Microcebus_murinus Locus ENSMICG00000004518
snOPY snoRNA Orthological Gene Database
Microcebus_murinus ENSMICG00000004518
Microcebus_murinus
ENSMICG00000004518
GeneScaffold_2379
SNORA62, SNORA62
2157..2307, 3841..3993
6355
TTGGCGGACGACGGAGTATATAAGGACGTCATATCCGGCCGACGGGCCTTTCCACGCTA
CCCGCGGAAGGGGCCCATACGGCGTTGTTCTGGGTGAGTTCCATTTGGGGGTCCCAGGTG
TCCTCCAAGGCTGCCAGAACCCTGCGCTCATGAGGGGTGCGGAGACTCGGGATGAAGGCC
GGTCGGACCAGGTGTATTTCATTCTCGGCGCGCTCCGCCTCAGGCCGGCGGCCCGCACGT
GGCCGGGCTCGGGCCTGCAGGCTCCCACAGTGCCCGGGGGTGGGCGAAGGTCGCGCTCGA
GCGGAGGCACGGAGCTGGGGTTCGGGTCTGCGGGAGTGCAGAAAGCAGGCTAGTGCATTC
TGCTACCATTCTTTGGGGCTCCGACACGGCGGTGAGTCGAGGCCCGAGAGCCGATTGGCG
TACCGGCGCCTTCGGCTGGTCATGTTTTCCCGGTCGCGCCCTGCTGATCAGGAGTTAGGG
TTTTTGGCAGGGCTTTGAGGCAAACTAGTCATGATATCACGGCGAAGTAATTCCGAAGCG
CCTACCTGCAATGTGCTTGGAAATAACCTGAAACCAGTTCACATTTTTCCTACTTTTTCT
TAGCTCGCGTATACCTCAAACATGGCTGCTCCCGCTGCTCATTTCACTTCTAGTTCTTAC
TCTTGCTCATCCATTAGCTACTCCTTAACTCTGTGTACTTTGAGAGGTGTTGAATATCAG
TTGACTGTTCTTGTATAGTTGCATTAACTGGGTTCTACACTTTCCTCAGCAAGGTTTGCT
GCAATTCTGTCTACGGGGCCTTTGTTAACGTTTTGGTTGTATCTTACTCTTCACTACTAA
GCTTATTGCCTGACATACAGTTCTCGGTTGCTTTTAAATATGAAGTTGGCTTTATATGTT
AGGGTGCACCCTTATCCCACTTAACCACTGGAATGAAAACAACTAGATTGTTAACTGCTT
TTTTCCAGATTCCCGTCGTAACTTAAAGGGAAACTTTCACGATGTCCGGAGCCCTTGATG
TCCTGCAAATGAAGGAGGAGGATGTCCTCAAATTCCTTGCAGCAGGAACCCACTTAGGTG
GCACCAACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAACTGATGGTCAGT
CATTGCTTTAATTTTTGTTATTCCAGCTATAATTACAAATTTTGACCCTGCTATTCTGAT
GGGTGCTACTGAATGAGGTAATTTCTATCTAACATCTCTGCCTCAGAGGACTCTGCTAAA
TGGTGAATGAAATGAGATTCCCTAGATTGGGAACATGCTTTAAGACTAAATGTTTTCTGA
TTGTTAACAGGAGGAAAGATTTCTGGGCTCCAGTGGAAGAGTATGACAATTGCCAAGTTA
TGGGGCTTGGATTGTGTCAAAAGTGTGAGATGTGAGAATGAGGAAGCTCGTTAGCTGAGT
TCCTAATAACTTTATCTTCCATATGTTTCTGTGTTTTTTTTTGTTTTTTTTTTGAGACAG
TCTCGCTTTGTCGCCCAGGCTAGAGTGAGTGCCGTGGTGTCAGCCTCGCTCACAGCAACC
TCAAACTCCTGGGCTCAAGCAATCCTTCTGCCTCAGCCTCCCAAGTAGCTGGGACTACAG
GCATGCGCCACCATGCCTGGCTAATTTTTTCCATATATATTAGTTGGCCAATTAATTTCT
TTCTATTTATAGTAGAGACGGGGTCTCGCTCTTGCTCAGGCTGGTTTCGAACTCCTGAGC
TGGAGCAATCCACCCGCCTCGGCCTCCCAGAGAGCTAGGATTACAGGCGTGAGCCACCGC
GCCCAGCCTGTTTTTGTTTCATAGTTACTGATACAAGATTATTGAACTGAATTCTGAGAG
GAAAGTAGGGCAAAGGTTGGGAAAAATAGTTTGGCTTGGAAGGATTGAGGAGAGAAAGTG
AGTTATGATGAGAGTGCGAAAGGCATGAAGTTGGCTAAGGCACTTGTTTAGCTTACAGAT
TGAGCCACTGGAGGATTTAAGCCTGGAGTGGCATGCTGTAGAGCCAGATGCATTGTTGCA
GATGATAAAGGGAAGAGTGGCAAGAGGCCAGGAAGTGGATAAGAACTTGTAGGAACCTAG
GGGGGTCTCATTAAAGGCAAGAGAAAGGAAAAGATGGACTTTGCCTACTAAATAGGGTCT
GCACACTATTAAAGCTCAGGGTGGAGGCCAGCCTTGGCCAGTGAACTTCTGAGTGTCGGA
AGTGTGCTACATTAAAGGCAGGACATTCGCTAACACCAGTAGAGCTTGCCTCTATGACTG
GAGTTTGATAGTACTCTCTGCCACATACACTCAACTTTTTAGAAGAATGTCCATTTGCAT
CACTAGGTCAAGTTTTTAACAAATCCTTCTGTCCTCTTCTAGGCATCTACATCATAAATC
TGAAGAGGACCTGGGAGAAGCTTCTGTTGGCAGCTCGTGCCATTGTTGCCATTGAAAACC
CTGCTGATGTCAGTGTCATATCCTCCAGGAATACTGGCCAGGTTTGTGGAACAGTACTTA
TTTTTTATAGACATAAAGCTTATGGACATTTTGGGATATACAGAAAAAGTATAACTCTTC
AGGAATTGCCAGCATTCAACATTTTTAATATATATCTTGCCATCTGACAGTGTTGAACTT
CCATATTTTCATTTTGTACTACATTGTGCCACTTAATATCTAGAGATGACTGTATTAAAT
TGGCTCATCACATTTTTTTGTAGTCAAAATTTTTATGTTGAAATACTGGAACAAATTTGA
AGTCAACTGCACACATTTTCAGAAAGGTTTTATTTTTCTGTTGAGAAAATTAGTGACGCT
ATTAATTTTTTTCTTTTGAGACAGGGTCTCACTCTGTTGCCTGGGATAGAGTGCAATGGT
GTCATCATAGCTTATTGCAACTTCATACTCCTGGGGCTAAAGCAATCCTTCCCTCTCAGT
CTCCCAAAGTGCTAGGCTTACAGGTATTAGCCACCACACTCAGCCTCTTAAATTTATTTA
TAGGAGTTCTTTTTTGTTTTCCCCATTCCCCCACCGATTTATAGGAGTTCCAACAAGGGT
TTCATTTACCCCATGACCTGGATTTTGACAAATTTAAAAATTACATAGGAAGACTGTCCT
TTTCTATTTCAATGTTGACAGCAAGAAGATGGGTTTCCATGAGAGTGTTTTTGTGGGGGG
TTATTTGTGACTGGAACCCTGTAGTTTTAGGATGTTTAAATTGTTGTAGAATGAACTGAG
TGACCACTCACATGCTTGCTTCAGCAATTTACAGAATATCTAGATTGGGCCAAGCAGTGT
TGATAGGTGTTTGGTATAATAGGAGAAACACTGTCTTCCTTTTCGAAGGGATACAGGGAA
TGATCTTGCTTTAAGTGTTTAATTTGATGCTTTTATTTTTTAGGAAAGGGTATTTGAGGG
TTCTGACTAGATAGGCTGCTTTGTGTGATTACAGAACTGGGTGTCAGCACATGGAGAGTT
CTCATGAAACCATAGGAACTCTGGAGTGCTGCTAACTCTTGATTTAATTCTTCAAAGCGA
GCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTCCTATTGCTGGCCGCTTCACTCCT
GGAACCTTCACTAACCAGATCCAGGCAGCGTTCCGGGAGCCGCGTCTTCTGGTGGTTACT
GACCCCAGGGCTGACCACCAGCCTCTCACAGAGGCGTCTTATGTTAACCTGCCTACCATT
GCTCTGTGTAACACAGATTCTCCTCTGCGTTATGTGGACATTGCCATCCCATGCAACAAC
AAGGTAATGACTTTAACAATCTAGAGTTTGCAAATAAGTATTCTAGAAAAATGGGCATTC
CTGTGCACATTGTTAGAGCTTGGAGTTGAGGCCACCGACTGGCCGATGAACTCACAAGTG
TAGGTAGTGTGCTACACGAGGGGCAAGTTTTTCGCTAACACCACAAGGGTCTCTGCCCGA
TGAGTGGAGTTTGATAGTAATTCTTGCTACAAGTATGTTAATGCATAACAGCTTTGAGAA
GAGATGGAAATATTTGAAAATGGCCTGTGTTTTCTCCTGCCTTTCTGTTTCTTGCACTGC
TTACGCCTCTCAGGCATTACATATTACATGGCTTTTCTGTTTTCAGACCAACTTGATGAA
TCCTGCTATAAGATTCTTAAAAGGTGGGTTGTGTGTGGTTCAAATTGGTATTTGTAACTG
GCCACAAAACCCTGGATGCACATTAGAATCACCCAGACTTTTTTTTTAAATGGCCAGTGT
TCAGGCACTGCTCCCAGGCATCGTTTAGTTGCATAGCATGATCTGATCATTTAGGTGCCA
TTTTTACATACACCACAGGTTTTTTTAATCTCCATGATTTCCAGTGTGCAAATTTGAGAA
CCCCTGATTTATAGGATGTTTTTTGTTATAGCACTTTAAGATATGTTTATTATACTTTTG
GTATGAAGGGACCTAGATGATGTGGGGGTAGGTGAGACAAACTAGGTGCTTGTGGTTTAG
AGTTGACTAAGTGTCACTGTTCAATAACCTGGTATTCTTGCAGGGGGCTCACTCTGTGGG
TCTGATGTGGTGGATGCTGGCCCGGGAAGTTCTCCGCATGCGTGGCACCATCTCCCGTGA
ACACCCGTGGGAGGTCATGCCTGATCTCTACTTCTACAGAGATCCTGAAGAGGTGAGCTT
TGTTGGCAAAGGCTTGTGGTCACATGAGCAAATTAGACACCGTTGTCTGTGCTTTTGGGG
AGCAAAACTTGTTCCTGTGAGGGAGTTTGCTTGCTTGCTTTATTTATTTATTTATTAAAT
AACCAGATTGAAAAGGAAGAGCAAGCTGCCGCTGAGAAAGCTGTGACCAAAGAGGAGTTT
CAGGGTGAATGGACAGCTCCAGCTCCTGAGTTTACTGCTACTCAGCCCGAGGTTGCAGAC
TGGTCTGAAGGCGTGCAGGTGCCCTCTGTGCCTATTCAGCAGTTCCCCACTGGTATGTGT
CCATACAAGTGCATCAAGCTGGTGTTTTGGAACTTGTAAGGTTTACTCTAATGATCTCTG
TGGCCATTACACTAGCAGTAAGAGGCTTTTATCCAATGTGCTATAGCTGCAGATAACTTG
ACAAGTTGAATTCAGGTGCCTTTGGAATGTGCTGGCATTAGTCTTTGGTATATATTTGAC
AGAATCCAATATATATCTGATAGATTGCTGTTGGGGGTGGGGTGAGGAAAATGCTACTTT
GGGAACACAGCTGATGGCTATTTTTGGTGTTTTCTTAACAGAAGACTGGAGCGCCCAGCC
TGCCACGGAAGACTGGTCTGCAGCTCCCACTGCTCAGGCCACTGAATGGGTGGGAACAAC
CACTGAGTGGTCTTAAGTTCTTCTACAAACTCTTAAAAATGGAAATAAGGTTAATGGAAA
ATAAACATGAGTTTCTAAAAATTGTGTCCACTTAAGTTGATTTTTCTAAATTCCAGATCA
AAGTATTTGGGATTGCTTTTACATGTCTTATTTATTTATTTTTTTTCTTTTGAGACAGAG
TCTCACTCTGTTGCCTGGGCTAGAGTGCCATGGTGTCAGCCTGACTCACAGCAACCTCAA
ACTCCCCTGGGCTCAAGTGATCTTCCTGCCTCAGCCTCTCAAGTAGCTGGGACTATAAGC
ATGTGCCACCATGCCTGGCTAATTTTTCCTACTTTTAGTTTGGCTAGTTTATTTATAGTA
GAGATGGGGTCTTTCTTCCTCTTGCTCAGGCTGGTGTCGGACTCCTGAGCTCAAGCAATC
CTCCCTCCTAAGCCTCCCGGGAGTGCTAGGATTACAAGCATGAGCCACCATGCCCAGCCC
TTTTACATGTCTTAATATCAGCTTCTAAAACACACTGTAGATAAAGTGTATTGGTTTTCC
TGAGATTCCTTTCTGTGTAAAGAAATTTGTGTCCCAAAAATAGATGTAAGTATTTGCACA
TACATAGGTGGTAATCCCAGGAATATTTTCCCAAATCCCTGATAATCTTGACTATTACCA
TTGTATTAGTAAATTCTATAGAGCCCAGTTTTAGAGGAAATTGGTTTTCAGAAATACGGA
GGTTTCTCAGGTTGATGCTGTTTAGGGAACAAAGGGTAGGAAAATGTCATTCCTGTATTT
TTAAATACATTGTAGAAAACTTAAATCACAGATGTGACTCCATCTGACAACTGCTGACCT
CCCCAGGATTGCACTTCTACCTGGGTACCATACAAACCTACCTGCCTCTCTAGCCTTGTG
TCCTCGTGCCCAGTGTCTCCAACCCAGAGGCCTTATTGTGAGCCTGTTGGCTCTGGCTCA
TGCTTTGTGGCATTCCCACAACAGTTGGACAAACAGCATCTTTTTTCTAGAATTTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1133, 2382..2500, 3537..3782, 4543..4671, 4806..4971, 5261..5355
1001..1133, 2382..2500, 3537..3782, 4543..4671, 4806..4971, 5261..5352
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved