Microcebus_murinus Locus LAMP1
snOPY snoRNA Orthological Gene Database
Microcebus_murinus LAMP1
Microcebus_murinus
LAMP1
GeneScaffold_2188
SNORA2
5919..6059
24767
AATAGAAAGAAATAAATTGGCCAACGAAAACTATATATAGAAAAAAATTAGTCGGGCAT
GGTGGCACATGCCTGTAGTCCCAGCTACTCAGGAGATTGAGGCAAAAGGATCCACTGAGC
CCAGGAGTTTGAGGTTGCCTTGAGCTAGGCTGACGCCATGACACTGTAGCCCAGGTAACA
GAATGAGAATCTGTCTCAAAAAAAAAAAAAAAATCAAAACTCCAGTCTTATGTAACCACT
TAAGCCTACTACAGGGGAGAAAACAATTTCTTCCCTTTCCCATTTTAGGTTCTTTAGTTG
AGACAATCCTGTGAACTAAAAATCTTAACCACACTTTCTCCTTCAGCTCGGCGCCATCTT
CCCTCCACCATCGATCGATCAGCGGAGAGAGACTCATCCGACTTCAAACCCGTCCTTCCC
GTCATAAGGGCACAGAGCAGTCAGGAAATACTGGCCGCCCGCGTGGCAACTGAGGCGCCT
GCGTCCCCACACACTAAGAAGCACGAGCCTTCTCGCCCCGCTGCCGCCCTTTCTCCCTCA
CTTTCTCCAACCCGGGTTCTTCCCTTTCCTTTTCCTGCAACCCCCACCTACTTCCCCCTT
TTCTGCGCCTCCGCCTGCCCGGGCCGCGGCCCCGCGGGATCACGTGGACGCGCAATCACG
TGCCGTGCGTGTCACGTGTCGCTCCGGGATCACCAGCCTCCGCGGGCGCAGGACGCAGGG
AACACGCCGCACCTGGGGAGCAAGCGGCCGACCCCGCGCGCGTGTTCTCGCGAGATCCTC
AGGGGTCACGTGAAGACCGGGCGCGGCGCGGCTCACGTGACAAGCGCTGCCGGTCAAGGG
GTCTCTTTCGTTCGGGCCGCAGCCGACGGGCCTCCTGAGTCGGTGGACGCCGCCGCCCTT
CGCTTCGCCCCGGCGCCCGCGCCTCCGCAGCCCCGCACCCGCCCGCCCGCCCGCGACCCA
ACCGCCGCCCGCCCCCGCACCGGCCTCGGCCGCCTCGCGCCATGGCGGTCCCCGGCGGCG
CCCGGCGGCCGCTGCTCCTGCTGCTGCTCGGTGAGGGGCCGGGGCCGGGGTCTGTAGGGT
CAGGGGCGGGAGCCGCGGGGCTGCCGGGGGCGTTCTCCCGCGGGTCGCCCCGCACCGCCT
CGCTGTGGGCGCCGCCAGGCCTGCCCGCGGGGTCGTCCGCCGACCTGGTTCCCCTCTCGG
GTCTGCATTTGCTCTGCCCTGGATCCGAGTCTGCTGGGGCGGGAAGTTGAGGGCTTGCCC
GGTGGTTAGGGGCTTTCTGGACAGGTCTGGCGGGGTGACGCAGCCGGAGACGGTGGCGGG
GACTTGGGTGGGCTCTCTGTCCGCCTGGGTGGGTGACCTCGATCGAGCTCTTCCCAAGGC
GGATATTTCCCAGAAGAAAACGGAGGGCCGGCGCGGTGATTGCCCGCCTCCGAGCTCGAC
CCGTTCGCCTCCCTCAGTGAGCTATGGAGGTGCGCGTGTGTTGGTGTTACTGTGAGTCAC
GTTTACGTTCAAACGACTTAAAGTTATCTTTGAGATTTTACGAGATTCCGTGGCAGGTGA
ATGAGGTAAAACTAGGCTTCGGACGCAGGACGGCAACGTTCATTTCTAGTGAGGAGCCTT
GGAGAGCGCTGTTGGTGAGCCGACATGGGAGACCTGGTGTTGCCTTGACTCAGGCAGGCG
GTAGGGCTCGATATTTTATTGCTTGAGGGGTTTCGTTCTTCTTTATTCTCTCTTAAAAAA
GAGGAATAGGGCCGGGCGCGGTACCTAACGCCTGTAATCCTAGCACTCTGGGAGGCCGAG
GCAGGTGGATCGCTCAAGGTCAGGAGTTCGAAACCAGCCTGAGTAAGAGCGAGACCCTGT
CTCTACTATAAATGGAAAGAAATTAATTGGACAACTAATATGTATATATAAAATTAGCCG
GGGATGGTGGCGCATGCCTGTAGACCCAGCTACTCGGGAGGCTGAGGCAGGAGGATCGCT
TGAGTCCAGGAGTTTGAGGTTGCTGTGAGCTAGGCTGATGCCATGGTACTCACTCTAGCC
TGGGCAACAAAGCGAGACTCTGTCTCAAGAAAAAAGAAAGAGAAATATGTGCTATCTCTT
TATTTATTTATTTGAATCAGAGTCCCACTCTATTTCCCCGGCTAGAGTGCCGTGGTGTCA
GCCTAGCTCACAGCAACCTCAAACTCCTGGGCTCAAGCAATCCTCTTGCCTCAGCCTCCC
GAGTACCTGGGACTACAGGCATGCGCCACCATGCCTGGCTAATTTTTTCTATATATATTA
GTTGGTCAACTAATTTATTTCTATTTACAGTAGAGACAGGTCTTGCCCAGCCTGGTTTCG
AACTCTTGACCTTGAGCAATCCGCCCACCTCGGCCTCCCAGGGTGCTGGGATTACAGACA
TGAGCCACTGCGCCTGGCCTAAATGCTATCTCTTAAACGGGTATCCACTTAATGGTTTAT
TCTAAGTCAACTTGGAGGCCCTTGGGGAACCTCTCTCTCTGACATTCCTTCTCCCTTGTA
ACCCCCAAACATCAGGGGAAGACTTATCTTAAGCGCCAGCATCTGAAAGATGATACGGGA
TAAAGCCAGTAAGAAATTAATTGACCAACTAATATATATAGAAAAAATTAGCCGGGCATG
GTGGCGCATGCCTGTAGTCCCAGCTACTCCGGAGGCTGAGGCAGGAGGATTGCTTGAGCC
CAGGACTTTGAGGTTGCTGTGAGCTAGGCTGATGCCATGGCACTCACTCTTGTCTGGGCA
ACAAAGTGAGACTCTTTCTCAAAAAAAAAAAAAAAAAAAAGAAAGAAAGAAAATTTGGTT
ATTGGATTTTGGTTTCACATTTTTGCTTTGCTTGTGTAAAATCTTTGAACTGCACAAATA
GTCACATAGATGAACTTAGTAGTAAACCTGAAGCCTTCCTCATGTCTCGTGATCCTTCAA
GGCAGGTGTAATTAGTTATTTAATTTTACTTTAAAAAAATATTTAGAAACGGGATCTCAT
TTTCTTGCCCAGGTTGCTCTTGAACTCCTGGCCTTGAGCAAATCCTACCCCTCAGCCTGT
CTTAGTGCTGGTATTCCAGGCGTGAGCCCTGCCGTTCCACTAGATGTAATTGGTCATGAG
AGGAGTCGCTGAAACAAGTTTTGTCACGTCAGAATAACTGCATTGTTCCTTATTAGAAAA
ATGCTCAGAAGCCTTGTAACTTTCATATTTTGTTTCATCTTTTTAAAACTGACTTTTATT
TTTTTATTTTTTGAGACAGAGTCTCACTTTTTTGCCCAGGCTAGAATGAGTGCCGTGGCG
TCAGCCCAGCTCACAGCAACCTCAATCTCCTGGGCTCAAGCAATCCTCCTGCCTCAGCCT
CCCAAGTAGCTGGGACTACAGGCATGCGCCACCATGCCCGGCTCATTTTTTCTATATATG
TTGGCCAATTAATTTCTTTCTATTTATAGTAGAGACGGGTCTCCTTCTTGCTCAGGCTGG
TTTTGAACTCCTGACCTCGAGCAATCGCCTGCCTCGGCCTCCCAGAGTGCTAGGATTACA
GGCGTGAGCCACCGTGCCCGGCCTAAAACTGACTTTTAAAATGAGAAAAATCTATAATTT
TCAATATTGTAATAGTTTAGAGTGTTATGTGTGTAATTAGTTTTTTTGTTTGTTTGTTTC
TTTTGCCCAGGATAGGGTGCTGTGGCGTTAGCCCAGCTCATGGGAACCTCGGACTCCTGG
GCTCAAGTGATCCTCCTTCCTCTGCCTCCTAATAGCTGGAACTACAGGCACGCACCACCA
GGCCCGGCTAATTTCTCTATATATTTTTAGTTGGCTAATTTATTTTTAGTAAAGACGGGG
TCTTGCTCTTGCTCAGGCTAGTCTTGAACTCCTGATCTCAAGCAATCCTCCCGCCTCCAA
GAGGGCTAGGATTACAGACATAAGCCACCAGTCCCAGCCTAAGTTTTATATTAAAATTTC
GCTTTTAAAGAAGATCTTTTAAGAACTTGGGATATTTTTTTTTTTTTTTTTGAGACATAG
TCTCACTTTGTTGCCCAGGCTAGAGTGAGTGCCATGGCATCAGCCTAGCTAACAGCAACC
TGAAACTCCTGGGCTCAAGCAACCCTACTGCCTCAGCCTCCTTCCTGAGTAGCTGGGACT
ACAGGCATGCACCACCATGCCCGGCTAATTTTTTCTACATAAGTTGGCCAATTAATTTCT
TTCTATTTATAGAAGAGACGGCCCGCCTTGGCCTCCCAGAAAGCTAGGATTACAGGCGTT
AGCCACCGTGCCTGGCTGAGAACTTGGATTTAATTTAGGTGTATTTAGAATTTCTTTTAA
CATACAACTTCACCAAAAAGCATTTTTTCTAAAACAAAATTCAGACTTTAAATTAGTAAT
TTCTTCTACATTTATGATTAGGAATTGCTTAAAGCCACTGGGTTTTGTTTTTTTTAATAT
TTGGTAGAAAGTGCAGACAAGTATGAACTGAATCTTTGTTTTGACTCATAGAGTTGTGTA
ATGTGACCTTTTAAACCATTGGTGTCAACTAGATGACCTCCTTCCCCTTTCCAAATGAGG
AACTTTCCTTAGAAGTTTGACAAGTTTTTTTGTTTTTTTTAGACAGAGTCTCATTCTTAC
TGCCCTGGCTAGAGTGCCATGGCGTCAGCCTAGCTCACAGCAACCTCAAACCCCTGGGCT
CAAGCGATCCTCCTGCCTCAGCCTCCCAAGTACCTGAGACTTTTATCTATATATTTTTAG
TTGGCCTATTAATTTATTTCTATTTTTAGTGGAGACGAGGTCTCGCTCTTGCTCAGGCTG
GTTTCGAACTCCTAAGCTCAAATTACCCTCCTGCCTTAGCCTCCCAGAGTGCTAGGATTA
CAGGCGTGAGCCACCACGCCCGGCCTGAAGTTTTATCCTAATTGTTACCCTGGAGTGTGG
GAGTCTCACTTACACAGGGGGAAGACCAAAGTCTTTGCTAGATTTGGGTTCAGAATGTTT
TTGTGGCCTTATAACTTTGAATTTATCTTAAGTTAGACCCCCTCCCCCTACGACATGAGC
TCGCCCTTCTCTGTGTACCCTCAGGACCTTTGCACGTGCTTTTGCAGCACAGCATGCACT
GTGGTGGTTTTCCTTAACTGACATGTAGTGAGTGCTCAGCACATGTATGAAGAAATGTTC
ACTTTTAAAGCAGTGGTTCTTAACCAAACATATGCACTGATCAGCTTTTTAGAAACATGA
GTGCTTGTGCCCTGTCTCTAGAGGTTGTGATTCAGTACCTAGGATGGTCAGTCTTTTTTC
TTTGTTTCTTTCTTTTTCTCTCCTTTAAACCTTCATGGATGGTTGTGCATCATTGGTTTA
AGAAGAAGAAAAATACTAGACTTAAAAGAATCAAGCCAAGATAAAAAACTAGGATGTGGG
GGCTGGGCACGGTGGCTCACACCTGTAATCCTAGCACTCTTGGAGGCCGAGGCGGGAGGT
CATGAGTTCGAGACCAGCCTGAGCAAGAACAAGACCCCGTTTGTACTATAAATAGAAAGA
AATTAGCCAGGCATGGTGGCGAGTGCCTGTAGTCCCAGCTACCCGGGAGGCTGAAGCAGA
AGGATCGCTTGAGCCCAGGAATTTGAGGTTGCTGTGAGCTAGGCTGACGCCACGGCACTC
TACCCCAGCCAAGAGAGTGAGACTCTGTCTCAAAAAAAAAAAAAAAAGGTAGGATGTGGT
TTCTTATGAAGATTAAGATTGGTTGAATGAGACAAGGTCTTGCTCTGGCGCCTGGGCTAG
AGTACAGTGGTGTTGTAATAGCTCACTGCAGCCTGAAACTCTTGGGCTTGAGTGATTGGC
CTGCCTCGGCCTCCCAAGTAGCTGAGATTACAGGGTCAAAAGCAAGTGTTTCCTTTTTTT
TTTTTTTTTTTTTGACGTTGTTTTAGTAGTATATTTTAATTGGCCCTGAATCAAGGCCAG
CAGTTTGCTGAAGCTGTTGGTTTCATATATACAGGAGCCTAAAGAATTATCTTTCTCTGG
TCTGTTGGCCATTTCAGAACTTTGGAAATGTAATGGTCAATTCATTAGAAAGAAACATCG
GAGAAGAAAAGAGGAAAAGCGGGGGTGGGGGGGAGTAGGATATTTTAAGAGAGAGCGTTT
CCTAAATCGAAGCACATTCCCTTACCAAGTGCTGTGTGGTTCGGACATGGCGCGTGCACT
GCGACCGGCCCCTGGACTGGCTCTGTCAGAAGACTCGGTCTGGGTCTGGTCTGCACCACT
CACTGGCCTGGTGACCTTGGGTGAGTGAGCTAGCTCAGGGTCCTAACACTGTCTGTCTGT
GAGGGTGTCATGGCAGTTAAATTAACTGCAAAGTGCTTAGAGCATTTGCTCGGTACANNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCCTAGCACTTTGGGAGGCCGAGGCGGGCGGATTGCTCAAGGTCAGGAGTTCGAAA
CCAGCCTGAGCGAGACCCCGTCTCTCCCAAAAATAGAAATAAATTAATTGTCCAACTAAA
ATATATATATATACAAAAAAAAAAAAATTAGCCGGGCATGGTGGCACATGCCTGTAGTCC
CAGCTACTCAGGAGGCTGAGGCAGTAGGATCGCTGAGCCCCGGAGATTGAGGTTGCTGTG
AGCCAGGCTAATGCCACAGCACTCACTCTAGCCTGGGCAACAAAGTGAGACTCTATCTCA
AAAAAAAAAAAAAAAAAAAGAAATGCTTTTAGTGTAATATTGCCTGGGTATTTCAGGGTG
TGGGTTAAAAAGCAGAGCAAAACAGATGATAGCTTCAGGGTGTGACATAGTTTGTTTTGT
TCTCGTGTAGCAGCTTTTCTTCGTCGACGTAGGTTTGGGTATTTCGTCTACCATGGGCTT
AAGGGAAGGCAGGTGGGATTTCTGGTTACACGCTTTGCTCTAGTTGCTCTGCAGATGTTA
TTTTGTGAAAGTCTGAAGAGTAAAATGAATTGAGTTCACTAGAGCCGTTTGCTTTCCCGG
AGGTACGATTTAAATGGTAAATCTAGTGTCCCGTCTTATGTGCTGTGCTGGGTGTGCCCA
AGCCGTGCTTGCACTTAGAGTGGGGGACGAGAATACAGGTGAGTCAGCGTCCTCGGAAGG
GCGTGCGCACGCAGGGTGGCAGGTGCTCACTGGAAGGGTGGGCATGGCTTGCAGCAGAGA
CAAGCCACTGCGCGTCACGTCTGGATGGTCGACACATCGCGGTGGCCCACCTATTTTTGC
CATTCTGGAAAAGAACTATGTACCAAAACCTGCACTTTGAAAAATTACCAAGTTCTTTAC
TGATAAGATTACATTTGCTGCTAAACATTCTGATCGGGGCAGTGGAATATGAAGAAGCCA
GAGGGGAAATACTTAGCAGTCACCGCTTTCAAGGCAGAAGACCCATAGAGCTTCTAGTCT
GTCCCTTGTAAAAACTGATCAAACTTTATATAGAAGTTGAGGACCACGGTGACAGACACT
GCCGGCTGTCCCATGGGCTTCTGCAGAAGGCCAGTGTTTAGGGTGAGGTGTGCGTTCAGG
GCTCACCACATTGTCCAGAGATGCTCTGGGAGACACGGAGCGTTCTGTGCTTAGGCTGGT
CCCTGAACCTGACACGTCCCATCCTGAGGTAGAGCACTGAACAGTTGTGGACCAGGCTGG
CAAAATGACCAGATGGGCTTAGAGGTCCTGACTTCAAAATAGCATCCATGCGGGATGGAA
CCTCAGGTGAACCAAGCCTCTGTGATCCACCTGTCTAGTTGTTCAGTGGTTGCAGAAACA
CAGTGGAATCTTCTAATAAATTCCATCGCTGCTGCTGTAGAAAATGGAAGTGCCCGGCAT
ATTTTCCAGAAGTATCTGACGTTCTCTGTCTTTCCCGGCCTTGGCAGGCCTCCTGCAGGC
GCATCCTCAGCAGTGTTCGAGGTGAAAGACGGCAACGGCACAGCTTGTATAATGGCCAAC
TTCTCTGCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNAGTGGGTTCTGTTGTAATTGTGTTTGTTCTAGAACGCGGCCTTTGACCTG
CCGCCAAGTGCACACGTGCTGAACAGCAGCTCTTGTGGAAAAGAGAACACTTCCGACCCC
ACTCTCAGGATTGCCTTTGGAGAAGGACACACACTGACCTTCAACTTCTCAAGAAATGCA
ACACGCTACGGCGTCCAGCGTATGAGTTTTGTTTACAACTTTGTCAGACACACGCACTTT
CCCCAACGCAAGCTCCAAGGGTAAGGACAAAAATTAACCGGTTATGAAGTGATAGAAATT
GGGTTGGATGATTGTCTAAAATTACTTTTAACTAAGGACTATGAATACATAGTTCAAAAT
TGTGACTCCCCCCCTCGGGATCTAGAAAGCAAGACCGTGGAGTCTGTCACTGACATCCAG
GCGGACTTGGACACTCGGTACCACTGTGTGAGCGCCACCGAGACGCGCATGGGCGGCGTG
ACCCTCACGCTCCGCGACGCCACCATCCAGGCCTACCTTTCCAACAGCAGCTTCAGCAAG
CGAGGTAAGTGCTGACCCTTGACCTCTGGTGCCCACTGTGGGCCTGCAGGCGACCTCGTT
TCTCTATGTCCCGGTGATCTGTGCTCGGAAGGAGCCTCACCCAGCCGGGGACACAGCTCT
GCAGGCCAGGCCCTCTTCTCCTCTCCTTCTTACCTGTTTTTTTGTTTGTTTTTTTTTAAA
CAGAGTCTTGCTCTGTTGCCCAGGCTAGAGTGCCATGGTGTCAGCCCAGCTCACAGCATC
CTCAATCTCCTGGACTGCAGGCATGCGCCACCATGCCTGGCTAATTTTTTCCATGTATTT
TTAGTTGTCCATTTCTTTTAGTAGAAATGGAGTCTTGCTCTTGCTGACACAATAAATGTA
TCCAATCGTTATATATAAAAAAGCAGAAGGGTAAAGCAGTTGTAATGTTTTCTGTTGACC
CTCGGCAGAGCTAATGGGATCAGGGTCACAGAGACCTAGTCTTAGTGGCCCAGCTCAGGA
AGGCCCAGGGACAGGTGCAGAAGATGAGCCATGCCTTTCTGAGGAGGTCGTGACCCCTGA
CACACCTGCTAACCTACTGGTGGGCTCTGGACCCAGACAGGCAGGGAAGCCACNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGGGCCTGTCCTCCGGGTCTGCGTGGTAGGACAGTAGTTAGAAGAATCTCAGGTGGCT
GCCAGCAGTTTGCTCCCCAGAGCAAGGGTGGGAAGGAACAGGTTACAGAGAGTCTCAGGT
CTCTGCACGCTGTGATTACTGATGCCGTGATCCGGATTGTCTTTTAAAGCTCAACAGCTG
GCGTATTCCAGAGTTGCTCAGAGCGCCCGCAAGGCTCTCAGAAAGAGCCTGGTTCCTTGG
AGCACTTGGGGGCTCACACCACTCCTGGGCTATGATGGCGTCTGGCTGGGTTCTGTAGGT
TTTGGGCAGTGGTTGGTGCACAGGTACTCGCAACTAAAGGGACTGGTATTTCCTCTGCAG
AGAGGAGGAGATCTGAGATAACTGACCACAGGTGCTGCTGTGAGCACAGATCACCTAAAA
ATACTTGATTGCTGCTAAATTAAGTCATTTCTTCTTTCATCTTGTGCCAGCTTCGTTCCT
TTGTTTCCTAGGCACTTTTGTGACTTACGATTTTGGTGTCTTTAATTTGAAAGCTGCTTA
AAGAGAAAGATCCCAGATCAGTTATGTTAAATATATTTTTTATATATCCCCGTAGTCTGT
TATTCTCGTGGTTTTTTTTTTTTTTTTAGACAGAGTCTCACTCTGTTGCCCAGACTAGAG
TGCCGTGCATCAGCCTAGCTCACAGCAACCTCAAACTCCTGGGCTGAAGCGATTCTCCTG
CTCAGCCTCCCGAGTAGCTGGACTACAGGCCTGAGCCACAGTGCNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTAGACAGACCCTGTCGT
GCCGCCCTGGGGAGTCGGGAGAGCCGTTGCCGAGCAGCCGGCTGGGGTCTCCTGTGAGTT
CGCAGACATGTTCTGGTCCTGAGTTTGGGTGTCGCTGTCACTGCTGACGGCTGTAAGGAA
CCGGGACTTTGGCCCCTCCCCTGTCCCCGCAGAGACGCGCTGCAGGCAGGACGTGCCTTC
CCCCACCACGGCGCCGCCCAGGCCCTCGCCCTCGCCCCCACCACCCGAGAGCCCCTCCGT
GGCCAAGTACAACGTGAGCGGCAGCAACGGAACCTGCCTGCTGGCCAGCATGGGGCTGCA
GCTGAACGTCTCCTACGCGAGGAGCGACAACACGGTAGGGCCGCAGGGCGCCTGTCACGC
CGCCCGTGCCCGTGCGGTGCAGCGCGTGGCTCTGAGGGAGCAGCCGTGCCCTGCTGCCCT
CCGGCGCGGGCGTGCGTGGCGTGGGAGGCCGCCTGGCGCACAGCCTGAGACATGCAGCTG
GCTCCGCAGAGACGCCCCCGGCCCTGGCAGAGCTGGGTTCCCTCAGACCCGGTGCTTTGC
CTTTGTTTTGGAGCAGGGTTGCCCCCAACACGCCGGCTCCCCGCGAGGCTGTGGGGGGCG
GGCGGGCGGGGTGTTGGGAGCCGCACCGACGCGGGACACGCCCCCTCGAAGCATCACTCA
GGAGCGGGCAAATTATTTTTGGAATGTGGAAGTCTTTCCTAGTGTAAACTCTATTGGCTC
TGGTTCTGTTTAAAATGGATGTGGCCTTGAAGCCATTTGTTTTCTCGAGTGAGGGGGACC
GGGAGCCTGAGGCGGCGGTCTGCTTGCTTCCCTGTCTAGACCGTGACCAGAGTGCTCAAC
ATCAACCCCAATAAGACCTCGGCCAGCGGCAGCTGTGGCTCCCAGACGGTGACCCTGGAG
CTCCGGGGCGAGGATGTCGCCCTCCTGCTCTTCCAGTTTGGCATGGTGAGCCGCTCCGCC
CCGGCCACTCCCTCGGGCTTGGGCCGTGCTTTCCCGATGCCTCGTTTCGGGCCTGGCCCC
CGCGGGACCTGGGGAGACCCAGCTCATGTCTGCCTTGGCTTTGCAGCGAGCCACCTGGTT
CCTGGGGCCGCGCCCCTTTCCTGCTGCGAGATGCAGGTTGTCCCGGCAGTCAGGCGTCTC
TGTCCCCCAGCTGCACACGCTGCTGCGTGGCGTCTCTGCCCGGGAGGAGCCGTGTGCGAA
GTCAGCACCGTGACACACGGAGAATGTGAATGCCCCCTGCACACTCTTGTCGGTGCACCG
TGCAGACGAATTAACAGTCGAGTCTCCGTTTGGGCAGAATCCCGTTCTGCGGAAAGGTCC
GGAAGGGACCACTCGACATTCGTGTCCCCAGAACCACATGGGGCCCTCTTCAGACGCAGA
TTCTGAGTGTGGCGCATGGCTGAGGGCCGTCTGTCTCTCTCTCTCTCTCTCAGAACACAA
GTTCCAGCCAGTTCTTCCTAAAGGGGATCCAGGTGAACATGACTCTCCCTGACGCTCGAG
GTGAGACCCTACCGCTCTCACGGCCCCTCCCCCACCCCGCTTTGGCACCCGGGTGACGAG
GCACCGTGTGCGTTGCAGACCCCGCCTTCAGAGCCGCCAACGAGTCACTGCGGGCGCTGC
AGGCCACCGTGGGCAACTCCTACAAGTGCAACGCCCAGGAGCACGTGCAGGTCACCCAGG
CGCTCTCCGTCAACATCTTCCGAGTGTGGGTCCAGGCCTTCAAGGTGGAGGGCGACACCT
TCGGGTCTGGTGAGTAGTGCCGGCTGGTGGGGGCAGCGGCAGCTGGGGAGCCCCTCAGGC
TCTTGCTGTGGGTGCTCAGCAGCTGCTGTGCCGGGCGTTGGGGGCCCCTGTCCCCCTGCA
ATGAGCTGTCTCCCCGCCCGTCTGAGACGGGGAGAGCCGCCCTGGCCCCAGAGAAGCCCA
GCATGTCCGGGGACGCAGACACGGGCGCCACGCGAGAATAAGTGGTCCTTTCAGGGAGCA
GTGATGCCGCTTCTCCCGTGACAGTTGAATATGAAAAGGTCCCCCTATGTCCCGTGCTCC
AGAAGGGCCCAGAGGCCCCGGACGCGGCGCGGTGGACTGGCCACGTCCACGCTGCATGGC
AGCCTTGGGTTCCGGTGCGGGAGAAGGCGTGTCTGCGGTCTGCTCGCCTTGTGCGAGGTG
CTCGTCTGCGCCGGCCTTCCCGGGGCCGGCCAGCTGCACCTGCGGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1039, 1042..1049, 9467..9587, 12102..12130, 12132..12132, 12135..12278, 12280..12319, 12445..12603, 22172..22353, 22839..22964, 23453..23519, 23598..23767
1001..1039, 1042..1049, 9467..9587, 12102..12130, 12132..12132, 12135..12278, 12280..12319, 12445..12603, 22172..22353, 22839..22964, 23453..23519, 23598..23767
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved