNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTATCGCTATTCCAGTTTTATTGTGGTTGTTCTTTGCATGATGTACTTCTTTCCATC
CTTTTACTTTCAATCTGTTCGTGTCTTTGAATCTAAAGTTTGTCTCCTACAGATAACACA
TACAGGCAAACATGGGAGATATTGCTGGTTGGGTTCTAGACCGCTACAATAAATCCAAGT
ATCATAATAAAGTGAGTCACCAATTTTTTTGTTTTCCCAGTGCATATAAAAGTTATGTTT
ATACTCTATTGTAGTTTATTAAGTCTGCAATAGTATTATTTCTAAAATAACAATGTATAT
ACCTTAATTTTTAAAATACCTTATTGTTTAAAAATGCCCACAATCATCTGAGCCTTCAAC
AAGCATAATTGTTTTTTTGGTAGAGGATTGCCTCAATGTTGACTGATCAGTGTGGTGGTT
GCTGAAGTTTGGGTGGCTGTGGAAATTTCTTAAAATAAGACAACAGTAAAGTTTGCCACA
ATGATTGACTCTTCCTTTCACAAAAGATTTCTCTGTAGCACATGATGCTATTTGATAGCA
TTTTACCCACAGTACAATTTCTTTTGAAATTGGAGTCAATCCTCCCAAACCCTGATGATG
CATCATCAACTAACTTTATGGAATATTCTAAATCCTTTGTTGTCATTTTGACATGGTTCA
CATCATCTTCACCAGGAGTAGATTCTATCTCAAGACACCACTTTCTTTGTTCATCCATAA
GAAGCAATACTTCATCCAATAAAGTTTTATCATGAGATTGCAGAAATTCAGTCACATCTT
CAGGCTCTGCTTCTAATTCTAGTTCTCTTGCCATTCCCACCACATCTGCAGTGACTTCCT
TCAGTGACGTCTTGAACTTCTCAAAGTCATCCATGAGGGATGGAATCAACTTCTTCCAAA
CCCTTGTGAATGTACATATTTGACCTCTTCCCATGAATCATGAATGTTCTTAATGGCACC
TAGAATGGTGAATCCTTTATAGAAGGTTTTGAATTTACTTTGCCCAGATCCATCAGAGGA
TTCACTCTCTGTGGCAGCTATAGCCTTCTGAAATGTATTTCTTAAATAATAAAACTTAAA
AGTTGAAATTACTCTTTGATCCACAGGCTGCAGAATGGATGTTGTATTAGCAGGAATGAA
AACTACATTAATCTCCTTGTACATTTTAATCAGATGTCTTGGGTTTCCAGGTCCATGGGC
AATGAGAAGTAAAGCTTTGAAAGGAATCTTTTGTTTCTGAGCAGTAGGTCTCAATATGGG
GCTTCAAATATTCAGTAAACCATGCTGTAAATAGATGTGCTGCCATTCAGGCTTTGTTGT
TCCTTTTCTAGAGCACAGGCAGAGTAGACTGAGCATAATTCTTAAGGGCCCTAGGATTTT
CAGAATGGTAAGTGAGCAATGACTTCAACTTAGAGGCAGCAGCTGCACTAGCCCTAACAA
GAGGGTCAGAGTCAGCCTGTCCTTTGAAGCTCTGACACCAGGCATTGACTTCTCTCTAGC
TATCATCGTCCTAGATAGCATCTTCTTCCAATATAAGGCTGTTTCGTCTCCATGGAAAAT
CTGTTGTTCAGCGTAGCCACCTTCATCAGTAATCTCAGCTAGATCTTCTGGATAACTTGC
TGCAGCTTCTGCATCAGCACTTGCCGCTTCACCTTGTACTTTTATGTTCTGGAGACAGAT
TCTTTCCTTAAATCCCATGAACCAACCGCAGCCAGCTTCACACTCTTCTTCTGCAGCCTC
TTCACTTCTCTCAGACCTCACAGAATGGAAGAGAGTGAAGGCCTTGTTCTGGACTAGGCT
TTGGTCTAAGGGAATGTGGCTCGTTGGATCTCTCCAGACCACTCGAACATTCTCCATATC
AGCAATAAGGCTTTTCACTTTCATTTCATTGGTGTGCTGACTGGAGTAGCAGTTTTAATT
TTCTTCAAGAATTTTTCCTTTACACTCATAATTTGGCTGTTGGGCTCAAGAGGTCTAGCT
CTCAGCCCATCTTGGCTTGTAACATGCCTTCCTAACTAAGCTTCACTGTTTCTAACTTTT
GATGTAAAGTGAAAGATGTTCAACTCTTCCTTTCACTTAAGTACTTAGCAGGGCTAATTT
CAATGTTGTCGTTTCTCAGGAAATAGGAAGGCCTAAAGAGAGGGAGCAAGGGTGGGCAGG
GGAGAAGTCAGAATGCACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTTGACAGGAAGGTGAACAAGAACTCACCCATGCGGGGGAAGGTGGTGCACCC
CAACTCTGTGGAAACAGACGCTCTTGAGCTCCGGACCCTTCCAGACCTCACCCTATGTGT
CTCTTCATCTGGTGGTTTATTTGTATCCTTTAAAATACCTTTGTAATAAATTGGTAAATG
TAAGTAAGTGTTTCCCTGAGTTCTGTGAGCTGCTCTAGCAAATTAATTTAACCGAAAGAG
GGGGTCATAGGAACCGCAACTTCAAGCTAGTTAGAAGTTCCAGAGGCCTGGAATTGTAAC
TGGTGAGAAGGAGGGTCTGTCTTGGGCATTGAATCCCCAGCCTGTGGGATCTGAAGCTAT
CTCCAGGTGGATAATGTCAGAATTGAATTGGAGGACACCCGCCTGGTGTCAACTGCAGAA
CTGATTGCTTGCTTGCTGATGGAGAGAGATCCCTGCGTATTTGGGGGTCATAGGAGTCTT
CTGTGTTGATTGTTGTGGTGTGAGAGCAGAGAAAAAATTATTTGAGTTCTTCCAAACAGC
TGCATAAAGGATTCTTGGTTGATGAGTATTTCTTTTCCCTTTCAGCATTTTTGATATGCT
ATCCCACTGCCTTTTGGCTTCTGTAGTTTTTGCTAGAACTCAACTGTTAATCATATTGGG
GAAGCCCTAATAAGTCATATTCACTTGTGGTTATTCTCTTGCTGCTTTCTAGATTTTCCC
CTTGTCTTTCACGATCAGCACTTTTACTATGATGTGTCCATGCGTGTCTACATTTATCTT
TCTCAGCAATCATTGGGCTTCCTGATGTGTGGGTTATTGGTTTTCAGTAAATTCTGAAAG
TTTTTATTCATTATTTCTTTGAATATTTTTTCCTTCTTCTTCCTTTCTGGCACTCTCATT
GCTCTTATGTTGGTGCACAGAATGGTGTCCCACATTTCTCTGAGGCTCTGCTCATTTTTT
TTCACGGTTTTCTCTTTGTTCTTTGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNACTGTTAAGACCTTCTAATGAATTTTTTTTTAGTTATTAACATTATACTTTT
CAACTCCAGAATTTCCACTTGGTCCTTTTTTATAATTTCAATCAAGAGATTGAAAGAGAT
TTCAACAGATTTCATTATCTCTTTTATAATTATAAATCTCTAAACCTATAATTTATGAAT
TATAATTATAATTCATATAATTATAATTAATATAATACATTTATTATTCATTTCTCAATT
ATATTTATAATTTATTCTCTGATATAACATTGTCATGATATGTTTTCCTTTTAGTCATGG
TTCTGTGGACATGTTTATAATGGCTACTTTGAATTGTTTTTCTGATAAATCTGATATCTG
GTCACTCTCACAGTCAGTTTCTATTGCCTGTTTTCCCCCCATTGTACGGGTCATACTTTT
CTGTTCCTTTGCATGTCTCATAATTTTTGGTTGGAAATTGGTCATTTTAGACAATATACT
GTAACAACTCGGTACAGCTGCCCCACCAGTCCTGCTCTTGTTATTTGCTTAGTTAGTAAC
TGGTGACACTGTGTGTGGGAAGTCTCTTTCCCTTCCTACAAGGTTAAGCCTCTGGTGTTC
CCCAGAGAGGTGTAGCTCTGGGCAGGCCCACACTTACCCTTAGGTGACAGTGGCTTTGCC
AGGGCGCTTTTCCACTTTCTCTAACCACACCCAGATGTTAAGCGTCACTAATTGGCAGCT
GACTGTTTTGTTATTTTCAATATTGTCCTGGGGCATAAATTGTTCTATAAGCTAATGCAA
TCAAATCCTGGCTCACTTGAAGGAACACTTCCTGAGGTCAATGTTTGGTGTTTGTTCCAA
TCCCAGAAGGGCTCCTCTCAACTGTCTTATTCTCTGTTCTCTCTTACAAATAGTAGTTTA
CAGTCTAGGCTGTATCTCTGTTAGATCCACAAATCTCCCAGTTCCCTTCACTGCAACTAT
TTTTGAAAGCACCTTTAGGTTTAAACTTCTCCATGCTCTGTTACAAATGAGGTCAGTTCC
TTTGGAAAGAAAGCAGGAGCTATCTGTTTTACAGCCCACTTCTCCCCCAGGCAAAACCTT
TGAGCCAGGGCTCTGGAGCTGGGGCTAAGGACAATGGCGAGCTTTACTCTGAGTGACACT
CTGTGGGTCCCTTTGGGAGGGAGAGCATTAGCCCAAGGTCCTCTCAGCTTGCCTCTCCTG
GCATGGAACCACTGTCCTACCAGCAGGAGGAAGGGCTCCAAGTCCTTAGTGTTCTCAGCG
TGCCAAAGAAGGGAGCTGGCACTGCCCAACCACTCTCACCCAGCAATAGGTGGCTGGGGG
CAGGGAAGAAAGGCCTCTGGGGACGCTAGGAGGGAAAGAAGGCCTGTGTCATGGCCGCAG
CAGCCCCTAGTGGCCTCTCTGCCTCACTCAGCTGAGGAGGAGGGAAGGAGCAGTTTTGGT
TCAAACAACACAGACTTTTGCTTTTCTTACTAAATTGTTGATTTTCTTGAAAAGACATTT
CTTTATTTGCTGTTTACTCTTAGGACCATTCCCAAGGTTTTAAATAGTTGTTTTTAAAAT
AATTTTCAACAGTTTCACTGGAAAGTGGGTCATTCCTCTCAGGAATTTCTCTCACTGTCC
TGCCCAAAGTCAATCTCAGTTTTCTCTGGTTTTATAACCTATTGGTAATTTCAGTGAGAG
TCTTGGAGGAGATCAATTGTATGATTGTGCTCATATCGTACCTTATTCTGATCCACTTCT
TAAACTTCCTCATGATATCCTCAGCAGCTAGGATTATACTTGGCACATAGTAGGTTTGCT
AAGTCATTTTTGCCAATGGTACTGGTGATGTTCGGGCAAGAAATGTCTGGGGAATTGTCA
AAAAGGGGCAAAAGGGAATGGATAGTTACAGAGTGGTTCAGAGCATGGGTGCTGAGCCTG
GAGCCAGCTCCACCTCTTCCTGAGTGTGTGGCCTTGGGCTATTCTGAGCCTCAGTTCATT
TCAACTGTAAAACTGGCTAATAATGGTACCTATCAGATAAAGGTGTGAAGATTAAATAAT
ATATGCAAAGCTTCTAACACTTGGTACACACTTAATAAATCCAAGCTAACATTTCAGACG
TGGCTAGGCACTGCTGCATATTTACAGGTTGTTTTACTCAGTCCTCACAAGAATCCTGCA
AAGTAGTTGTTAGTATTCCTATTTGATGGGTGAGAGGAGAAACATGCAAGAAGGTTAAGT
CATTTAGTAGGTCACAACTAGTAAGACAGAATGAGGATGTGAACCCAGACTGCTCTGGCT
TTAAGCTTCTCTCCCTCCAGCACTCGTGTAGAAAGCAGAGGTTAGTTAGGACACATGAGA
CAGAAACTTGTCTCCAGGCTTCGGCCCCGCTCTGTTTCTGCTCGTGTGTGTGCAGGGGGT
TCGTCTCCCCTTCACACTATCAAGCCAGCCTCAAGCAACACTGACCTTTCTGAGCTGACC
CTTCTGTGCTTGCCTTTCTGACATTGTGTAAATGTTCATTCATATGTACACATGTATGTA
CAGAATATAAACACAGACATGCACTGCATAATGGCGTTCTGGTCAATGGCAGACCACATG
TATGACAGAGGTCCCGTAAGATGAATAATGGAGCTGAAAAATTCCTCTCGTCTGGCAATG
CCTCTGTCAGAATGCCACAGCACATATCACTCACACGTTTGTGCTGATGCTGGTGTAAAC
AGATTGTTTTTGTAGATTTAGTGCAGCCTAAGTGTACGGTGTTCATAAAGTCTGCAGTAG
TGCATAGGAATGTCCGAGGCCTTCACATCACTCATCACTGACTGACTCACCCACAGCACC
TTCCAGTCCTGCGGGCTCCAGTCATGGTAAGTGCCCTATACAGGTGTATTGTTTGTTATC
TTTTATATCATATTTTTACTGTGTCTTTTCTAGGTTTAGATATGTTTAAATACACAAATA
CATACCATTGTGTTACAACTGCTCACAGTATTCAGGACAGTGACCTTCTGTGCAGGTGTG
TAGCCTAGGAGCAATAGGCCATCCACAGAGCCTAGGTGTGCAGCAGGCCACGCCGTTTGT
GTGAGTGCACCTTCTGATGTTCAAACGAGGGCAAGATCATCTAACAATGCATTTCTTAGA
ATGTATCCCCATTGTACCGACATGCATGACTATATATGAACAATATATGTAAATGTACCT
AAATAATTATTTGTAATCATAAACCCAACATGTGATGGTAAGGGCATCGCCTATCTCCCT
TAATAGCATCCAAAATGGTACCTATAAGCTTTGCAGAGACAGAGTCTTCCCTTGGTGGGT
GCAGCTAAGTCTCACTATACCAATATCATTGTCCCTGAGATGCCCACACCTTGGATAGTA
GGCATTAATTTCAGCCATCATCACCACTGTGGTCTTAGAAAACACAGATCCCTTTCATAC
TTGAGCACAAAGTGGGGCACACTACCTTTCCCCATACGACAGCTAAAACCATGATACCTG
ATTTGAATACACAGGAGTCTCGGGAAGATTCAAAAGGGAAACAGACTTTGTAAAGGCATT
CTGGCTGAGACAGCAGCTCACATGGGCTGGATCTGCTCAGGCCGCTGCCACTGCACCCTC
CACACAAGAGCACCCTCAGGTCTCCCGAAGTCCTACCCCAAAGAGCCAGAGCCTCCCTCT
CCTGCCTAGCTGGCCACCCCTGCCCCCACCCTCTGCAGATCCTTGTCCCTCTGCAGCTCC
TCACCAAGCCGAGCCCCTGGGAACAAATTGCTGGGGAAGGCCCTGTCCCCTCACACGCCT
GGTCTGTAGGGAGCAGCCAGCCACTGGCAGAGTGAGTGCTGAGAAGGACTAAACCGAGTC
TGAGGAGGGACACTGACTGAGATCTGAAGGTTGAGAAGGAGCCAACACCATGAAAAGCCA
AGAGAAGGTCATCTGAGGTTAAAGGGACAGTGAGTGCCCAGACCCTGAGGGAAAAGGAGA
AGCAGCCAGTCAGCACTGTGGCTGGAGTGCAGAGAGCAAGGCGCAGGGGTGCCTGGAGGC
GAGAAGTCCGCAGCCAGGACTTGGGAAGTGTGAAGGGAAGCCCCCGAAGAGACTGCCAGA
GGGGTGCCCAGGAAGAAGGGAGGGGAAGAGCCGTTCTTCTCAAGGACGGGAAACAATGGA
AGCAGAGAAGGGAATTGTGCATGCTGGGTATGGGGTGGTCAGAAAAGGCAGGCACATCCT
CCAGACAAGTAAAGGAAACTGAGGAACCGAAGGTGGGGAGATCCACATGGAGATTGGGCT
GAGTCATCCCCCACTGCCCCTTAATTGAACAATAACACCAGTGTTAGCTATGCATGTACA
GAGCTTGGCCCTTCACCTAGAACTGTGCTGGGCCATTGCCCAAGATGTTGGGGCAGATAT
TATTAATAACATACTGGTGTGCTGGCCTGGATACCAGAGGGCCGCCAGGAGAGGAAACAA
TGAGATGCAGGGTCCCTGTGGTACAGAGCTAAGAGCTAGGAGCTCAGGGATGGAGATGGG
CTATACGACACAGACTCCAAATGGCAGGAAGCAGGGAGAATGCCTACTTTTCCAGCACCC
ACTCTGTACCGTCTGGGGTGTTGGAGCACCACGCACACCTCTTACTCATCCCAGCCGTCT
CAACACTGCTGGCGCGCTACAGCAGAACCAGCCCCTGCGGGCTGCGGAGGGGTGATGGTG
CTACGTGTGCATTGGGGTAGGAGGGGTGTCAGCGGCCCTGATAGGCTCCCCTAACCCCCA
AGGGATACCACAGCGCTCACTGTTTTCCACTTTCTGGGTTTTGTATTTCATACGATGACT
TCTTGGTTAGCGCCCTTGTTTGGAGCTGTGGAGGCATCTCTTCTGCTATGTGGACTCTAA
GAACCTATGGATGCTCACGACTTCTCAGAGGGACAGATGACAGAGCTACGCCCTTCCCAG
CCCTGACCACCCCCAACAACCCCATAATTCCTGGCTCCTTGTCACGCGCCTCGTGGCCCG
TTCTCGTTTATGCTGTCACTGTGCTTTTTCACGCACCTTCTTAAACCCTTTGGCATGGAC
GGTGACTCCACACTGTATGGCCCCTTGACCACCGCAGACCGCCGGCCGACCGCATGCCCG
GCGGGGCGGCTCCCGCCCCCGGCAGTCGGGAGGGTGGCTGGAGCCAGGTCGCCCCCGCTC
CAGTGCGCTGGGCGGGGCCAGGGGAGGCTCAGCTGGGCCACCCGCTGGCGTCCCCGCCCC
AGATGGGTGTGGACGCGCCGCCCGCTCTCGGAGCTAAAGTCTTTGCTGAGGAAAGGCGAG
CGCACGACCGCTCTACTCACCAGCACGGCCGCAGGGTGCCTGGGCGTCCCCTCCTGAGGC
CAACCCTGCCCTAATACACGCGTGCTAATGCCGGAGGCGCGGCCAGCGAACACCGAGGGG
CGGCCTGGGGCCCCGCTCGCCGCGCCCGCCGTCGCCGGCGCTCCAGGTCTGCGTGCGCGC
GTGCGTGAGCGCGTGCCGACCGGCCCGCGACCCGCGCCGGGGTCGCCTCCGCGGCTCTGC
GCCCGCCCGGGCCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTT
GATCTAGGGGCTGACTCTTACTCAGGAGCTTTACCTGCCTTCTTTCCAAGGTGAGTTGTT
TATTTCTCTCAATTCTTTGTTGTGGCTCTTCTGTTAGGCTTCTACTTGACTCAGAAGAAA
ACTTCTCACTTTCAGATGAGTTTGTCAGAAAGGGATCTATTCAGTAGCTCTTACTTCATG
GCTGTCATTTCCCCTCTGTCATTATCACTGCTAACAAAATTTTCATGTAAAATAGCAAGA
TCAAGTCGCATTTGTTTTGAAGAGTTCCAAACTTCCTTTTTATTTCCCAGGTATTCAATT
CTGTCAATAAAATCCTCAAATTGGGATTTAGGAAACAGCCTATGTGCCCAGTGCTCCCTG
TGTCTGATTAGCATCTTCAAGTCTTCAGCCTCATGACCTTTACCTTTGAAGTTTGCCTTG
TCAAACAAACTCCTTAAGGCTGCAAGCCCCTCTCTGCATCAGTCTCACGACCCAGCGTGG
GTGCATTCCTCTTACTGTTGTCTGGAGGCGCAGGAGCAGCTGCAGCTACTCCACAGCCTT
CAGTGGGCCCAGCTCCTTCTCCTCCTGTGTCGCAGAGAGGCTAGAGGTGGGAAAGGAGGA
CAGTTTCTTCTCCATGCACACAGTCTGCTGGGTCATCATGCCGTTCTCCTGTGGTTCCAG
CATCTTTTCCTCTGGTTTCCTCCCTTCCTGGAGACTCCTGGATCTTCTTTCATGTTCGTC
TTCTCACACACACTGCAGCCGCCCCCATGCCCTGAGGGCCCTGTTGAATTTGATATGGTA
GTATTTTGTTGAAGAGTTTTGTATCTATATCCATAAAGGGTATTAGCCTTAGTTTTCTTG
TAGTTTCTTTGTCTGATTTATTATTAGGGTAATACTGGCCCTATAGAATGAGTTAGGAAG
TATTCTCTTCTCTTCAATTTTTTGGAAGAGTTTGAGAAGAATTGGTATTAATTATTCTTT
AAATGGTAGAAGCCATCTGGCCCTGGGCTTTTCTTTATTGGGATGTTTTCTATTTCTTAT
TCACTATCCTTACCAATTATAAGTCTATTCAGACTTTCTATTTTTGAGTCAGTTTTGGTA
GATGTGTGTTTCTAGAAATTTTCCATTTCTTCTAGTTTAATGTGTTGGTGTACAACAGTT
CCTAGTATTCTCTGATAACAATTTTTGTTCTGTAAAATAGGTAGTAAAGTCCTCACTTTG
CCAACTGAATTTTACAAAGGTACAAAAGCAATTCAGGGGAGGAAAGATAGTCTTTTCACA
AATGGTTCTGGAAAAATTAGACCATCCATAGGTAATGAAAATTAACTTTAACCTAAACCT
CACATATTATACCAAAAAAAGAGAAACCAACTCAAATGGATCATAGATTTCATTGTAAAA
TTGAAAAACTTTTAGAAGAAAACATAAGAGTGGCCCTTATTGAAGCTGCAGCTGCTGTGG
TCAAAAGGGGGCCCAGAGTGACAGTTTTCCTTGACAGTTGGTGTGCCGTTTACAGTAACT
GATCCGCTGCAACATTTTGGGAAAATACAGTTCAATAGAAAGAGGAAAAATGGAAGAAAG
CATAAAAGAAAATCTTTGGGAACAGTGTTTGGTGAGGAGTTCTTAGACATGACACAAAGG
CACAACTCATAAGAGGAAACATTGATAAATTTAACATCATGAAAATTTAAAATGTTTGCT
TCATGAAAACCTTTGATAAGGGAATGAAAACATAAGCTACAGACTGAAGAAAATGGTTGT
AAACCACAGATTTAACAAAGAACTCACATCCATAATCTATAAAGAACTCTTAAATCTCAA
CATTAAAACAATAAAAAATCCAATTAGAAAATAGGAAAAAGACATGAGGCAATATTTCAC
CAAAGAGGATAGATGGCAAAGAAGCGCATGAAAAGATGTTCAGCCACACCAGCCTTTTGG
GAAATGCAAACTGGGACCATGAAGAGATATAACAGGACGCCTATCTGAACGTCTAAAATG
TGAAGGAGTGACAATACCAAATACTGGTGAGGATTCAAAGAAACTGGGTCTCTCATACAA
TTGCTGGTGGGAATATAAAATGGTCCACCCACTGTGAAAACTAGTTTGGCAGTTTCTTAA
AAACTAAATATTCGACTCCCATGTGACCCAGCAACTGCACTCCTAGGCATCTGTGCCAGA
GAAGCGAAGCTTATGTCCACACAGAACCTTGCTCATGAATGTTCACAGCAGCTGTGTGCA
TGACGTCCAATGATTGGAACTGACTCACACATCCTTAAACAAGTGAAAGGGTAAACAAAC
TGTGGTATTTATTGCATGCCAGGGAATATAACTCAGCAATAAAAAGGAGTAACGCATTAA
AATAAAACAACTTGGATGAGTCGCGGGCATTTGGGTGAGTGAAAAAGGCAACCTTGAAAG
CTCACACACAGTTTGCTCTGGTGGCTACACAGATCTGTTTGGGTGATAAAACGACATAGA
ACTACACACACAGCATACCAACATCAGGTTCCTGGCTGAGATATGCCATCTGGGGACACT
GGGTGAAGGGTACCATAGGACCTGTATTAAGATTGTAACACCCTGTAACTCTATAATTAT
TTCAAAATAAAAGGTTTTTTAGAGCCCTAGAGAAGAAGGCATGTCACTTTGACAACCAAT
GATGCATTGCAGTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGGGTCTCGCTCTTGCTCAGGC
TGGTTTTGAACTCCTGACCTTGAGCAATCCGCCCGCCTCGGCCTCCCAAGAGCTAGGATT
ACAGGCGTGAGCCACAGCGCCCGGCCTATGCTATGGTATTTACATATAACATGCCTTGGT
TTTATTTTAAAAACCATCTAGTGGGGAGATGAATTAGATGATGAAACCAAACTGTCTACA
TGTTGAGAATTGTTCAAGCTGGACAATGGATATGTAAGATTTATTATACTATTATCTCTC
CTTTTGTGCATGTTTGAAACTTTCCATAATAAAACAGTTTTAAAACACAAATGAAATAAA
AAATTATGAGGGTTCCTTGGGACTCGTGGCTACACATATGGTCAGGAGCCAGGCCTTGGC
TCCCACTGACAAGCCGGGCTCAGGCCACTGCTGCCCTGCTGGAGACTGAGGTGCCCAGGC
CAGTTCTGGGGATGTGCACGGAGCACTAGCGTGCCCCTGGTGCGGGCTCTGAGGGCTCAC
CGTTTGCCCACCTGCTCGTCTCCGCATTTGTCCCTCCATCTGGTTAGTCACCATTTAGCC
ACAATTCTTCCATCCGTTTACTCATTCATATATTTAGCATTTACTAAGTATTGCCATCAG
GGAAGAAGGCACAGCTCCTGCCTTCCAGGCGCTCAGAGTCTAGCTGGGGGGAGAGGCCAG
CACGGTGTGTAGCGGGGTGTGTTGCACGCGAGAGCTGTCTGCTCAAGCACCCTCACAGCC
AGACAGCAAGACGAGGGTCCAGAAGAGGAGTGCCTGGGGGGCTGTGGCAGCTGCTATGTG
TCAGCCCCACCCACATAACCCAGCACAACATCCCTGTTTCAAGGTCAGTTGATTGGCAGC
CTTAATTCTGCAACCTTAACTCCTCTCTGTCATGCAACGTGACATATTCCTAGGCCCTGG
GGATTAGATCCTTTCATCATTCTACCTCGCACAAGAATAGAGTCCAGGTGTAGACCTGGC
TGGAAACTCGACTTAGCCACTTCAGTACCAGTGTCCACTATAGGCGACAGCCACAGATGA
ACGCGCACAGCGACTGTAGCCGACAGCCGTGATATGAAGGCGCACAGCCGAGCGTCGACT
TTAGCGTTAATAACAAAACTTCTACAACAGTACTCCGAATCAAGGCAATACAACCCTGTA
CTGCATGAGAAAATCTCATGCATTTTAGAGAAAGACATTTTCCAGCACCTTACAATAGTA
ATATAACAAAAAGGAAAAATCCATTAAGAAGATGTATTGTATGCTCAAAAAATAATAAAA
GGCGTAGTACTAGATACTATTGTAAACAATGTAACGTTGGCCTATGTGTAGCCCCATGCT
TCGAACTTTATCATATCAAAGAATAAAATTTATCGTGATATTCAAAAACTTGCCTTATTT
CTTTATGATATGAATGAAATAAAACTATAATTTTGAATTGAGTTTTCTAATTTTTCATTT
ATCAAAATAAAATTGTGAACATTTAAAAATAAGGTAATGAAAACACATATGTATATGTTA
CCTATTCTGATTGACATGACAAGCAAAGCTGCCTGTAGAGTCAAACAAGCTCTCAGTGCT
TTCAAGCTCTCCTCACCACACGAGAGCAAAACGGATCCGACGTCAATGCGCAGCGCACAC
TACGGTGCGGACTGTGAGTGCGGCGTGGGCGAGGTGTCGCGGCCGGCCAGCGCCGCACCA
AGGTGGCTAAGGACAGAGCAGACACCGCACATCTGGGAAAGGACTGCCTATTCCACAATT
GGTGCCAACACCATTCGTTATCTTTGTGGAAAAAATTAACTTGGATTCTAACCTCATGGC
ATATATAAAAATCATTTCCAGGTGGATTAAAAGCTTTCATGTCAAAAGAAAAACTATATA
ATATTAGAAGATAACATAGGACACGTTGGTCCAAGTGCAGTGGTGTTTACAACTAATAGA
TCACAACCAGTTACAGATTCCTTTGTTCCTTCTCCACTCCCACTGCTCCAATTGACCAAC
CTTAAAAGAAAGAAAGAAAAATAACCATTGGAGAATATCTTTATGACTTTGAGGTGGGGA
TGAATTTCCTAAGCACAAAATGCATAAACCATATAGGACTAGATTAACAGATTTCTCTAT
ATTAAAATTAAGAACTTCTGTTCATCAAAAGGCACCCTAAAGAGAATGAAAAGACAGGCC
ACAACCTGGGAGGAGAGAGTTGTAACACATATGAACAGACACACCTACCATGTTTCCCAG
AAAATAAGACCTACCCATAAAATAAGCCCTAGCAGGATTTCTAAGCATTTGCGCAATATA
AGCCCCACCCCGAAAATAAGACCTAGTGGCGGGCGTGGCTACGCAGCGCGTCTGCACAAC
CCATGCATGTCGTCACGGAGCGGGAAAGAAGACGAGCAGCCCTTCTCCTCTGCCCCATGA
GAGCTCTGTTGCTTGACATGAGAGATTGGGGCCAGTGGTTCTAAAGGAAATAGAGTTGCA
AGAAATTCAGGATGGAATTCAGGGTTTGGAGAGTTATGATGATGTTCCAGAAGAAGACTT
AACTATATTTGAATAAATGTAGATGGTTGTACTGCACTTAAAAAAAAATAACACATCCCC
TGAAAATAAGCCATAGGGTGTCTTTTTGAGGAAAAATAAATATAAGACCCTGTCTTACTT
TCGGGGAAGCACCGTAGAATGGAGGAGGGAAAGTATCTATATACACACATATATTTTTTA
TGCCATGATATGTTAAGGATAGGCAACTCAATAGAAAAATGAGTAAAACTTATAGAAACT
TCACATTAAAGGAAATATAAATGACCCATAAACACAGATAAGATGCTCAACTTGCTCAAC
TCATTAATAATCAGAAATGTAAGTTAAAGCCACAAAGAGATACCATTTCATATTCATTAG
TTTCTCAAAAATTAACATGTCTGATAAAGCCAATCCCAGGAGCTGGCTAGGATCTAGAGA
TGAGGACACTCACACACCACTGTGGGGTGTCTGGATTGGTAGGACTACTTTGGGAAATGG
TTTGGTGTACCTAGGACCCAGCGATGTCACACCTAAGTGTCTACAGCCTAGAGTGTGTAT
TTATGCCAGGGGCAATGATTCCGACAGGAGGACAAAGATCTTAACTACTACAAAGCTTTG
TGGCCCTCCAAAGAGGCGCACTGCATGAGCAGTATACAGTGTATCTGTGGCACTGACATT
TCATGGGGGCAGGGGTAGGAAGACAATGTCTAAAAGGCTCCTTAGGGTGGCAGTCACGAA
GAGAAGCTGAGCGGCGCTGCCTAGAGGCACAGCAGACCCGCGCTCACAGCAGCAGCCACC
AGGGCACAGCGTCTTGCTCAGCGGTGCAGCAGACACGCAAAGTCTGAGAGACCCTAAACA
CAACACGGCACAGCAGTGAGAATACATCAAGCACAGCTGCACAAGCAGTTGAGTGACAAG
AGCCAGACAGAGAAGAGTAGCTGCTGGGTGTGTCATTTATAGGAGGTCAAAAGTAGGCAT
AACTGGGCAGAAATCAATGCCATGACAAAGACAAGCATGGGAATGACATGCACAAAGTTC
CAACTCTTGGATATCTCTGCTGGGGCCAGAGGGGCGTGGGGCTGGAGTGGAGGTGCAGGA
GAGGAAGTCCAAGATTCTGATGTTCTTCTTAAGCAGGTGATAGGTACCAGGACTGTTCAT
TGTATTGAATTTCAAACAATATTTGCACGTATATACTGTATATTTTCTTTAAATACACAC
ACACACATCTACTTCGTAACAAAATCTTTACCTTTTTCTTAAGGGCCTTACAGCGCAGCG
GACACGCGGTGCAGGGCGGGCTCTGCAGCGCTGTGGCGAGGCCTCGGGCGTCCTGCCGGG
CGGCGGGTGCTGTGGGTGGCTGCGGGGCGGGACCAGCTGGTGGGTCTCGCGGCCAGGCCT
CGGGCTTGCGGCAAGGGTGGTTAGGAAGCCTGGCTCCCCAGCCTTCGCTGCTCACAGGCG
GAGTGTTTGTTCCGAAAAGGCTTCTCTGCATGCCTCCCCCTTGAGCCGCCCCCTTTGCCA
GCTGCTGTCTCTCCTTCCAGCCATGCCGGGCGGAGCTCTGGATGCGGCCATGTGTGCTGA
GGAGGCAGGGAGCGAGGAGGACCTGTATGAGGACCTGCACGGCTCTGGCCACCACTACAG
CCACCCTGGAGGGGGCGGTGAGCAGCTGGCCATCAATGAGGTAGGGCCAGGGCTGTGCGG
GCAGGGGTGGGAGTGCTGGGGCCGGACAGATGTGGCCCTGGCCGTGGGCAGCTCCAGCAT
GCTCAGGCCGGAGAGATGCCCACCGCCTGTGTTCCAGGCAGGTGACAGTGCTGCTGGCTG
CACATGGCGAGGGTTCAGCCTGCAGCTCTCACTTTAGGATGTGTTGTCAAGGGCAGCGTT
TGTCCAAACACCAGGCTCCCCCGTGCCCTCCAAGGCCCACCGAGCCACCGAAGAGCAGGC
CTGAGGCAAAAGGCCCTCCTAGTGAGCAGGTCCTGAGAGCCCCCAGCAGGGCACCTCCGA
CCAGCAGACTGAGAACAAGGCCAGTGACACTGTCGTCCCTCCTGTTGACACCAAGAGTTC
AGAAGTATTTCTATAGCTATGACAACTGCATGTGAGTTGCCATATTCCACTATTCCTACC
TAAGCAGAAGAAATCAGTGAGAAACTTCATCAGGGCTAGACAGGTTCCCATCCCACATTC
TCCAAAGAGGGAGAAATTTGGAGGCTTCAATCCATTCTCTCCTTCTCCCTCATCCTCTTA
CTCCCTCACTGTCTCTCACTTCATCTGGCTGTGGACATAATGGCAGAGTCACCAGATGCT
GAGCACAGCACGTGGCCCTGGCAGACATGTGTTCTCCTGGTCACAAAGTACTGCTGTGGG
CCGGGCGCGGTGGCTCACGCCTGTAATCCTAGCACTCTGAGGCTTAGGCGGGCAGATTGC
TCAAGGTCAGGAGTTCGAAACTAGCCTGAGCAAGAGCGAGACCCCATCTCTACTAAAAAT
AGAAAGAAATTAATTGACCAACTAAAAATATATAGAAAAAACTAGCCGGGCATGGTGGCA
CATGCCTGTAGTTCCAGCTACTCAGGAGGCTGAGGCAGGAGGATCGCTTGAGCCCGGGAG
ATTGAGGTTGCTGTGAGCTAGGCTGACGCCACGGCACTCTAGCCCGGGCAACAGAGTAAG
ACTCTGTCTCAAAAAAAAAAAAAATGCTTTATTCAAAATCCATGATGCGTGGGAGAATAA
ATATGTAAATAAGTTAGTTTTTCCAACAAATAACACCTTTCTCATTAAGTGCCTCTCTGA
GCTATTTTGGGTAGAAGGTGTTCTGATATCATGTCATCTTGTACTTTTCCTTGAAGAGTC
AGGCTGAGTCCTCCGTGCTGGGCTCAGCCACAGCAGGGCAGCCCAGGCTGGGGGCCTGTC
AGACGCGGGTGACACGGCGCACCGGCGTGCGACTGAGCGCAGGGTCATCGGCTGTCAAAC
AGGATGGCCCCAAGGCTGCATGAGGGCTGACGGAAAGAGGAGGTGTGTGCGACCTGGCCT
AGAGGGTTCTCAGGAGGTGTCCAGTGGCCAGGATGGGGATGAAGAAGAACATAACAGCTC
GCAGGGACCTGGGGAAGGGTTACCGATTGGCTCAGAGGCGCTGTCTGAGAGCCTACGTCT
GCACCGGGCAGCTGCACGTCTCCTGCTTGACGGTGACATTAGGCAGTGTCGCATCTTGCT
GCTGGCAAGGAGCTGCTTTTGGGGGCCCTTCGTTCTTGGGCAAGATGTTCATTCTAAGGT
GCTTTGGCCAAAGAAAGCCCAAAGAACAAATAACAAATACTCTGGCAGAGGGGCCCCTTT
GTGAGGTCAATGCAGGCAATTTAGATCATGAATTGTGTGCGCACCTATTTGGGCTGCTGA
GAGGATGGTGTCCTGCTGGTTCAAGGTCTTTCTTGGCATGGAGGGTACTGAGCGGACACT
GCTATACCTATGTTTGCAGCACTCTGCACTTTCCAGCAGTGTCCTCCCTAGACCCTTTCC
GTCCCGTGGGAGGGAGGACATGCCACATCAGAGGGACAACAGCAAGTCAGGCAGAGGAGC
CCTCTCCAGTGAGCTGCGGGCTGGCCCAGGGAGGTGGGCTCCGGACCCCTCGGCATCCAC
CCAACGGCTCGCCCGTTTGGGATCTGCCAACGCTTTCAGACCCTTATACCAGGGTCAGGC
TAAGACATGCTGCCCCGAAAGAGGCAGCAGGAAGGCAGGCCAGGGTTTGGAGGACACCTT
TTGGTCCAGCGGAGCATCCCCGGCAGGGCTAGGGAGGCCTCACTGTGCCTAGCTTGTCTT
GGGTACTCAGGAAAGGTAGTGCCTACCTGTTATGACCCACTGAAAGTACTGAAAGAACTC
ACCTCATCAGAAATTCTTTGAAAAGATACAGGAGGTGATTGTCCAGTGACAGGCGAGTTC
CCTGGCCTTACTGCCCCCATGTGCTCAGCAAGAAGCTTTGCTGGGGGTTATCGTGAGTTT
CATACCTAGAGGTGATCAAAGTAACAGGTATCAGGAAAAAGTCCTTAAAAAATAATACTT
GGCTTGCTCTAAATTCACACATTCACTTATATTTTCTAAGAATACATGGGTTCTAAATTG
TGACATTTTCCTGTTCATGTTGAACTCAGGAAGGGAAACCACTTCTTAATTTTCTAAGCA
GAAGGGAACCCAAACCATCTGGCCTAGAGAGCTGTGGACATGGGGAAGGCCAGGGAGGCA
GCTTGTGTTCTGGATACACAGGGAGTGAGCTGTATGCTCGCATGTGTGTACATGCTGTGC
GTGAAAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTC
GCCCCCTCAGTGCCTCCCCCCAGAGGCCACAGCCCAGGCCTGGGCCCGCATGCCCAGTTC
CTTGCCCTCCCTGCCACTTGGCCCTTCTGGGCTGGCCATCCTCCCTGCAGTCAGGCCTGG
GGCCACCCTTAGCCCCAAGACTTCTGAAAAGGTGAGGATACAGCTGGAAGCACCTGCAGT
GTGTGACCACCCAGCCCTGCCCAGGGCAGTGGCAACTTCACTGCTGCACAGGATGACACA
ACCAGGGAGAGGATGGCATGGTGCCTGCTGGGGAGGCCTGGGGTCTCCTGCTGCCACTCA
CTACAGGCCAAGCCACAGCCAGAGCTCCCTCTCGGCTCCCTGGGAGGCTCCAAGGGCCTT
GGGTGTTGGGGTCCCTCCTGCACACCTGCTCCTGCGCTGCTGTGATCCCCTGCTCCAGTA
CAGCAAGGGGGAGACCAGAAGCGGCTTCTGGATCATCCTGCTGATAGGACACATGAAGCC
CAGCTAGAAGGAAGGCAGACGTGGGCAGACAGCCACAGAACCTGTCTTCCCAGCTGGGCT
CGAAGTACAAAAGGGCATCATACTTAGGCCAGCACCAAGGTGGGGCACGCAATTAGACTG
TGGTCCTGCCCGCCGACCACAGGGTGCTCAGGGATAGAAGGCAGTCTCACTGCCTGTGCC
CTCCCCGCACTTTGAAGGAGGGACACCCAGAAGTGCCGGGCACAAGGTCAGTCCTTGGCT
AACCCTCATGGCAGAGTCAGTGGAGCCCGTCTGACCCTCTCGCTGCAGGTGTGTCTCTAT
CTTCCCTGAGCTCTTGTGGTGCTCACCTGGCTCCTGTCCCTCACCCCTACGCAGGCACAG
AGAGCAGCCCAATGCAGGGCGGTGCCCCACACACCTTGTGTTACCCTCACTTGGCTGGAC
AACTTGGGCTTAGATGCTCTGTGGGACGGGGCAGGTGCAGCACCAAGTCTCCTCGAGCCA
CTGCCACCGCGTGTGCCCAGGGCTGCAAGGCTGCCTGGTGGCCAGCCCCTGCACAGCCCC
TTCCTCTTCCCTCTGTGATCCCGAAGCCACAGCACCAGGGGCTCAGTCCTCATCTGCTCC
TGACACCCACATCTCCCCTCGGCTTCCAAGTCAGTCCTGCCACCAGCCTTGGGGGCCACT
CCCCTCCCTGGTTGGAGCCATCCAGCTTGAACCCCTTGAGGGCCTGGGCCTTTGCCTTTG
AGCTTTTTTGTTATACTTTGGTCATGAAACACACATAAGCTGTTGCCACCATCACCCCTG
CTGTATGCCAAGCTCTCCGGGATATACAGGCTGGGGAACCCCCTCGGCCAGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAACTTTCAGCTGCA
AGGGAGGCACAGCTTTCCAGACACTTTTCTGACCCTGGCTGCACACAGGCACCTGAACGT
GCATGTACACACAGATAGGTAGCCACATACCTACACGCGCACACTGGGCGTGCGCACACA
CACACCTGTACACATGTGCACACACCTGGCAGCCACTCTGCGTTGGAGCCCTCAGCAGGA
TGGCTGCGTTCACGAGAGTACTTGTCTGTCCTTCATGGTGTAGCGCTGGCGCACACAGGA
GCTGAGCATACAGAGACAAAGCCACCCGTGTGCGAACACCCAGCCGCTGCACACATTCCC
CCTGCGCGCCCTCCTTCCCTCCGGGGGCCTTCCTGCCTCAAGTGTCAGAGCACTGCGATT
GTTGCCCAGAGATCTCTGCCCGTGGGCAGTGCGGTGGGCTCAGCACTCTCTCCACTGCAG
GCTCATCTCTGCGGACAGCGACGTGTGTGGACAGACGGCAAGACTCGTGCATGAGAGCTT
TGAAACCCTCAGGGTTAAGGCTGCATGCTCGGCCTGGTGGAGGCAGTGGAAGCCCTGGAT
ACCCGACATAGGGTATTTTTTTAAAAAAGCGGCAGAAGCAGCTGCTTTTCCAAAGGAACA
AAACGCTGCTCTGGGTCAGTGGAAGAGCCCCTCAGGGTGAGTCAGTCCCACCCCGGTTCG
AATCCTGCCTCCGCCGTCCTGCGTTCCTGCGCGGACGTTATGCCTGCACGGATTCTAGCG
GGGCCGCACTGGCTCATCTGAGAAGCGGGCGCTGCGGGCAGCCAGTGTCAGCAGCCGGGG
CCCTGCCACCCCTTCTCAAGGCGCCGGCGGCAGGCGCTTTGGCGTCTGCCTGCCTTTCAC
GCCCCGGGGCGTCCCTGAGCGCCCCCTGGTCGTCTGTGCAGCTGACAGTCCTAGGGCCCG
CTTTGCCAACGGTCCCCGCCCCCTCCCAGCAGGCGCGGAGGGCGGAGCGAAGCGCAAGCC
GGGCTGCGGGCGGCCCCACTTGAGGTGCCTTAANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTGGTTGTCTGGAAACGGAGCGAAACTGAACACGCAGCTCTGTGTGGTTG
AGCGAGGTCTGCGGGAGATGCCTGGGCACCCCTGCGCACCTTACCTACAGTTGCTCTCTC
CATTTAGGACTTAAAGTAAGTGGTGTCAGTCTCTCTGGGGACAGAGGCCTGCTGATCCTG
CAAGTGGCACTCCGAACCCCGCCCCGACGCGTGAGGGGGCCAGGCAGGGCGTGAGGGCAG
TGGGAGTTGTCAGGGAGCCTCGCCCTCCCTGGGGTTTATCGAAACCCCAGAGCCACAGGA
GGGGATCCTACTCCCTATTCCTGGTTTGTCTTGGTCTTGAACTTGCCCCTCCACTGGGAA
CAGCCCCTGCCAGGCCAACACATAAATGTCCCTGTGCCTCAGAGCCAGCCTCTGCTCTAC
ACAGAGAGGCAGCCTGGACTCCTCACCCCTCACCGCCCAGGTGCAGCTGCACCTACGATA
GGAGCCAGGAGGGGCCTCTGCCAGGAACCCACCCAGCGTGGATCCTGGGGGCTGCTGGGT
TGTGTGGAGGTGGAGCCTGTCTGTGATGTCTGTGAATCTTGTTTCTGACCTCTTGGAGCC
ACATTTTGTCTTGGTGACAACACAGGAATAGTTAATGTCACTCCTAACTCCTTAGACTAC
CTCCTGTTTGTGGGTCTACACAGGAGCTTGTGACCCATAGGGCAGACCCTGTCACATTGA
GGGGAGGCACAAGGACATCAGAGTACCTGCTCATGGCCATGTGTCTGTGTGGTGCCTCCT
ACATCAGGCATGGTGCAGGGACAAGGAAGGGACAAAGGCAACTAACACCTTCTTCCCAGC
CCCCAAGACTTCCAGGTGACTGGCCAGGTGTGGGGCTCGGTCTCTCCGTGAAGCCCTGCC
TCTGTGCCCCACGTGGAGACCTTCAAGGCCTCGAGCAGACGCCTGCCTTGGGGTGGTCGT
GCCAACTCCCCACGTGTAGGCTGGCTCCTCTCTCATGTGGTCTTTTGAGTCCTTCTTGTC
CTTTGTGTGGCAGCCAGCAGGTCATGATCCTAGGCCCACCTGCAGAGGGTCCTTGTAGCT
GGGAATGGGTGTGACAGTCCCCTGTGGAAGCCTGCTGCCCCTCCGGTGTAACCCAGTGCT
CTGTGCCTGGGTCCCTGCAGGGGCCTCCAGAAGCCTGCAGCCCCTGAGCAGCTTCCACAC
TGAGGGCTTGGGGATGACTCTGAGATGGGGGATGACTGCTCACGTTTGGAGCAGTTTCAC
CTCAGGACAGAGGAAGAACCAGTGGTTCATCCTTCCCTGAACTTGCTTGCTCAGACCCTG
CCCTGGAGGAAAGGCCCCAGCCCGAGTGGGCTTGATGCTGCAGTGGCCAGCCGCAGCCCC
TGCCCTGCCCACGCAGGCACAGAGGCTCCCAGCCTGAAACACAGGAGGAGGATCAGGCAC
AGTGAAGCCAAGGGAGGGCTCACCTGGGATGGGGCAGGTCAGAGGAGGGGTCACTGCAAA
GGTCCTGTCTGGTGGTGCTCCACTTCATCCTTGACCACTTAGCCAGGCCCATGGCTATGA
CAGCTGGAGCCAACACCTGGTCCCAGCAGGGAGGGGCATGGACCTCACCTTCTGTGCAGC
CTCCAGCCCAACCCTCCTCTCCTGCCCTAAGCCCCTGGGGCCATTCATCATTCATGAAGT
GGAAACAGCCCACAGTACAGGAAAGCAGGGGTCAGCCCAACGGGAAATGGGGCTCCGCTT
GCGAGAGCCGCCTGGGAGGGCAAGGGCATGTGCCTCACGGCCCATCAGCCCACAGCCACT
CAGAAGAAAGGAGCCACACAGTTACTTGAGCAAAGGGAAAGGAATGTGAAGAGTCATCAG
CTAGGTGTAAAGTGTGTGACCTGCAACGCAGCAGTGTGGGAGANNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGGTATCTGGGCCATGAGCGGTCAGACAAGGGTACTGCGAGACT
GGTTCTGCAAGTGTCAAAAACCCACAGCCAACTAGCTCCAGCTCCCGTGGCGGCCAGGCG
TGTGGAAGCCGGATGACACAGCACTGTGGCTGTGGGGTGAGAAGCCCAGAGGGGGAGCCA
CCCCCTCCCTCCTGCAGCCTTTCAGCCCTCAAATGTTGCCTTAGGAGAGCCTGACAGGCT
CTGGCACGATCCCAGCGGCAGGACCGGCTCCTGCGGCTAGTTCACAGGATCTGCATCAGG
CTCCATCCCTGAGCCCGACAATCCAGACATGCCAGGATGCAGCCCGGTCCAGGTGTGCGG
CTGGCCAGCAGGGAGCCTCGTGGGCTCCTCTGTAAAGGAGTCAGGATCCCCTCTTCCTAG
GACTGCAAGGTGTGGGGACAGAGGGCAGGGAGGCCTAGGCAGCCCCGCCCCACTGACCCT
CCTGCCCATGCCTCTCTCCTCAGCTTATCAGCGATGGCAGTGTGGTCTGTGCTGAAGCGC
TCTGGGACCATGTCACCATGGATGACCAGGAACTGGGCTTCAAAGCTGGGGATGTCATCG
AAGTGATGGATGCCACCAACAGAGAGTGGTGGTGGGGCCGAGTCTCCGACGGCGAGGGGT
GGTTTCCAGCCAGCTTCGTTCGGGTATGGTTCCTGCCTGAGCTTCTCCTGGGCCAGGCCC
ATCAGGAGCCACCTGGCTCTTCTCAAATCCAAGCCTAAGACAGCTCTGGTGTCGAGATGC
TGGGTGTGGACCACGCCTGGGGTGCCGAGGGCAGGGTGGGTGGGCATCAGGGAGCTGTAA
CACATCCCTCCTCCTCCTGCAGAGCCACCACCTTCTCCATCCCCTGCTCCCGCCCCACCC
CCAACTCGCCGCCAGCCCTCTAGGGCCAGAAAGGTCAGAACGAAGGCGGAAGTCCACCCC
TCCGAGACTGCCACCACACACAACTCTGTCCACATGGGCCATCTCATTTAACACTCACAC
AGCACTGGGAGGTGGGAACCACGACTTACACCTGAGGAAACTGAGGCACAGATAAGTTAA
GTCATTAGCCCTACAGATCACAAGGAGGCCACATACATCCCCCCTAAGGCGGCCTCTGAT
CTCCAAAGACGACAAACAGGTTTTGTCTCCAAAAGGTCAGGCTGAGGGGCCCTGGCCTGG
CGTATGGGCGCTTCTCCTGCCCCAGACCCCATGGGTAAACTGTGCGTTTTGTGCCCCAAG
CCATTCCCCAAGGTCCAGGGGGACCGGTCTGGGCAGACGCTGGTTCTGTGCAGACCACTG
GCCGAGGCTGGGGATGGGGAGTGCGGGCCTTTGGAGCAGCCGCATGGTCTCCGGTGACGC
CGGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCATCGAGGACATCTCCCGGGTGCCCAGAAGGGCGTTCGTGAAGGGCCCCTGGAGC
AGAAGTTTCAACCCGCGAGCGCCCGCACCTGAGCGAGCTGGGCGCCTGCTTTCCTGGAGC
ACGTGAGCACCCCGGCCCCGCTGCCCACCTGGCTCTGGCCGCCTCCGCTTGGAGGCTGCC
CGGCTCGCTCATGCCCGGGCCACCGGCCGCTCTGTTCCCAGAAGTTGCCACACTCTGGGT
GCGCTAGGCTCCAGCCCTCTACCTGCCCAGTGGCCCAAACTTCAGCATGGTTTTAGGAGT
GTCTCTGCTTCTGCTGCTGCCTGGGGTGATCCAGTCAGGAAAGGCTCCTGGGGGCAGGGG
CCTGAGGCGTTGCTGCAGAGGGGTTTGCTTTGGCCAGAGAGGGGAACAAAGGTGGGCTGG
GCCACCTGTGGAGCGCCCCAGGGCTGCTCTTAACAGATTCTGGGGTTCCCCAAGCAGTGA
GCAAACTAGAATTTATGTGGAACTTACAACTTATGTCCACTCTAAATGCCAGTTTGCGCT
TAGCCAAGGTCTACTGGGTTGGTCCGGTCCAGATGGAACTGCTTCTGGCCTCACTTGGTA
GGGAAGGGACTTGTTTTATCCCTCTCCTGGAGCAGTCATGTGGGGTTGTGCAAAGAATGT
CGGTCACCCGACACAGCCCCACTTTTGGCTTAACAGCCCTTCCTTAATGACATCATTGGT
TACGCCAGAACACTGTGCTGCAGAGAGAGCCAGGCACAGCGGGGGCAGGCACACACCCAT
GTTCCCAGAGGTCTTTACCCTTGCTGGGCATGACTCCATGTGATGTGCCCTGCGAATTAG
GTAGACAGAGCTGCCCCCCTGAGCCTGGCTCCTTAAGGAAGTGCAGAGGCTTTTGCCCTT
CCCAGACATGTGGCTGGGTTGCCTGGGCATGCAGAAGATGCCTTCCTAACCTCCAGCTGT
TCCCCCAGCAAGCAGACTTCCAGATTTACTCCGAGTACTGCAACAACCACCCCAACGCCT
GCGTGGAGCTCTCCCGGCTGGCCAAGCTCAGCAAGTACGTGTACTTCTTTGAGGCCTGCC
GGCTGCTGCAGAAAATGATCGACATCTCCCTGGACGGCTTCCTGCTGACCCCAGTGCAGA
AGATCTGCAAGTACCCTCTGCAGCTGGCTGAGCTGCTCAAGTACACACACCCCCAGCACA
GGTAGGAGGGCACCAAAGCAGGGAGGTGGCCCAAGGCTCTGCACACCTCCCATCAGCCAG
TTTGTCGGGCACTTGCAGTGTGTAGGGCACTGGGGCAACATAGAAAAATAGCCCTGCCCT
AACGAGCTCTCCTTGCAGTGAGGGAGAGACTATCAGTAGGATATAAACTGTGCTCTGTGC
CTGGCATTTGTGGCACAGAGAGGCACTGTGCATTTGAGGGGTGAGGATGTGGCCACGGGG
CACGGCCCCAGAGAAGAGCAGCTCCACACATGGGGGCTGCAGGAGACCCCACACCCCAGC
TTCTTCGGGCAGCAGCCCTCCATGTCTGTTCTGCCCCAGGGACTTCAAGGATGTAGAAGC
TGCTTTGCATGCCATGAAGAACGTGGCCCAGCTCATCAATGAACGGAAACGGAGACTTGA
AAACATCGACAAGATTGCTCAGTGGCAGAGCTCCATTGAGGACTGGGAGGTGAGGGCCTG
GGGGCCCAGAAAATACCCTACAGTCTTGGCCTCTTGCTTCAAAATAGCACTTGCCCCTGA
AAACTCTAGGGAGGACTGAAGCAGGGAGCCGTGCTCCTGGGAGCTAGCAAACACATGCCG
GTGTGGGAAAGCAGTCCCTTAAGGTGCAGGTGCCAGGCCCTTGGGGCTGCCTCCCAAAGC
TGGCTTTGGTGGCCCCTTTCCTACGTGAGATACCATCGTGAGCAGCCCGCGCACCCGCCC
AGGAGAAGCTCCAGCAGTAGTGCTGCTCTTCTGCCTTCAGGAGACAGGTCGGATGCCTGA
GTTTGAGTTCACTTCTGGGATTCCCAGCAGAGGGTGCAGGGCTGATACACAGTGTTGACC
TCCTGGTTCTGTTTCTCTGGCTTGCGTGTTTCCTTTGTACCTGCCAGTCTAGCCTTCTGA
GGCAGTGGGGCCTTAGAACTGTAGGGTTCCTGTCCCCTCCACACCCGGCCAATCTGCCTC
CTCCTGGAGCGCCGCTCTGGAGGGCTCCCCGCCTGCACGGGTGCCGGCACTGCCTGCCAT
GCGCTCTACCAGCTGTCTGGAAGAGAAATGACCTGAACATCAACCAGAGTAACCATAGAA
TGTTGTAAAAAGATGGATTCCTGGGCCTCACCTCAACATAACTGAGAGTCCCTGGGGTGG
GGCTGAGCAATGTGGGCCAAGGACCCCTGTAGACTCACTCACCCCAAACCTGTTGCTACC
CACAACCCCTGGCTGTGGTTTGCATTTTCAAGAAGGAACCAGAGGGGCAGGGCTTAGTCT
AAAACTTTGAAGGCCAGATGGGGGATGATGGACCTTCAGGTACCATCATCCACTGGGAAG
AGGGCCTCCTTAGAACTCAAGATTGGCCTCAGAGGTGAATTCCAGCCAGCCTTAATTTTT
TTCCAGGGCAGCACTATCTAGTCAAAATATCATGTGAGCCACATACCGAATCTGATACTT
TCTAGCAGTCATCTTAAAGAAGGAAAAAAGAAAAAATAGGTGGACCTAATTTTAATATTT
TAACTCAATGTTTAAAATAGCATTTCAACTTGTAATCAACATAAAATATCATTAATGAAA
TAGTTTACATTCATTATTTCATACTAAGTCTTCACTGACATCACATCTCAATCAGGATTG
GCCACATTTCCAGTACTCAGGAGCCACATGAAGCCACGTGGCTACAGTGGAGTCCTGTTT
TGCAAAGATAGCAACTCACAGGGCAGACCTGCCCCCATGGCCCTGCCTGCCCCCACCCTC
CGGACTCAGAGGCCTTCTCTGGGCTTCAGGAGCATCGCTCCCACCCGGGCCTGCCTGGTG
GGGCCCCCCAACCTGTGACGGAGGCAAGAAGTGGTGCCTGAGGTTGGGTGCACTCAACTC
GGGGTTCTCCTTGGGTCTCCCCAGGGGGAAGATCTTTTGGTCAGGAGCTCGGAACTCATC
TACTCAGGGGAGCTGACTCGAGTTATACAGCCTCAAGCTAAGAGCCAGCAGAGAATGTTC
TTTCTCTTTGACCACCAACTTATCTACTGTAAGANNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCCCCCCCCCCCAG
GAGCTCCACATCTGCAGGGGAGGTGGGTGCATGGCCACCAGCCCCTCCTGTGGCCTGGCA
GAGGGGTCAGGGGCAGGTCTGGACAGCATCAGGTGGACGGTTCGGGCGCCAGGGCTCAGA
GTGGTATCTGGCAGGACCTGCTCCGCCGGGACGTGCTGTACTACAAGGGCCGGCTAGACA
TGGACAGCCTGGAGGTAGTAGACCTTGAGGATGGGAAGGACAGAGACCTCCACGTGAGCC
TCAAGAACGCCTTCAGGCTGCACTGTGGCACCACGGGGGACGGCCACCTGCTGTGCACCA
GGAAGCCCGAGCAGAAGCAGCGCTGGCTCAAGGCCTTTGCCAGGGAGAGGGAGCAGGTGT
GGCTGGACCAGGAGACAGGTGCGAGACCCTGCTGGGCCATGGCCCACCCAGCCTTCCTGC
CCTACCCAGCCCTCCTGCCCCACCTGGCTGCTGGTCAGGATGGCCTCAAAACTGAGATAG
CATTTGGTGAGGCTTAAGGCACCTCTTTGTCCCAGTTGAGAGCACAAGGCACTGTCTTTG
TCACCCCACTGGCAGGATCACCTGTGGCCCATGATGGCATTTCCTCAGCGTTCAGTGCCC
AGGGGAAGGGTCTGCTGGCTCTGGGTGGGGGATGCTTCCCTACATGTGGGACACATGCAT
GCGCTCCACAGGGCAGGGGCCCTCTGCTCAGTGCACCGGCTGCTGAGATGTGGGGGCCCT
TTCTAGCCAGCACAACCCCTGGAGAGCACTGGAGTAGAAGACGAGTAGTGGCTTCAGAAG
CCTCCCCACCCCACGTGAGCAGATGTCTCCCTGCTGCATCCCCTCCTGGTCACAGTCCCC
AGGCGTTATCGTTGGCAGTGACCAGGTTGGCTCTCGGTCTGGGAAAGAGCCTCCACTGCA
GTGGAGAGAAAGGACACTAGACACTGGGCAGGTTGGGGGGGGGGGGCATCCAGGCTGGGT
GAGATGGGCGGGCACAGGGATCTCGTTCTCTGCCTGGGCCACCAGATGGGGCACCAGGGT
GTCTCCTCTGCCCTGGTTGGTCAAGGCAGGCTGACTTCACAGGATGAGGGACGGTCCCTG
CTGTGGCCAGGACCCAGTCCCTGAGGTGTGATGGGACCCCAGGCACTGTGAGAGGTATAG
ATGTGCAGAAAGGACTACGCCTGAGGCCAGGGAGCACGAGAAGCTGAGGAGAAATGTGGG
CAGGGGGACGATGGGGCCAGGTCTCACCTGCGTACCCCTGCCCCCAGGATTCATCATCAC
TGAGCTGCAGAGGAAGCAGGCCATGCTGAACGCCAGCAAGGAGCAGGCCACTGGGAAGCC
CAAAGGTAAGTGGGCAGCAGTCCCACCTCCTCAGCCGCCTGCCCCTGCCTTGATCGCATT
CCCTTCTCTAGCCCCAAAGCGAAGCCAGCAGTATAGCCACCTGGGTCCTCAGAGGTGCCC
ACTGCCCTTTGCAGGTTTTGTTCCTAAAGGCTGGTGATAAGGGGCACCCAGTGATCATAC
AGTTGATGTTTTGCTCTCAAGTCTTGGCCCCCCACCACAGAGGGCACCACCAGTGACAGT
TCTTACATCCTGTGGCTACACCCTCACAGACACCTGGGAGGGAAGGAGCTAATCTCTCCA
TTTCTATGGATGGAGCCAAGGCTCTGAAACATCTCATCCCTTGCACAGGCCCAGGGCACT
CCCCTCTTCTGGCCAGGCCCAGGCTAGAGGCTTCAGACAGCCCGCCGGGGCTAAGTCCTA
TGTGGCTAAGCTGCCACCTCTGGGTGGTCTGAGGCAGAGCCCTGGGACCACCCCATGCTA
CTACCCCCATAGCAGGGGCTGCTGCTCCGCCCTGGGCACCCATGACCCCTGCCGTCTCTC
CCTGCCCAGCTGTTGGCCGGCCTTGCTATCTGACACGCCAGAAGCACCCGGCACTGCCCA
GCAGCCGGCCCCAGCCACAGGTCTTGGTGCTAGCAGAGCCCAGGCGGAAGCCGTCCACCT
TCTGGCATAGCATCAGTCGGCTGGCACCCTTCCGCAAGTGAGCCAGCACCCCACCTACAG
GTCTTGGTGGCCCTGCTCGCCAGCAGTCCCCAGCTTTTCCTCCCTGAGGCACACTCCATC
TGGCCCTTCTCTGCCTATTCCACAACCTGGAAATGATCAGGGCTGAGCAACGGAGTTGCT
GCTCATGCCACCAGGACATGCAACCTGCCAGGTCTGTGCTTCCATTCTTGGTTTTTTCAC
TGCTCCTGTAACAGTGAGGAGGCCAGCTAGAAGAGGCAGGGGCCCCACGCGCGCAGCCCC
TCCAGCCATCCAGACCTGTGCCAAGCCCCCGCTACCCCTGTGCCTGGGAACCACAGCTCA
GAGCCAGTGACTGGGCTGACTACTATGGATGCTCTTTGGAAAGCTAGTCTTCCCTTCTCC
CATCTTCTCTGGGCAGGAGTGGCTGACTCTTTGGCCTTTGGCGGCCACAAGGCCAGGCCA
TGTGCCCCTCTCTGCCCTCCAGTTCTCCTTTTGGGCCCCAGCCCAGCCGGTGGCCCCAGG
CAGCTTGTGAGCTTGGAGGGTGGGAACCAGGAATTCTGTGCCCCAATGTTTGGCCCAGAG
CCCACCCTTCTGCCTTCCAGCCCATCTCTAGACACTGCTAGCCGCTGGACACCCTCTTCC
CTTGTGATGTGTGTCTGTAGTGGAAAGAACAGGCCCGCAGAGTCAGCTGTGCATACAGTC
CGGGCGTGTACCAGCCCACCTGTAGCTGTGGGGTGCCTGCTCAGCCACCCAGTTCTTATT
TTTCTTGTTTGGATTTTGTCATCTTGTTTTTCTAACAATCGAGAAAAATAACTGATTCTT
GTTAGTGACACAGAAAGATTGCCTTACCCTAGTGAGCGTGAGAAGCCATAAGGACTGAAT
TCTGTGGCCCAGCATCCAGGACTGGCCAGCACCCCAGGCAGTGGGCACGTGGAGAATGCC
CCCTCCGCTGAGGGGCGCCCACCCAGTGTGTCCGGGCAGAGGCCACAGGACTCAGCAGCA
TGGACAGTCACTCCTGCACTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1127, 24920..25059, 34043..34222, 35222..35398, 35694..35782, 35785..35797, 35799..35808, 35811..35829, 35832..35870, 35872..35881, 36728..36960, 37299..37428, 38844..38975, 39734..39977, 40847..40924, 41469..41620
1001..1127, 24920..25059, 34043..34222, 35222..35398, 35694..35782, 35785..35797, 35799..35808, 35811..35829, 35832..35870, 35872..35881, 36728..36960, 37299..37428, 38844..38975, 39734..39977, 40847..40924, 41469..41617
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved