Microcebus_murinus Locus NOL5A
snOPY snoRNA Orthological Gene Database
Microcebus_murinus NOL5A
Microcebus_murinus
NOL5A
GeneScaffold_3330
SNORD110, SNORA51, SNORD86, SNORD56, SNORD57
2187..2256, 3005..3137, 4040..4125, 4564..4635, 4960..5031
7072
AATAGTCGCCTGAGTGCCCAAAAGCCACCCTCGAGGACAGGGAAGCAGCTCCCATTCAC
TCGGAGCTAAGAACTTAGGGCCGGTCGAACCGGTGAGCAACACGTGGCCCGGCAAAAGGA
GCAGGGTCCCCAGGAACAGAGGAACAAGAAACCGGTAAGGCAAACGTGAGACCGCCTTTC
TTTCTCACGTTATTGCCTGCCTCCGTCACTTTTTAAAAATAATTAATAAATTCAACCGCA
CCAAGACGACCGCGAGGAGCCATGTTTCCCGGAGTCTGCGCCAGAGCGCCCCGGGGACCG
CTCCTGTCCCTGGAAGGAGGAAAGGGCGCGCGACCCATGGGGCCCCGGGGAGGATCGTCC
CCGAGTGAGAGGCGAGAATGGAAGGGTCCTGAGGGCGTGGGGCGCAGGGAGGGGTCTGGG
GCCCGAGGTCACCGGCGCTGCGGAACGCCGGCTCCGCAAGGGTCTGGGACGGTAGCCGCG
CCCAAACAGAGCCTCCCGCCACGATTCACCGAGCTCTGCCGCCCGCAACCTATATGACGA
CAACGTGAGCGACCGGACCATTATCCGGAAAAGGGCCTTTCCAAACGTCTTGCGGCCTGC
AAGGCCCGACTCGCTCCCGCGCGTCCCAGGCAACCGCGCCCGCCCGCGCAGCTGCAGAGG
CCGGAAAAGACCCTCTTGCCCGCGCTCCGCGCCATCCCCGGACGCTACCACCCCCGCGGA
CCCCTCCGGAGCCCGGAAATGGTGCCGTCCCCAGCCTCTGATTGGTCGGCGAGGCTGGGG
CGTGGCCTCTGGAGCCTGGGTCCGCGCGCCAGAGCGCGCCAGCCGCATTGCGAGCCGAGC
AAGGAGTGGGCGCCATGTGAGGAGTGCGGCGGGTCGCGGGCGAAGCGGAGGCGGCGGTGT
GGGCCCGAGTTCGGGCCCCAGGCCGGTCCCGAGCCAGCGCTGGGAGCGGGGCTGGGCGCA
CAGAGTCCGCGTTGACGCTTGCGCCCCGGCTCCCATTCCAGGTCCTGTTGCACGTGCTGT
TCGAGCACGCGGTCGGCTACGCGCTGCTGGCGCTGAAGGAGGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATCA
TTAGGGGCATTTAGAAATGGGCTCCGGGACTCGCCCGTGCCGATTGGAGCAGAACCCGGA
TGTGGGGCCAGGGATCGGTACATTTTTAAAACGTCCAGGGGCTGAGAACCGCTGCTTTAC
TGCGCCGCAGAGGCAAGAGCAAAGAAACCGCTCATCCGCTTTCTCCCCACACCCGCAGGT
GGAGGAGTGCGTGCTCAACCTGGGCAAATTCCACAACATCGTTCGTCTAGTGGCCTTTTG
TCCCTTTGCCTCATCCCAGGTTGCCTTGGAAAATGCCAATGCAGTGTCTGAAGGTGAGTC
AGCCACCGAGTCTTTCAAAGAGAAGCTATGTGCGGTTCTTTACGTTATCTTCTTAGAGGG
TTTAATAGTACTTACCTTTCCTTCCGCGCTAGCTCTAAATCTGGTAGGTGTTTGGGCAGT
ATTGGAGACGAACAGGATGTCATTTAACATGATTAATTGTCTTCCCTGAGCTCAAGATCT
GGGAACTGTGGTAGACAGAGTCTTCCACATTTAAAGGCCACGATCCAGGATGCAGATATT
ATTTCTCTTGGGGAACTGTAGTGACAAGTGATTCTCTTTTTTTTTTCCCCAGCATGTTAT
GGGGGTACAGATTTTAAGGTTTCAATAAATGCCCTTTCTCCCCCTCCCCCCACAAGGCAA
ATGATTCTTAAATGAAATGGAGGGGGCTGGTTTAACACCCACCTGTGCTCCCGTTTGGCA
AAACACAATCAAATTTCTATTTCTCTGCTATACCTTCCAATTGATTAAAACAGGCAATTT
TGATAAACAAAAGCCAAGAAAAAGATTTGTTCCCAGAAGGCAATTGAGGTACTAACTACT
TAAGGTTGTGTTATAAGCTTTCAACTATGTATTTCATACCTGTGCTCTTGGACCCGAGTG
CAGTTCCTCCCGTGGTTGGGCCAGGCTTTGCAGTGATGACTTTGGTATCTGTCAATCCCC
TGAGTGCAGTCACTGATGTCTCTGTGTCTCTGAGCAATGCCTGGCAGGGAGGGGTCTAGG
CATGCCACTCCAGCATGCTCCAGGAGACCAGCTGAGGGGGTGAGATCCTTTTGCATCTTC
CAGCATGTTAGTGGGAGCTATGTTCTCTGTGCCTTGAGGTGTTGTTCATGAGGACCTCCG
TCTGTTCTTGGAGACCCACCTGCCGTCCAAGAAGAAGAAAGTACTCTTGGGGGTTGGGGA
TCCCAAGATTGGTGCTGCAATACAAGAGGAATTGGGGTACAACTGCCAGACTGGAGGCGT
GGTAGCTGAGGTCCTGCGAGGTGAGACCATCATATGTCATGCTCCTGCCATTCTTTACCT
CTTCAGGGGGGGTTCAGGTGCTTCTGGGGAGGCCTCATGTTTGGCTGGTGCCCATGAGTG
CAGGAGCTAGCTCAGAGCCCTTCCTTGCTTACAGTCCTGCCCTCCTCTTAGGAGTCCGTC
TGCACTTCCATAATCTGGTGAAAGGTCTGACCGATCTGTCTGCTTGCAAAGCCCAACTGG
GGGCTAGGACACAGCTATCTCGTGCCAAAGTTAAGTTTAATGTGAATCGGGTGGACAATA
TGATCATCCAATCCATTAGTCTCCTGGACCAGCTGGATAAAGACATCAATACCTTCTCTA
TGCGTGTCAGGTAAAGTCCAGGGGCCATGGAATGGAATCTTTGCCCTGTAGTTTACCTAA
TTCAGAGTCTTGAGCAGAACTGACAATTCCCTTGGGTGGAACCATGTGGGCTGTGGCTGG
GCCTTGGCCTCCCAGTGCTTACCACAGGCTGTGTTCTTACGCTGCCTGTATAGAAAGAGG
AGGCAGAGTAAAGCTACCCCATGTACACCCCCAGCCCAGGCCCTGTGCCTGGTCTGTATT
GTGAATGGGGGAACATGGAGTTGAGGGGGGTTTGAATCTAAGGTGCTCCCATTTCTCCAG
GCAGGCAGTAGGTGTGGAGAGGGCTGAGGCTGTGGCTTTCTTGCTTGAGAGGAGGCAACT
GGGCTGAGAGTGACTGTGGCTCTTTGCAGGGAGTGGTATGGGTATCACTTTCCGGAGCTG
GTGAAGATCATCAACGACAATGCCACATACTGCCGCCTTGCCCAGTATATTGGAAACCGA
AGAGAGCTGAATGAGGAAAAGTTGGAGAAGCTGGAGGAGCTGACAATGGATGGGGCCAAG
GCTAAGGCAATTCTAGATGCCTCGCGGTCCTCCATGGGTCAGTACAGAGCCTGGCAGCCA
GCATAAGGTACAGGGCCCTGTGTAGCTGGCTGTTGGATTGACACTTGGTGTTTCCTAGGT
ATGGACATATCTGCCATTGACTTGATAAACATCGAGAGCTTTTCCAGTCGTGTGGTGTCT
TTGTCAGAGTACCGCCAGAGCCTGCACACTTACCTGCGCTCCAAGATGAGCCAAGTAGCC
CCCAGCCTATCAGCCCTCATTGGGGAAGCGGTGCGTCATGGGGGATACTAAAATAGAGGC
ATGGGTGTGTTACCATGTGCATCTGCACTGCTGTATTTCCTGGTCCACTGTATCTTCCCT
GGTTGTGCTTGATGGGGAGGAGGAGAACAGGGGTCATGCACCTGGCAGCTCAGCAGTTAC
AGCTGAGCTCTGACTCCTTCCTTGACTTTTTCTCCAGGTAGGTGCACGTCTCATCGCCCA
TGCTGGCAGCCTCACCAACCTGGCCAAGTATCCAGCATCCACTGTGCAGATCCTTGGGGC
TGAAAAGGCCCTGTTCAGGTACCAGTGCGGGCACCTGCCCACACTCAGGTGCCACTTCTG
GTGTCCACTGCTTATTTGGGGATCACAGTGATGGCCAACCAGGGCTCCCTGACCTATACA
GGCCTCTGCTATGGGGGTGATGGCCAGTCCTGGTGTCTGAGTGATTCCCAGGGCCCAGCA
AAGGGACCAAGTTTCCAGGTCAGCGACATTGGATGCCTTCCCTCTGCCTCTGGGAGCTGT
GGGTTGGCATGCACTGGGGAAGCGATCCAGCCTGTCCTGAGGCTCTGGGGACTGGGGGGA
AGGGGGGGCGGAGCACGGGGCAAGTTACCCTGGCTAATGGGGTTGAAATTTCTCATCTTA
AACTCTCCACTGAATGTTCTCTCAGAGCCCTGAAGACAAGGGGTAACACACCAAAATATG
GACTCATTTTCCACTCCACCTTCATTGGCCGAGCAGCTGCCAAGAACAAAGGCCGCATCT
CCCGATACCTGGCAAACAAATGCAGTATTGCCTCACGAATCGATTGCTTCTCTGGTATGG
GTGGGGGGGTTGGCACTTGTGAGGAGAGGGGGCTGGAGTGGGGGGCTGACTACCTTAGCA
GCTTCTACGATGATGGTAGTATTTTTCGTCAACAGCAGTTCACCTAGTGAGGGGTTGATA
CTTCGTGTCTGATTGAAGATGACTGATGGAAGGAATACCGGGTGGGGACAGGGGGGGCTG
CTTTGTTCCATTCTGGAGCTGACTAGCTTCCATTTACNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCTTCGAGAACAAGTTGAGGAACGGTTGTCCTTCTATGAAACTG
GAGAGATTCCGAGAAAGAATCTGGACGTCATGAAGGAAGCCGTGGTTCAGGTCAGTGGTT
GGGGTCTCTGGGTAGGGGGCAGAGCCACACAACTGACTGTTGGAGGTGATGAACTGTCTC
AGCCTGACCTTGTAGAGTGGAGGCAAAAAAACTGATTTAATGAGGCTGATCCAATAAAAC
TACAAAGGAGGCTTAGAAACACCAGAGGTTTTCAAGCCTTTTCAGCACTTTTCTTTGACC
AGGCAGAGGAGGCGGCTGCTGAGATTGCTAGAAAACTGGAGAAACAGGAGAAGAAACGCT
TGAAGAAGGAAAAGAAACGACTGGCTGCGCTTGCCCTCGCTTCAGAAAACAGCAGTAGTA
CTCAGGAGGAGTGTGAGGTCAGTAAGCAGATGAGATCCTAGGTGGTAGGATTTTCAACAG
CAGAACAAAGGATGTGCTTCGTCAAGCCGTGGTCTTGAGTCCAGGCTTTTGGACTAAAAC
AAGGACCTGAAACATCTCAAACTACCTCTTGATTCTATAGGAAGGAGATAGGTGCTGAGA
GAACTTGCTCAAGAGCCCAGAGAGCTGGTTGTAGCACACACCCGTTCCCTGGGCAAGTGT
ATTCTGTCCTCGGCTGCCTCCCAGGAGTCCTCAACCTGGGGTAGTGTAAATTCCTGCTCT
GCTTCTTCTCAGACGTGTGTCCGGAAGTGGTAGTGTCTCTCAGTGGGGATGGGGGCAGGG
AGGTTGCCAGCGTGTGAGGCTAGATTCATTCTCCCTGGGGTTTTCATTTAGTCCCCACTT
TGTTAAACAGTGTTTCAGGGTCTCCTCTGGAACTTGGCATGATGGTTCTATTGTGACCAG
CATGGTGGGTTTTTCTATAGGTTATTTAATGGGCTGAGGTACAAACTATCTCATTACATG
TTCTCCCTTAACTTCTAATTGGGAGTAGCCTTTGGGGTAGACTTCCACAGTTATACCCAC
ACAATTTTAAAAACCATCCCAGAAACACTGCGCAACTTTAACAGAACTTTGCCAGTTTTC
CTGCCCTGGCTCTACTGCTGAAAATGTAATGGGTGTGTGTGTGTGCGTGCAGACAATAGT
TGACACTGTTTTCATGCCTATTTCCCCCTCTTCCCTTTAGGAGACGGTTGAAAAACCCAA
AAAGAAGAAAAAGCAAAAGCCCCAGGAGGTTCCTCAGGAGAATGGAATGGAAGACCACCC
ATCTATCTCTGTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1090, 1438..1552, 2378..2539, 2691..2761, 2763..2777, 2780..2889, 3269..3456, 3538..3689, 3877..3977, 4345..4493, 4788..4909, 5102..5236, 5980..6072
1001..1090, 1438..1552, 2378..2539, 2691..2761, 2763..2777, 2780..2889, 3269..3456, 3538..3689, 3877..3977, 4345..4493, 4788..4909, 5102..5236, 5980..6072
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved