Microcebus_murinus Locus PPIB
snOPY snoRNA Orthological Gene Database
Microcebus_murinus PPIB
Microcebus_murinus
PPIB
GeneScaffold_2845
SNORA62
4724..4877
7311
TTAGTGCTAATGTGAAGCTATCCCAACTTACTTGCTGAGCACTTAGTCCTGCAGCTGTG
TTGAGGGAGCTGTATACAGATTAAGTGGAACACAAACCCTTGCTCTCAAAAAACGTAATC
ACTTGGGGAAACAAATAGGTAAAGAAAGGAAGTTAGCCACTGTATACAATAAAGTGCACA
TTGACTCATACAGCAGTAAGCACAGCAAGATTAGAGAAGGGAAAGAGAAACAGGTAGTAA
AGTGACAGGGGCTAAATACCAAAGGAAACGTGTTTTCAAGTTTTGCAAGACAAGAAGGAG
CTGTACAAGGTCATACTCTGGGTAAGGATCAATGTGCTCTGAGTTTTGGGAGCTACCATA
CTTAAACCCAATTAGGTGGTGACCAACGCTTGACTGGACTAATACAAACAGTGGCAAGTG
TCCTCTGCCCCATCCAGGCCCACGGATTTCCTAACATCTGGCGTCTGCCACCAAAGGGCC
CAGAGAGGAGTGCTCCCGGGAAGGCGGAGCGGGCGCCAGGGCCAGGCCGCCAGGCCTGCT
TGGAGCTGGTAGTCTGTCCAGAGACGCCTCGCTCCGTCTTCTCGGGCGCCGACTTCCGCG
ACTGCCTTCTTGTGGGTGGGGGGCGCGAACGGGCATTCTATGAGGCAGTGGTAACGTGGG
CAGCAACCACGAGTCGCCAATCCACCCGCCCTGCGAACCCGGGGCCCACGCCCAGGGAAG
GACACTACACCAGGACGATGGTAGGGGAATACATCGACCCCACGCCCGACGAGAGAGCGT
GGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAAGGGGCCCAAAGTCACCG
TCAAGGTCTGGGCCCTCCCTTCCCGCCCTGCCTGGCGCGGCCCGCCCTCCGCCGCCTGGG
TCCGGCCTCGGCGCCGCGGCCAGCTGGTCCCAGACATTTAGGGTCTCGGAGCCCCAGCTT
GGGCGGCTCTGGCTCTGATTCGGCCCCTCTGCTGCTCCCGGCTGCGGCCTCGTGGCGCCT
GGGCCGTCCCACCCTTTCTGACCGGAGCGTGGCCCGGACCCTTTCCGACAGCCCCTCCAC
TGACCCAGGGAGTCACCGGGTGCTCGGCATGCCAGCGGGGCCCGCACTGGCACCTCAGAG
CAGGCTTTTTGCAAACGCCCCGCAGTACTGGGGAGATGGTGAAAGATCACCCCTGCCAAA
TTAGGAATCTTTTTCTCCCCTTAAGCCAATTTTTAGGCACTTCTAGTTATAAAGCACAGT
AAATATAGTTTAAGTTTGCGTGGTGTGCTTGGGCTCCCCTCCTTATGGGTTTCCTTTATG
TTAATTTCTGGAATTGGGGCTTTTTTTTTTCTTTCTGAGCATAGATTATTATCCTGTAGT
TTAAGGAGAGTATAAACAAACGTTTCCCAGGAATAGGGTCTGGAGCTTTCATTAGAATCT
CACAGGGGTTTTGCCTACACCAAAATCAGGTTCAGAACCACTTTTCTAAAAATATGGCTC
TGTTCTCTCTCCCGTCCTCACGGTAGACTTTTGTGCCCTGCTTAACCTAGCAAGACTCTA
AAAAGGAAGCTAAGTTTGAAATGGTCTTTTTCCTCAGGTGTACTTTGACCTACGAATTGG
AGATGAAGATGTGGGCAGAGTGGTCTTCGGTCTCTTTGGAAAGACTGTTCCAAAAACAGT
GGATAATTTCGTGGCCTTAGCTACAGGAGAGGTAAGTGGCCAGAGCAGAGGTTGTCAACT
CAAATGAAGTGAAGTTGGGAGGGACAGCAGCAAACTGAACTGCAGAGTGCAGCCGGTCTG
TAGTGGTAGCCCTCACTGGGTACCACCTGACTGTTGTCCTGGGACCCCAGCATTGTCCTA
TCTAAAGAGTAAGGAGCCCAGAGCTTCCCAGAGAGACTTTACCCCAGGTGGTGGCACCAA
GTTTCAAGAAAACAACAGTGCCCCCTTTAAACAAGTTTGTATTTTAACTTTCCATTGGGC
CTGCAGATGGCTTTTTTTCCTCCATCAGTTTTCTTGCATCTATCTGTTCTTAGGACTGGA
GGAAATGAGGGGAAGGCATGATGTGAGGTAGGACTTTATAAAGGCAGAGAAATTCCCGGA
TCTGTGAGCCCCGTGCCTTGCCTGCGGTAACTGCTCACTCAGCAGCACATTGAGTGATGA
ATCTGGCCAGCAGTGGTGTCTTCTCTGTGAGCAGTTGTGGGCTGGGTTTCTGTTGGACCT
ATTGGATGTCTACCTGCTGCCTCATGCCACCTCCTTACCTTCCCTTCCCTTTTCCAGAAA
GGATTTGGCTACAAAAACAGCAAATTCCATCGTGTAATCAAGGACTTCATGATCCAGGGC
GGAGACTTCACCAGGGGAGATGGCACAGGAGGTAACCTTGGGTCCTCTGGGCAGAGGCGT
ATGTCAGTGTGGCCTCCAAGGTGGGAGAGGGGTGAGGCAGCCTCTGTTGGGTTACCTGTT
ACCTGCTTGCCTTGAAACCAACGACACCCTTTGTAGAGGGAACCCAGTACAAAGGGGAGG
GAGTCATGGGTGGACCTTATGGTAGACCTAGAAGCTCTCTCCCAGGTGGCAAACCTGCGA
TCCAGGCCTACAGCATGGTAATCGGTCTCCCCATACCTATTTGGGGTGAGGGGATGTGTG
GAAGCAAAGTGAAGACACGTAGGTAGGCAATTAGAGCTCAGGCGTGCAAAGCCCATGTGG
ACCATGTTGGAAGCCCCAGTAAGAGTGGGAGAAGTTGCTTGCCTTGGCATTCTCCCCCCA
GAGACCACTCTGCAAGGGCTAACTCTCACCTCTGCACTGACTCGTACACATAGGACNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGTC
ATAGTGAGGGAACTGCTGGAGACTGGAATAGTGCGAGGCCCCAGTCTCAACGGGGTTCAG
GGAAGCGTAATGTGGTGGCAGGGATTCAGGGTGTGGCAGCAAGAGTAAGTGGACTGCTGA
GGGGTTGGCGCAGCCGTCCCCGGGTAGGATGGTTTGGGCCTGAACCCCAGGAGCGTATAG
CCAAGTGGGTGAGAGCAGAGATTCAAGAGCCAGACCACGTTGGTTTGGATTGTAGCTGTG
CCACTTCTTAGTGGGGTGCCTTTAAGTTCTCTGCACCTTAATTTTTTTACCTTTGAAACA
GGGTTATTAGTTATTACCTTGTAGGGTGGGTAGTTTTGAAAAAATGCTTGCAACAGTCTC
TGGCACATACTGTGAACGCTGTAAGCATTAGCATTACTGCAGGGGGATAGCAGGAATGGA
GAGAAAGGAAATTAAGTGGTGGGTGGGAGGGGACAACTGTGAGCAATGTGCAGAGGGACA
GTTGTCAAAAGAATAACTGCTGGCTGGCCAGTGAGCTCATGGGTGTAGTGGTGCACTGTG
CGAGGGGCAGGTCTTTCGCTAGCACACAGGGGTCTCTGGCCCAGTGAGTGGAGTTCGACA
GTCATGCTTGCTACAAGTATAGTAATAGAAAATAAATAACTGAAGTCTGAAGAGAAAGGT
GACCAAGTATGTTGAGTTTAAATTGAACTGTCCATTTGGAACTCCTTGTATCTTGGGAAA
GTGATTGGAGCTAAGGATATAGACTGGGGCGTTTTCTGGAGAGCAGCAATAATTGAAATT
CTGCAGTTGGTTGAGATTTACAAAGAGGATGATGCTCCGGTTGGGGAGGCGTTTAGCCAG
CACCCCAGCCGGGAGTCACTGCACAATGGTGGCAGAGACTAGTCTCCCTGCCCAGGGTAC
ACAGGCTTCAGACACCTCTGTCACCACCAGCCGGTTCTTGGTTTTCAGTCTTCCCACCTG
CTACACAGTCAAAGCCATCTCCCTGGCTAGCATCGGTCTGGGACAGTTTCCCAAGCCACA
GGATGAAGGCAGGTGCATTGAGAAGGAAAAGGGGGTTTTGCATGCAAATAAGTTTGAAAG
GTGTTGGGTAAAACAAAATGAAAATGGCCTCTTTATTGCTGGGTTTCTCTGGGCCTAATG
CACAGCATCAGTCTCTAAGAGGTAACAAGGAAAAAGAAGAGTTTCAGTGTTTCTCCTGGA
GTCAGCTTTGGAACTAGGACCTCTGCAACCACATAGAAATCCGCTTTCAGCTCCCTTTGC
TGTGTCCGCAAGCCCCACGTGGACAGAAACGTTACACGCATTCATGGCTGCCTTTTACTT
TATATTCATTGCTTGGTAAGAGGCTTTGACTCTCCAGAGCCCAGTGGCATCCCCTCCCTG
ACCCTCCCCACCCGGTCTGGCTGGCTGCTTTCTGCTCTGCAGCTGTGACCATGTCTTTTG
TGCTGTTAGGAAGACGAGCTGGGCAGCCACAGCAGTTCTTTTCTGGAAGGTTCCGACCTC
CCTGGTTCTCCTGCATAGCACCTCTCTCTACCACAGTCCCTCTGTGGCAGGCCTCAGGCC
ACAGCCGAGGGTAACTGATAATATGTACTTTAAAGCCATAAAACTGGACTCTCAAAGTGA
GAGCTATTCACTAGCTCATGTCATGTGAGCTATTCACTCAGTCAATCAGGCCTTATGCCC
CATGGTGTCAGTCAGTCTGGCTTGGCTCTAAGGCCAGAGGACACGAAGGAGACAGCTTTT
ATTATGTCCTTGAACGCCACCCAACCCTAGCCTGGCACAGAGCACCGATTGAGCCCCTCA
GTCTGCACCCCAAACATCTGTGTGATTTGGGCCAACCCAGCTCCCCTGACCTACTCTGTC
TTCCCAGGAAAGAGCATCTACGGCGAACGCTTCCCCGACGAGAACTTCAAGCTGAAGCAC
TACGGGCCTGGCTGGGTGAGCATGGCCAACGCAGGCAAAGACACCAACGGCTCCCAGTTC
TTCATCACCACGGTCAAGACGGCCTGGCTAGACGGCAAGCATGTGGTGTTTGGCAAAGTT
CTAGAGGGCATGGTGAGTTCTGGAGGTGGGGGCGAACCTGGGCAGTCCTCACCGGGATCT
AACACAGACCTTGTGGGGCTGGGGCTCCATGTAGTTTGTCCCTTTCCCAAAAGAACCCAA
CCCACAGATTTAGACCAGTGCTCATGTCTCCTAACCTGGGGGAATTCTAGAATAAATGGC
CTGCATCCCTGTGCCCACAAGCTTCTAAATCCTTCCATGCCCTGGCAAGTGCAGCCAGGA
GGCCTTGAGGCTGCACGAGGGCAGGAATCTCCGTTCCATCATTCCCTCCGTTATGTGCTG
GCTTCCCCTCCCTGAGTTGTACAACTGACACGATGTCCCTAAGCAGCCACTTGGTACCAC
ACTCCCCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1024, 1777..1890, 2457..2550, 6127..6311
1001..1024, 1777..1890, 2457..2550, 6127..6311
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved