Microcebus_murinus Locus GNB2L1
snOPY snoRNA Orthological Gene Database
Microcebus_murinus GNB2L1
Microcebus_murinus
GNB2L1
GeneScaffold_4653
SNORD96
1478..1553
6544
GAAAGTGGCTTCTGCAGCACTGACTGCCACGTTGCAAAAAATAAAAACAAAAAAATTTG
TTCACCCTGAGGCCATGGGGTTTTATTATAAAAACTTTGAAAACGAGACAGTAGATTCTA
ACGTGTCGGAAAATCGGTTGCTTTTTTTTATCTATTATTATTTTCTATGAAACTTGGGAA
ATATAGTTCACAGGAGTAAAGTTAAGAGATGTGTGTGTCGCCTATGCTTCTCACGAGGCC
CTGGGCTTAAAACTAGCCCCGAGTTAAATACAGCCTCACATGGCAGCTGTGTTAATTGTC
GATTTTCTGTCGTCACAGGAGGCCCGTAGGTAATCAACAGCAAAACAGCTGTGTTTCTGA
ATTCTGAGAAAAAGATGGTTCAGTTCCTCTGAATCTCAGGAAAAGGTTGTCCATGATCTG
GGGCGCCTGCGTTAAATTATCAGGGTGTGGCTTAGCTGTACCTGTGATTTTATTCCGGGT
AGGGGGTCACTCAGCCCTGGCCTAATAAATGCTATTGTAGCCTCCTTTTCTTTTTTATGT
ATCTTTTTTTTTTTTTTGGAGACAGAGTCTCACTTTGTTGCCCAGGCTAGAGTGAGTTGC
TGTGAGCTCACAGCAACCTCAGACTCCTGGGCTCAAGCCATCCTCCTTCCTCAGCCTCCC
GAGTAGCTGGGACGACAGGCATGCGCCACCATGCCCGGCTGATTTTTTTATATATATATT
GGCCAATTAATTTATTTCTGTTTTATAGTAGAGACAGAGTCTTGCTCTTGATCAGGCTGG
TTTCGAACTCCTGACCTCGAGCAATCCGCCCGCCTCGGCCTCCCAGAGTGCTAGGATTAC
AGGTGTGAGCCACCGTGCCTGGCCTTTTATGTGTCTTTAATTTGTCATCCTGTTACCCCA
ACCACTGCAACCTTGAGACATCCTGAATTACCCAGTAGGTTAGCGCATTGGCTGCAGAGT
TCCTCACTCGTTTTCCTTCTCTGTTTCACCTCTCCTTAGATAAGACCATCATCATGTGGA
AGCTGACCAGAGACGAGACCAACTACGGCATCCCGCAGCGTGCTCTGCGGGGTCACTCCC
ATTTCGTCAGTGACGTGGTCATCTCCTCGGATGGCCAGTTCGCGCTTTCAGGCTCCTGGG
ACGGGACCCTGCGCCTCTGGGATCTCACAACGCAAGTAGCTGCTCGCCTAGCTGGGGGGG
GGGGAGGCTTGGGAGAAAGCTGGGCGGAGATGAGGGGGGGGGCAGTTTCCCAGGGGACGT
CAGGCCCCTCTGGAGCTGTAAGCAGAGTACGCGGAGAAGACGGCTGTGCTGGTCTGGCCT
CACCTCCTGTGCTTTGAGTTGAGTTAGCTCAGTTGCCGGGCAGTGGTCTGGCTGGGAATT
TTGGCCAGGTGCAGCAGTTTGGAGTTGGCAGCACTTGCTCTCGAGTGTTTTATCTGGAAA
GCCCTGTCCTGGATAGTAGTTGGCAGGCGGAATAGAGGGTCCTGGTGATGATGGACGACA
TTGTCAGCCAACCCCCACGTGGGAGTGAGGACATGTCCTGCAATTCTGAAGGGATTCTCT
GGCATGTGTGCACTTAGCCGAGGGCTTGCTGTGATCAGAGCCGCTCCCCGGGGTTTGGTG
GGAGGTGCAGCGGCCGGGGACTGGGCCGGGAAGCAGTGTGGCTGGGCGAGCATTTGCAGA
GTCTGTCTGGAGAGTGATCGCCCCCTCCCTCGCAGGGGCACCACCACGAGGCGGTTCGTG
GGGCACACCAAGGACGTGCTGAGCGTGGCCTTCTCCTCTGACAACCGGCAGATTGTCTCT
GGGTCCCGAGACAAAACCATCAAGCTGTGGAACACTCTGGGCGTGTGCAAGTACACTGTC
CAGGTAAAGTGAGGGCGTGGCAGACAGTGCGCACCCAGGGTTTCTCCCGCCTGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGGC
AGCACCTGTACACACTGGACGGTGGGGACATCATCAACGCCCTGTGCTTCAGCCCCAACC
GCTACTGGCTCTGTGCCGCCACAGGCCCCAGCATCAAAATCTGGGTGAGTGTGGGCTGTG
GCTCCGGCTGGGTGCCCAGTGCACACGGTGAGCCTGGCAGTGTGGCGATGGCTGCGGGTG
CCCCTGGCCCCCAGCCGGGAGCCGAGCTCCTGAACAAGTGGCTAACCGTCTCACTGTCAG
CAGAGACCCAGCAAGGCTCAGATTTCCCAGGATTGGGATTTGCGGTGGTGGGATGGCTTG
TATAGCAGCTTACTCGCCCTCAGCATAAACTGACATTCGGTCTGGGTGATGCTTTGCAGT
GGGGTGCTGCCTTGTGCATTTCAGGGTGTCTGGCAGCGTCTCCAGCATTTGCCCACTAGA
AGCCATCCTTCCCTCCCCGGCAGGAGCAACTAAAAATGCACGTGTGCCGGCACGGCCACA
CGTCCCCTGGGGGAAAATCGTCCCACTGAGAAACTGAGTTATGACGGGGCTTTGAGGGAG
AACCTCTGGTGGATGGAAGCGTGAAGGGTGCTTTTGTTGGTGTCGCCCCGTCCCCAGGAC
TTGGAGGGCAAGATAATCGTGGACGAGCTGAAGCAGGAGGTCATCAGCACCAGCAGCAAG
GCAGAGCCCCCCCAGTGCACCTCTCTGGCCTGGTCTGCTGATGGCCAGGTAAGTCGCTGC
TTCCTTTTTATTTTTTGCTTCTGTTTTGAGATGGGGGGCTTTCTGTTGCCAAGTCTGGAG
TATAGTGGGGTGGCTTGATCGTAAGTCACCCTAACCTCCAACTCCTGGGCTCCAGTGATC
CTCCCGCCTCAGCCTCGAGAGTAGCTGGGACGACAGGCGTGCGCCACCACGCCCGGCTAG
CCTTTCCTCTCAGCTGTTAGTGTGTCTGGTTTGTCAGGCACAAGATCAGTGTGTTTGGCA
TAAAGTGAAATGGCAAAAAGGATTAGCTGGGTTGATTAGCATGGTCTGGGCAGCTGCGCA
CCAGGACGACGGCTGTGATTTGGAGGGCAGTGGTCGCCGCCCTTCAGTTTGTACCTTGCT
TATTTTGACCAGAGCTGAAATGTCTGGATCCTATCACTCACTGGCTGCTGCTTCCTCTAG
GGGTACATAGTCACCGCCTACAATCTGGTAGTTAGAAGTGGGGCTGGTTGTGTTTTTTTT
AATGATCCTGGAACTTTAGAAGGAATTGCTTTTATCTTTTAGCAAGCAGAGTGGAGTTCT
TAGAAATGAGGCCTTCACTGGCACTAGTGGAGCTGCAGAGTTCATGGCTGGGCCTATCAC
TGTTTTTTCTCTCCTGCAGACTCTGTTTGCTGGCTACACAGACAACCTGGTACGCGTGTG
GCAGGTGACCATCGGCACCCGCTAGAAATTTTACGGCAGAGTTTCTAGAAATAAACTTTT
TCTGACTTAAGGCTCCATACGTATCTATGTTGCTTACAGGTCAAGAAGCCATTAGTTGAG
GTATTGGCAACCTGGAGGCTGGGGGCGAAACCTGGGGACCAAGTAAAGAAGGCCTAGAGG
GGAAAGGGAAATGTCAGTCTGTGTCCACTTTCTGTAGGGTTGCGGTGGCATCAGATGTCA
CATTTATGGGAGGGAGTTTTCCCAAACTTGCCCCATCCCTGTGTCCTACATTCCGGTACA
GTCAGCCTACCTTAAGCCTAGGGAAACTTGCTGAGTGAAAAAGACTGGTTGTTTCAAGGT
GATTGCCATCGAGTTGGAAATAGCAGGCTCCTCGAAACCTCTTTGATAGAGACCAGTCTC
CATCAACTTGGATCTTTGATCAAAATGGAGTGGGTTCTTTTTTTAAAAAAAAAAATCTTG
AAGGCAAGCCAACTCTCACCAGAAGAATTGGTGCTTAACCACAACTTGTTTAAAGTTCTG
AGTGGCCTGGGGAGTATTCATAAATTAAAATAGGCCCTTCCGTACAGTTCTCAACCTACA
CCTGTTAGTCACAGCATGGCTGCCTTGTGGAAGGTCAGAAGTGGGCTGTAAAACTAGCCC
TGTAATTTCCAATCTCAGTACAGGTGTGCTGTAATAGCCTTATGAGACCTCAAAACTGCA
GTTTTCCCAGCACAGTACTCTGACAGCTGAACAGCTGCAGCATGTTGCAGGTGTGTATGT
GCCGCTTTGCCCTGGTTCCTACTCCCTTGACTGGAGTTTCAGCTAGGTGTTGGTCACACA
TATCCTTGGAGGTATGTTCCAGAGACCTGGGCTTGTGAGCTATGGGTATGAGATTCCTGG
GGGAACCTCATTCCTAGAGCCTCAGAGCAGTGGTAGAAAAGAAATGGCAAATTATCTTCA
AGTAAATTCTGAACATTGCCAGTAAAGAAACTAGGTAAAGTGTTGGGGGGGAGATCAGCA
TCCAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1170, 1715..1862, 2855..2950, 3051..3161, 4104..4139, 4142..4243, 4737..4847, 5479..5544
1001..1170, 1715..1862, 2855..2950, 3051..3161, 4104..4139, 4142..4243, 4737..4847, 5479..5541
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved