Microcebus_murinus Locus RPS8
snOPY snoRNA Orthological Gene Database
Microcebus_murinus RPS8
Microcebus_murinus
RPS8
GeneScaffold_1367
SNORD55, SNORD46, SNORD38, SNORD38
1265..1344, 1844..1948, 2756..2828, 3275..3343
4574
AGAAGAGTTGAGTAGTTGTGACAAAGACCCCATAGGCCACAAAACCTAAAGCATTTACC
TACTTTTAACTCTGTAAGAAAAGTTTGTAGGCTGGGCACAGTGGCTCACGGTTGTAATCA
ATCCTAGCTAGCACTCTACAAGGCCAAGGCAGGAGTATTGCTTGAGGTCAGGAGTTAAGA
CCAGCCTGAGCAAGAGCCAGACCCGCTCTCTAGAAAGAAAAAAATATTATTCATTAAAAA
AAAAAGTTTGTAGACCTCCCCTTTATGCTCTCTCTCTAGGTTCCAGCCATTCTGGTGCTT
TTTATTACGATTTAAATACTAACGATCCCCAGAGTAACATCTGTCCAGATCCCTTCCCCA
AGGATGATCAGACATGAATATCCAGCTGCCTACCTCTCATTCCCATTTATATGATTCACC
AGATCTCAAAATAAACATGTCCATAACAACTCCTGTCTTAGACCACTCTATCTCAGTAAA
TGGCCCCAATACTCATCTACGTGATCAAGTGAGAAACTTAGGAATCCCTGACACCTCTCT
CTCCCTCAACCTCTATGTCCAACTTATCACCAACCCTTCAAAACAAAACCCAAGTCCACC
ACTCATTTCCACCTCTACTACCTTCCACCTTTTCCAACGCACCGGCACGCACGTCCCTCA
TCTGGACTACTGCAGTAGCCTCTGAAACGAGTCTCACAACGTAATTAAAACTATTCTGCT
CCCTTCGGCTGTGCCCTAAATCTCTTCCGATTCTGCCAAAAGCGCTCACACCTAACCACG
CCGCGGACCCACCTACCCCTCCCAAGGTCGGCAGCGCCGGGCGGGAGTCCGCAGCCAGCA
GGACTCTCCCAAGCCCCGAGGGCCTCAGCGCGACAGCAGAAACGTAAGTCATTTCGCCCT
CCGTGGTTACGGCCCTCTGAAACAACGTCAAGGGGCGGGACTGCGTTTTACAAACCGGAC
CGTGAACCTTTGCGTTTTCTCTTTCCAGCCAGCGCCGAGCGATGGGTGAGTGTCGCTCAG
CATTGGGGCTATGGGAGTGGGGTAGGGGTGAGCTCAATCCAGCTCCATCCTGCCTGGCAG
CCAAGTTAGGAATACAGGAACCCCGACTCCCGGCCGGGAACAACCACAGGGAGGGCTGGC
CCTCAGGTTTGGGCCGCCGAGGCCCTTCCCCGGGGGCTGCAAAGGCGTCGGGGTCCGAGC
CGCGGGCTGTAGGCTGCGAGCAGCACCAACATGGCTGCCGCGGGCCAGAGGCCGGCTGGG
TCGCGCGCGCATGATGACACCTGGGAAATGCTGCAGACTGCCGAGTGCGCAGTGGGGAAG
CCAACCTTGGAGAGCTGAGCGTGCGGCCCGCCCGGAGCGGGGGTCTGGAGCTGGCGAGTC
GCCAGCACCGAGTTCCCGCGGCTCAGGCTTTCCTCCCCGCTCCCACATACAGGCATCTCT
CGGGACAACTGGCACAAGCGCCGCAAGACCGGGGGCAAGAGAAAGCCCTACCACAAGAAG
CGGAAGTATGAGCTTGGGCGCCCCGCTGCCAACACAAAGGTGTGTGCGCCTGACCGGCCC
GAAGGTCTTCCTTTGCCCTCCAGCGTGGTCGGGTCTCCGTGTGGCTTCCCCCTGGGGCTC
TGATTTTTTCATAGTAGGAGCTGAGCAGCTGCCTACCTGGAGAGAGTATGCTCTCAGTCC
CCTGCCCCCAGCTTAGGGGCTGATGGAGACAGATAACAGAGTGGTGGGACTTGGAGAGCA
CCTGGAGAGGTGAGCTCCTCTCGTGACAGTCAGAAACCTGGGAATTCTGTTGCACAGAGA
CTTAATTTTCAGTGTTTTGGGGTCAACGCTTTCCTCATTGAGGTAACTGGAGTGATGAAA
AAATTATCCTTAGGCATGGTTGTGGCCGTCTTGGTCACGTGTGTGCCATTTGCCAATGCA
AGGACATGTCATAGTTACACTGACTATGTTGCCTCCATCCAGCCCAGGTTCCACTCCCTC
TCTTACCTTGCTCTCCTTGGTAACCTGGTTCCTGTCTCCCTGTGTTTTCCAGATTGGCCC
CCGCCGCATACACACAGTCCGTGTGCGGGGAGGTAACAAGAAGTACCGTGCCCTGAGGCT
GGACGTGGGGAACTTCTCCTGGGGCTCAGAGTGTGAGTGAGCCCCTTGAGGAGTGGGTGG
GAAGGCACCTAAACCTTCCTAAGCTTCAGTAAGTGCTTTTAGCAGGAAGTCTATGGCCTT
CACCAAGGTACTTGAAATAATTTCTCCTTGCTGAAAAACCTTGAGGTACCTGGAGTTCTC
TCTACCCAGACTTTCCTACCTTGTTCTCTTAGCTCTGCAGCCTGAGGGGTTGGGGCTATT
TCTAGTGACTCGTGGTAGCCAAACACTTCTAAAAAGATGAGTGTGGAACACCAGCCGATG
TTCCATGGCTGAGTGAAAGCTCATAGTGCTTCTCCTTAAAGGCCCTGCTAAGGGAGAATT
GCCTGGGGAGGTGCAGCAAGATAGGTTGGCCTCTGGTTTACCTGATTTGATTCTGAATTT
CCCGTGAGCAGGTTGTACTCGGAAAACGAGGATCATTGATGTTGTCTACAATGCGTCCAA
TAACGAGCTGGTCCGCACCAAAACCTTGGTGAAGAACTGCATCGTGCTTATTGACAGCAC
ACCGTACCGACAGTGGTACGAGTCCCACTATGCACTGCCCCTGGGCCGCAAGAAGGGGGC
CAAGCTGGTGTGTATTACTTTCCTGTGGGGGGTGGATTGGGCAGCCTGAGTCCAGCCTTC
TTATGATGAAAGCTTAGTCCAGTTCTGCTACTGAAGGGAGAGAGATGAAAGCTTTTAATG
CTGAAGAAGGCCATTGTTGGGCTGTGGGGTTCAAGAATGACCTTCCCTGCGCTAATCCAA
CTATGTTCCCTTTATTCAGACTCCTGAGGAAGAAGAAATTTTAAACAAAAAACGATCCAA
AAAAATTCAGAAGAAATATGATGAAAGGAAAAAGAATGCCAAAATCAGCAGTCTTTTGGA
GGAGCAGTTTCAGCAGGGCAAGCTTCTCGGTGAGATGCCTGTTGTGTTGGGGGGCGGTGG
GGGTCAAAGATCGTGTGCTGCCTGTGTTTGTGCCTTGCCTCAGTTAATTGGACTGCCCAC
CATGAGGTCTAGAGGGTTCACCCAGAGAGTTTAATGACAACAAACTATAAGCACAAATGG
GAACATTTGGTTACCCTATTAGTGTGAAACTGAAATGGGAAGGAAACATTGGGTAGAAAG
GGCCATACATGGAGCTTGGAGTTTTAAAGGGGCTGTCTCAGTGATGAAAACATTGTCCAG
TTCTGCTACTGACTTTAAGTGACGATAAAGTATGTCTGAGGAGACAGCAGTGGGCTTTGT
GCCTGCCCCCCCGGTACCTGAGGCAACATAGACTCATAAGGGGATAGATAGGTTTGGATG
GGGTCACTTTGTCATTTTGCTAAGGGCTATGTATTCTCTTGGCAGCATGCATTGCCTCCA
GACCGGGCCAGTGTGGCCGAGCAGATGGCTATGTGCTAGAGGGCAAGGAGCTGGAGTTCT
ACCTGAGGAAAATCAAGGCCCGGAAAGGCAAATAACTCCTCCTCTCTCCTGTCTTAGTTC
ATGTAATAAAGGTGTTTATTGTTCTATCTGCTGTGCTAGTTTGTCTGAGTATTTGTTGCT
CTGTCCTCTGGTTCCCTGTCCTGAGCAAAATTGGTGGCTACAATTACTTCCCTGCCTCTA
CCTCCTGCTGTCCACATAGGGTGTCCATGCCACACTGAGAGTCCCCATTGGTCACAACTC
TACCTCCCTGAAGGCCTGGGCTATGCTGTTTTTTCCTGTATTGCTAGGAAAATCAGTTAA
GTTTTTAACCTGAATTCATGGACGGTCTGGAAACTTGAAATTGTGTTCAGAGTTCATTAC
TGTGTTGCTGAGAGCATGTCATTCACATATTTGCATGTTAGTATCTTGTCTGCTTTAGAG
GGCTTTCTATATCTTTGTTTTCTCTTGAGCTCTATAATCTCTCACCATCTGGAAATTTAA
AATATTTAGGGTTACCATTGACTTAATGCATTGCTAAATCTAAGGATCACTTTTGTCCTC
AACTCGCCCTATCAAACACTTTTTTGAGATAGTTTCACTGTTTCCAAAGAGTGCCATGGC
ATCAACCTAGCTCACAGCAACCTCAAACTACTGGGCTCAAGGCGATCCTCCTGCCTTAGT
CTCCTGAGTAGCTGGGACTACAGGCATGTACCACCATACCCAGCTAATTTTTTCTATATG
TATTTTTAGTTGTCCAATTTCTATTTTTAGTAGAGATGGGGTCTCTTGCTCAGGCTAGTT
TAAAACTTCTGACCTTGAGTGATCCTCCCAACTCAGCCTCCCAGAGTACTAGGATTACAG
GCATGAGCCACCATGCTCGGCCAAGGATCAGATTTTTGATGCAGCAATTTCCCATCTCAA
ATAAAAATCCTTACCAAGTACTATGGCAACTCTAGTTGACTACACAACCATCCTGACCCT
ACTGAACATACACGTTCAGTTCATGTACTATTATTACCCCTTGTGGGATATGCTCCCCAA
ATATCCACGTGGCTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1004, 1432..1538, 2032..2131, 2531..2706, 2899..3028, 3465..3574
1001..1004, 1432..1538, 2032..2131, 2531..2706, 2899..3028, 3465..3571
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved