Microcebus_murinus Locus C1orf77
snOPY snoRNA Orthological Gene Database
Microcebus_murinus C1orf77
Microcebus_murinus
C1orf77
GeneScaffold_4476
SNORA66
6644..6745
9322
CGGTCCCCGGCCCGCCTGCCGCAGCCGTGGTGGCAGCCCCGGGCGGAGCACTGGCGTCC
GTTTCCTTCGGTGCGTTTCTGTGCTAAGGAGGAGGGGGAAAGTCTTGGGAAGCGGAAGGG
GCCGGCGGAGGAGTAATAGGGGTGGTGGGATGTGGACGCAGGTAGGGTGTCGGAGTGTGG
AGGCCCCGGGGAGGGGGCGGAGCCGATGAGAGGAGGCAGGGGAGGACCTGAACTGGAACC
TGGTGGCGGGATGGAGAAGGTTGGGGATAGGGATAAAAAGGGAAATGGTTCGGCGGGTTG
AGCAAAGTTGGAGTTCTGGACAGGACTTTGAGGATGTTAAGGAGATTAAATGAGCACTAC
ACGACTTTAAGGAACGTTGGAAGTTAATGGCTGCTTTAGAGTTACGTGGAGGGCTCTGTG
AGAGCTAACTCCCAGGTGAATGTCCATTTAAGAAACCTTTTGTGCTCCCTCCCCCAGATC
CCCAGTTCCTTACTAAAGCCCCTATTTGATTTTTTTATTTGAAAGGCAATTTTGAAACTG
CATACCTGTATTTTCACTGTAGATAAATGGTTCTCAACATTTTAGCTGCACATTAGAAGC
ACCTAGGTAGCTTTTCTCCCCTCACAATTACTAATCTCCAGACCTCACTACCAGAGATTG
GTTTAATTAGTCAGGACCCATACATCTGTATTTTTTAAAAACTCCCTGGGTAAGTCATGC
AGTCAAGATTGAGAGAGACTGCTATATGTTAAAAGCCAAACTCTTATACTTCCTTTAGCT
AGATTTTGTTCTGCCATTTTTAAGACTTCAAATATTTTCTTTCTTGTGGCCTTGAGTGTT
AATTTGAGGTAACTGCTATATATACCTAAGCACTTGAAATAAGTTTTGATATGATCTTCA
GCTGTCAGTGATAAGGCCTTTACGCCTTGTAGAAATGAGTGGCCATAATTCTGATTTGCT
CATTTTGCCTATTGTACTTTGTAGATTCTCGGGATTTGAAGATGGCTGCACAGTCAGCGC
CGAAAGTTGTGCTAAAAAGCACCACCAAGATGTCTCTAAATGAGCGGTGAGGCAGCCAAC
AGCAACTTCAGCTCCTTCCTAAGAAAACATTACTTAAGTTGGCCCTGGGGTCCAATGCAC
AAAACCGGTTTTAAACTAAATACCAACAGAAGGCTACAGACCTCTGTTCTTAGTTGCATC
TTAATGTGGTACACAAAACAAATTGGGCTGTTGTTTCAAAACCCCTTGTCAGTAGACTTT
TATGTTAAACTATCTGAAATATTTATCTGGTGGGATATATTTTAAAAAGACTCCTAACAC
CCTCCCTTTCTTCACATTTTTTTACATTGATACAGGGGTGGTGCAGCACGGTAGCATGGT
ACCCTGGCTGCAGTAGGCTTGCTGCCCAGTCCAAGGCCAGCAGTGTTGTGTTTGGCCTGT
AAGAGGCAGGTAGCAAGCCATGAATATGTCCAAAGGCCCTTGAATGTCATTCTTGGGCCT
TGTAAGAGGCACTTGCTTTGCTCCATTTCACTTTCTTTCCATTCTGCTTCTAGTTTGTTT
TTGTTTTGGATTCTTTCACAGTTAAGTGTTCTTCCCTTCCATTCCATTAAATTACCTTGA
CAGGAATAATACAGGGGTGTCTTCACAGGCTCTAAAATGATTGGACTTACCTAACTTTCA
TAAGTAACCACTTGGAGTCAGAAAAAGTGATCATTTGAGACTAAGAAAAGTAAAAGTATT
TAAAGGCAGTTTCTACCTCTGAGAGCTTTATTCATTGGGTGCCTTTGGCCAATAATTTGT
TAAATTGATGTTAGACCACTAAGGTTTATTGAATGTCTATTTTTGCCTCTTTTGAAGTAT
ACGTGCTTCTCTCCTTATCTCTTAAGATATGTTACACTAATATCTATATTCATATGTTAC
TAAGTGACAAATATGTTTTTAAATTTGTTACACTCCTATAATTTATATGAGTGCATTATT
TCCATGAGCTCTGAAGGTACTCTAGCCCTTTCTCATATTTCCCTTAGAATGCTCCCTCAG
GTCTCCCAAGGTTTAGGCTTTCTTTGTTTGTCTTTGAAACTGCATCTTCTGTCTCTTGTC
ATCATATCTGCTTATTGCGTGTTTTTCATACTTTCCACCTTTCTAAAAACTGTTACCTGA
GCCCTTGTTATCACTTTTGATTGAATGTGCTGCACTTAGCTGCATTTCTAAGTTTCTGAT
TCTTGCAAGTTTGTGGAAACTATGGAGTCTTTAACCCACATCAGCCTTGATCTAAGTGTA
CCACTTTACTTAAAAGTTCGTGGGATCTGGAGCTCCTGGTCTAGCAAGCCATGAAAATGC
CAATAAATGTTTTGTAATAAAGCTTTTATTTAAACATCCATTTTGTTCGACCTTGAAGCT
TTACTAATATGCTGAAGAACAAACAACCGATGCCAGTGAATATTCGGGCTTCGATGCAGC
AACAACAGCAGCTAGCCAGTGCCAGAAACAGAAGACTGGCCCAGCAGATGGAGAATAGAC
CCTCTGTCCAGGCAGCATTAAAACTTAAGCAGGTGAGAGAATGGGTCTTAATGTTCCAGA
AGCAGCTGGTGATCTCTGTCAGGCAGTCTGCTGAGGCTATCAGGACGTGATGGATGATTA
CAAGGTGGCTCAGGGCAAAAGCTGAAACTTCTCTGGAAGAGAGGTTCAGAGAATTCCAAT
TTTGGCAGGTACTGATAAGTAACTGTTTATTATTGTCTTTTTCTCTTTGGGAGTCCGCCA
TCTGTGTGGCCTGTTTCTGTTATCAATGAGTATTGATCTTTTGTTTTCTGATCCTTTACC
TTTAATGTAGATTATTGGCTTTTTCCACAAAGAAACTTTGTTTCAGCTTTAGATAATCTT
TAAAACATCCTTTACCCCCTGTTAAATGATTTACAAACTAGGGAAATAATTTTATTCTTT
CTTCCCTGGTGCAGGGAGTCTTGAATGGGTTTACTCAAAGGTTTTCAGTGCTAAAATGTA
GAAGGAATAGAACGACCCTCATTTCCACAACACCTGAAGTTTTATCAGTAAAGTGGAGCA
AGAGTACTGAGTAATTAACTTGAGTTAGTGGGTTCTCTTTCAAATTTCCAGTGAGAGATA
ATCCTATTCAGACCTGAAATAAAACCTGCTCTTTATTATTCATAGACTTTATATGCAAGT
CCGGACAGTGGCTGTGGAAGGATATGCCCAAGCTGTGGCTGGCTGTCTGGAGGGCGGTGC
CATGCAACTGTAAGGACTCTAACTGGTAGCACTGCATGGCTGTGCACAAATTCAGCAGTT
AAATATAACACCCTTCCACCCCCACCCTGAGCCATTGGGCTCACTGACCAAAAATAAACG
AGGCTTTCTGCTTCAGCTACCTTAAGCCTTGGAGTGACTGGATTCCTCCCTGACTCAGGA
AAGCAGCAAAAGGCACCATCATTTTTCAAGACTAAATAAAAATTCCTGAAGATAAATCTG
TGACAGATCATTTCAGAGGAATTTTCAACAAGAAGCTTTAAATATATAAGTATAGACTCT
GCAGAAAGTAGCCACGGTCTAGAGTAGCGCTGTCCAATAGAACTTTATACAGTGATAGAA
ATGTTCTATGTCTGCTATCCAGTACAGTAGCCACTAGCCACATGTGGCTATTTGAAACTT
TGTGGCAAGTGGCTACCTTATATGGGCACAGCTCTAAAGAAGAAACTGGGTGGCATAGTT
GAAGTATTTACAATGTTAGAGACCAGTATTGGTGACAACTAAGGATTGGGAAGGGAGAAG
AATTTTTTAGCACTATACAGTTCCCCACTTAAAGTACACAGGAGAATGAATATACTCAGA
ATCAGTGAACACAAGGGAACTTGAGGAATGTGGTCCTGGCCTCATTATTGTGTGTTAATC
GGGAGTGAAAGAACAGGCCACTCGCCCATGCTAGGTGCATAATGTTCAGAGCCTTCTCTG
ACAAACAGTTTATGATCTTGTGATAGAAAGCTAGTAATAATGCCTCACAGCATCTTTTGA
GGGGTATGATTGCAAAAAAAAGAGAGACATTGGTAATCCCTTATGCGTGACACATAGAAT
TTATTTTCATTCATATTAACTGATGGCATTACAGAAAATCAGGCTTGCTAGGGCCTTGGT
ATTATGTTTAAGGCTATACTATTTGTTTTTCCTTTGAAGGAATTTAATTCTCTAGGATGT
GGTTTCCCTTTGATAATAGATACTGAAAATCTCTCTGTAGTACATCCATGTCCTTTTATA
TGGCCCTGGGTTTTGTGATGCTAGCTCACCTGTCTTAATTTTAATATAAGTTTGGCTGGC
TCTCTGTGGAGATACATTTGAGTTACATGTTTACTTTAAATTAAAGGTCGTTATACTGGC
TTAAAAGAGCAGTTTGCGAGGGTAGACATGGAATTACAAATTTTTAAGAAATGTAAGGAA
AGGAGATTTGACTTTTTGTGTTTATTTACATCTTAAGGTAAAAAGTGGACCGTCTGGAGA
TAGATACTCAGAGGAAAAATGGAGCACACGGGCCTCTTTGAGAAATCAGTCTTGTTCTTA
AATCACAAGAATTCAAATGAACTTATAATTTAAATTTTGCCCAGAGTATGATGAACTTCC
TATGGAGTTTGAGTAAGCCTTGAAGACAGTGATAGTCCTTGGGCAGGTATGAATCAAGTC
ATGTCATTGACAACCTGTAGATCAAAAACAGCACAAGGCATAAACCAGGATTAAACTATA
GAATGTTCTTACTGAAACTTAAGTTCCAACTGACAGACAGTGTGTGACTTCTGTAGCCAA
ACTAGTGAGGTAGTTTGTGGTGATGCCAATTTCATGGGACCATACTCAAGCTTCTTAGAG
TTTCTGCTCTGGATCAAAATTCTGCTTGTTTTATATCATGTTCTGAGGCAAAGGCTTGTT
TCTGATTTGGGATCCTTATGACACCCACAACAGGTTTATCTCCCTTCACACCAGACATCT
CACTTGCTTCTTATTCTCTGCACTTTGAATTGCCAAATCCTGCTGGATTGCCTTTTTGAT
CTCAATCCCCCAACACCTTTTCTTCCAGAAGAGCTTAAAGCAGCGCCTGGGTAAAAGTAA
CATCCAGGCACGGTTAGGCCGACCCATAGGGGCCCTGGCCAGGGGAGCAATCGGAGGACG
AGGCCTACCCATAATCCAGAGAGGCTTGCCCAGAGGAGGACTGCGTGGGGGACGTGCCAC
CAGAACCCTACTTAGGGGCGGGATGTCGCTCCGAGGTCAGTGCTGTGTACCTGATAATTG
TCCGGCCCCATCCCCCTTCCCTTTTCTCTTGGGCTGCTTATGGACACATTTGTTTAACAT
CTTTAAGCCTGAATTTGTATTAATGTAATTAATAACTTTTGAAATCACATATTTTTAATA
GTGCTGCATGTCTTTTATCGATACCATTCCTTTTCTGATAATGTGCAATGGTGAGAGGCT
ATGACCTGCATAACAACAGGTAATTCATGTCATCTCCATTCCATTTTAAAACACCCTGCT
GCTGCTTGAATCAAAGCACATTCAAGTTCTAGAAATAAGTAAAATCTAAGAAATTTATGG
GTCTTTTGGCCTGTATCTTAACTGTTTGTGTTCCTGGTGCTAGTAAAATGCTGTTACATC
TGCAAAAAAGAGAGGACAAGTAGACCCGTAGCTTTCCTATATGTTACATTTGGGGCACTG
TTTCTCCGTTCCCTGTATAGTTCTTGTCCGCTACAGAACATATTGAGATCAGGAACCATA
GCATTTATTTTTAAATCTACTGCAATGCTAGGTATCTATCTGATTATTCAGTATATATTT
ATTAAATGTATTGTACTTACTAATTAACTCCCAGCTTCTTCCAAAAATGCATTTGTGGTC
AGGCTTATTGAATTGATTGAATAAAGAGCAGCTTTAATCTGTTCACACTCAGTGTGCAGC
TTGCCCCAACCAACCTAAAAATTAACTGAATTACTCTCATTTAACCCTCACCGCCTTCCT
TTGGTTAGAATCTACTTTGTCTCTCTTGGATTTACCTGCATATACATTGTATGCCTCCTC
TCCAAGGTCAAAACCTGCTCCGAGGTGGACGAGCCGTAGCTCCCCGAATGGGCTTAAGAA
GAGGTGGTGTTCGAGGTCGTGGAGGTCCTGGGAGAGGGGGCCTAGGGCGTGGAGCTATGG
GTCGTGGCGGAATCGGTGGTAGAGGTTAGTCAGCTACCAACTTCAGAGAGTAGCTCCCCC
TTATTTTCCTCCCTTAAAAACTCAGAGCCACCTTTCTGCACAGCTTCAAGTCATAGGCAG
GCTTCTTTGTTTGTCTTGTTTGTTATTTGAAACTGGCTTATCTTCTAAACTTACATGCTA
GTAGTGCAAAAGTCTGTCATGATTTCCCAAGAACTAGTCAAGTGCATATTACAGAGCCAG
ATTATATGCAGTCTTCCAGGCTCTTGGAAATTTAAATTGTATTGTTAAAATAAAAAAAGT
TTAAAACCACAAAAATGGTCAGCTTAGGGTTTACCTTTCTCCATCTCTGTCCCACCACCA
CCACCACACATCCCACCGCATAGTTCAGAACCCCAGTTTGAGTCACATGAGGATAGAAAA
GAGGGAGATGTACAAAGATGAAGGAGAGTTAAAGAGAGTAATGTGTGCAAACTCGATCAC
TAGCTCTGCCTGATGTGGCAGAAGCTAAGGGAACCAGATTTGCTAAAGTAATTATGGTGA
TAGAAATGTACTAGCCTCAGATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTTACACCACTGATTATCTGTGCC
CTTGTTACTGCCTCCCTAGCTTACTAAATGGGGTTATCTATCATGTATTTTAGTTATGAA
CTTACAGTGGGTCTCAAATGTTAGGTAATTTATCTTAGGAGAGATTAAGGTTTTTTAAAA
TTATAATTGTCAGTTAATTATTATCTTGATAGAAGAAAAAATTTTAAATAGCATTTAGAG
ATAAGCATGTAATAAGGGATTCATTATGTGTGCTTTCCATGTGTTGCTTTCTACCCAGTG
TGTTTCCTGTTTTTCCAGATTTCTCCTCTTTGCCCTGCCCTTCAGCTTTCCTCAGCTAGG
CCCCACTGCTCTGAGGGGCATTTACTGTAGCACCCATTAAACCTACTTGTAACTGTCTTT
TTTTTTCTTTGGGCCAGGTCGGGGTATGATAGGTCGGGGAAGAGGGGGCTTTGGAGGCCG
AGGCCGAGGCCGTGGACGAGGGAGAGGTGCCCTTGCTCGCCCTGTGTTGACCAAGGAGCA
GCTGGACAACCAATTGGATGCATACATGTCGAAAACGAAAGGACACCTGGATGCCGAGTT
GGATGCCTACATGGCACAGACAGATCCTGAAACCACTGATTGAAGCCTGCCCACCCTCCT
GTGAGAGACTCTTATTAAAGTCACCACATCTGTAAATAATCTTCACATAACAGATGAGAA
GAAACTTGATTGATGCTGGGATGGACCGATCACATAAAGGATTCTGGGACTGACCTCACG
TTTGCGCATTCAAGTTATCCCTTTCCTCTTTTCTATACCGATAGTTGGAATGGAAAGTAA
CTCCTTTCCATTTGAATTGGGGGGGGGTGTTGTGTTTGGTTTTGCTTCCTTTGCTTCGCA
CTTCACTTCTGAATAGAACATAAAGTTGGTCCGGCCTGCTTGGAATACAACTCCTCCCGA
TCCTAACGCCTTCCAATCAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1065, 2398..2551, 5071..5254, 6066..6203, 8117..8322
1001..1065, 2398..2551, 5071..5254, 6066..6203, 8117..8319
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved