Microcebus_murinus Locus AADAT
snOPY snoRNA Orthological Gene Database
Microcebus_murinus AADAT
Microcebus_murinus
AADAT
GeneScaffold_1096
SNORD60
10530..10602
33704
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATCAGTCATCTCCTTGG
CTGCTGGATCACCAAATCCAAACCTGTTTCCCTTTAAGACAGCTGCCATCACCGTGGAAG
GTGGAAAGACCATCCAGTTTGGGGAAGAGATGATGAAGAGAGCACTTCAATATTCTCCAA
GTGCTGGGTAAGTGTCAATAGATAATTGTATTAGCTCATTTCCATGAGAAATATTCTAAG
GCCCATTGATATGGTGACTTGTGTTTTTTGTTTGTTTGTTTGAGACAGAGTCTCACTTTA
TTGCCCATGCTAGAGTGAGTGCTGTGGCATCAGCCTTGCTCACAGCAACCTCACACTCCT
GGGCTCAGGCCATCCTCCTGCCTCAGCCTCCCGAGTGGCTGGGACTACAAACATGCACCA
CCATGCCCGGCTAATATTTCATATATATATTAGTTGGCCAATTAATTTCTTTCTATTTTT
AGTAGAGACGGGGTCTCACTCTTGCTCAGGCTAGTTTCTAACTCCTGACCTCGAGCAATC
CGCCCTCCTTGGCCTCCCAGAGTGCTAGGATTACAGGCGTGAGCCACCGCACCCGGCCTG
ACTTGTGTATTTTTTAACTGAGTGTTCAATGGCTAGGAAGGTTTGGGGAAGAGGTTTCAA
AGAATAAGAGCAAGAGGGATATTTAATGCTCCTCAGTGATTGCTTTTCAACCTTAAGTGA
CTGGGGAATCAGAGAAGGCTTCTGGAAGGAAGGACCATTTGAGCTGAGTCTGAAACAGTG
AGGAGTCAGCTGGGTGGAGAAGCACATTGGGAGAAAAGAAATGGGTGACCCAGGAAGCAG
AGATTTTAAGTCCCCAGGCAATTTTTAAATAATTATGTTCCCTTTCTAAACAAGCAGGTA
TACATATACATTGCTCTCATAGGCTCAAATGTCTTTAATTTCTCAAAGGCAAACTGAAAC
ACAAACCTTTAGACTTTCTTTACCTTGTCTTCTAATAGTAGTGTATAGAGTCTATAAATT
ATACTTTATCAAAACGTTCCTTATTCCGAAATTGAAAAGTATATTGAAATGTTATTTGTA
TATAAATTATATAATATGTAATATGTACATAGGCTTCTCTTTCCATGATGTAAAGAATTT
ATTGAGCCTGAACTTCTAGGTAGCTGTAGAAATCTTCCTAGAAGGAACAAAGAATTGATT
ATGCAATGAATTCTCTAGTGTAAGACTTCAGAGTTGAAATAAAAAAAATAATAGATTCAA
ATCTCATTGATTAAATGATTGGCTTTATGAGAATCTCAGTCTGATTACCTTTATGTAAAT
TTCCTAATACCAGAAATCTATTGCTTATATTTTAAATGGGAATACTAACACTGGCAAAAA
GCATTTGAGGATTTTTTAACTAAATGTATAAAGTAGTTGGTATAAAACTACCATTTATTT
CCTGTCTACTCTTACTATGATTATTACTACTATAAATTTAAAAATGCATTTTTATGCTTT
AGAATTCCAGAGCTTTTGTCCTGGCTAAAACAGTTACAAGTAAAATTGCATAATCCTCCC
ACCATCCACTATCCACCCAGTCAAGGACAAATGGACCTGTGTGTCACGACCGGCAGTCAA
GAAGGTCTTTGTAAGGTAAGAAAGAAAGCCTATGTGTAGAATGAAATATGTTTGTAAATA
TAGTCATCCCTTGCTTAGCCACAGAAATCAAGTTTTGTGGATTACTGGTAGTCTTTCTTA
TCTTCACCTAGAATTGTGAACCGGGAATTCTAAGACAAGACATAGGAGGGGAGGAGTGTG
TGTATGTGTTGGGGTACGGAGGTGTTGACTGTTCTTAAAACCCAGGTAGAAATACTTCAG
GTTAATCTATCAGTTTTTCGCTCTAGTTTCCCTCATTGTGAACACAAGGACTTTCAAAAT
TTATCTGCTCTTAATATCACTCACCAGCCTGACTTTTTTTTTTATTTCAATACTCATTTC
AGTACTGATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTGGTTTCTAAGACCCAGACCTATGAGTCACTAAAACAAGAGCCCCACTAAGGG
AGTTCTCAACTCCTACCAGAAGCTTAGTGAGCACTGCTTAGTTTCATCTGGTTAAAGATA
CAGGTTACATTTGTTTTCTGCCTATAGTTATGAAATATCAATATAATTTTTAAATTCTTA
AAGAGCGTCATAGATGGTAAAATACATCAGTAACTCCTTACTCATAGACATACTTGTTAC
AGAGCCCTTAGTAGGAATCTAATTTATTATTAATATTTCTTCCACTTTGTTCTCCAGTAT
GGATGTTATTTTAGGCTCCTGTGTTTCTGTCTTTATTGAATAGTGCTGCCAGTGATAGGC
TGGTTGTTTTAGGGCAAACTGTAATTAGGTTTTCATTTGCTGTGTTGATAAGGCATATAT
CATCCTAGTGTTTTCTTTGGTGCTAGAATGTTCTGTAAAAACCAAATCAATTAGCTGTTT
TACAGAGGAAGATACTATTTGTCATAAGATGTCAAAAGCTACTAAGGAAAAGGTAAATTG
AACATCACCGGCCAAGCTAGGGGACAAAGTCAAATCTTTTATCTCAATTGATAATGACCC
TACTGTTTGTTGTGAGATGTGGATTGTTAAAAAGATAAGAAGAAGAATTCAAACTAGGTG
GAGATTGTAAACATGACTAGGTAAGAAAGGATTTTTCTGTGACTTACATACAATTTAGTA
ATAATTTAAACTGGAAAAATCTATTGCCTACCTCTGAGGGTATCAGTAGGCATCATATTG
TCCACACAATCTCCTAAAATTTGTCAAACCTTCTCTAAACCTCCAAATATCCTTGAACAC
TGTTGACCTCCCCACCCTTTTTGAAGCACTCTCCTCCTCTGGCTCTCAGCACCATGCTGG
CTGGCTCTCCTCCAGCTCACTGCCTGCCTGCCTCGCAGTGTCCTCTGCCCAGCCAATATT
TACTGGAGTTCCTACGGCCCAGGCCTTGAGCATCCTGAATCTGTACACTTTCCCTGGGTA
CCTCCTTTCTCACTCATGTGGTCAGCCATGTGCTTGTGCCTTCCACGCTCCTTCCAGATA
TGTTTGTCCATCTGACCACCTGACACCACCACAGGATGTTTCAGGGCCCCTCACACAAAA
CAGCTCGTCATCATCTCGCTCAGATGTGGACTTTCTGTTTCTGAATTTCAGTGAATGGCG
GTGGTGCCTCAAACTCTGTCTAGTTCAGTAACCAGAAATCCAGGCATCACTCCTGACACC
TGCTCTTCCTCACTCCTCTGTAGTCCCTAATCATGTTCTGTTGGTTTTCATTTCCTGAAT
ACCTCCCCGTTCTTCTCTAAAACTCCACCATCACAGCTCTTGTTCAGATGCCCCTTATCA
AATGTCCCCAGACTGTGGCAATAACTTGCCAAACGTCCATGTGTAATTTTGCCCTTCTTT
TATTCTTTCGTACTGCAGCCAGATTGATATTTTCAAAATGCATGTCTGATAATGTAACCC
CCACTCCCCTCTCCCTTCTTAAAACTCTAACTCGCCACCCTTGGCTTCAGGGTCCCCTGT
CATGGTCTCTGCCCTCTTCTGTCTGACTCTCCACTGTCCTCTTTACACTCCGCCTCAAGC
CACAGAATTCTTTAGGTGAAAGAATGTAACCATCGTCACCACTTACACCAAGGCATGGCT
TCCTCAGGGAAGCCCTCCCTGAATCCCTGAATCCCCACGTCTTCCTACAGTGAGCTCGCA
TAGCCTTGTTTGTCTACACTTAATAATAGCACTCGTCACTGTTTTTAATTACACGTTTAT
TAGATAGTTATTTGATTTGTGTCTAGCTCTCACTCGGACTGGTAGCTCCATCAGAGTACG
AACAGTATCATTTTGCTCATCATTTTATTTCTAGTACCTTATACAATCCTGGCTTATAGT
AGATATTTAAGCAGCAACAAAAGAAATAAATGAATTTTAGGAGCCAGTTATGTTCTTTTT
CTCCTTACTGAAAACCAGGGGTCTTAAAACTATGGCTTGAGAGCCAGTCCAGCTCTTCAT
CTAATTTTATAAATAAAATTTTATTGGAACCCAGTCATGTTCCTTTATATATTATCTGTG
GCTGCTTTCTCACTGTACAGACAGAGATGAGTGGTTGCAACAGGGACACTGTAGCCTACA
AAATACTTACTGTTTGGCCCTTTACTGAAAATTACTAACTCCAACTCTAGAGTCACGTGA
ATTCAAAATGAAAAACAAGTCATGAGCGTGAAGACAGTACCAACCTCGATTTACTAATAA
GCTAACCTGTGCTTCTTTTGTTAGGTATTTGAAATGATCATTAACCCTGGAGATAATGTC
CTCGTAAATGAACCTATTTATTCAGGAACACTGCAAGTTGTAAGTATACATTTTTATAAA
AAGCAGCTCTTAAAATTAGTAAGATGAAATCATTGCACCTTTAGAATTATCTGTCCACTG
AAAAAATAGCATCTTTCATCGGTAAATCAGAGAATCTTAAATAATATATGCAAAATATGT
AAACCTTACCCTCTGCTTCATACATTTGTTTTTTAAAATCCAAATGTATAGGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGCAAGCATGGCCCATCACTGCAGGTGCTCAGAGTTACTTACTCCTGATTGCCACTTAAT
ACAAATACTGTAAAGGTAGTTCTAGCTTGGAGTAGGGGAATTGAATGAGGTGGCCTTTGT
GCTCTACTGATTCTAACTTCATGGATTCTTTTTATTCTCCAAGTTTTATGTTATTTTTAT
AAAGTCAATTTAGAAAGCAAGATACAAGCAATCCAGTTATAATAGCATCCAGAAGAATAA
AATAACTAGGAATAAATTTAACAAAGGAGGCGAAAGACTTGTATGTTAAAAACTCTAAAG
CTTTGCTGAAAGAAGAAATTAAAGAAGACCCAAATGAATGGAGAGACATGCCCTGTTGAT
GGATTGGAAGACTGAATATTGCTAAGATGTCAGTTCTACCCTAATCAATCTATAGATTTA
ATTTAATTGTATAGATCTATCAAAATTCCAGCAGCCTTTTTTTTTTTTTGCAGAAATATA
AAAGCTAATCCTGGCTGGGTGTAGTGGCTCACGCCTGTAATCCTAACACTCTGGGAGGCT
GAGGCAGGCGGATTGCTCGAGGTCAGAAGTTCGAAAGCAGCCAGAGCAAGACCCCATCTG
TACCAAAAATGAAAGAAATTAATTGACCAACTAAAAATATATATACAAAAAAAAATTAGT
CGGGCATGGTGGCGCATGCCTCTATAGCTATTTGGGAGGCTGAGGCAGTAAGATCGCTTG
AGCCCAGGAGATTGAGGTTGCTGTGAGCTAGGCTGAAGCCACGGCACTCACTCTAGCCTG
GGGAACAGAGGTGAGAGACTGTCTCAAAAAAAAAAAAAGAAAAGAAAAGCTAATCCTAAA
TTCATATCAGAATTTAAGGATCCCAATAGCCAAAACAATCTTGAAAAAGAACAAATTTGG
AGGACTCAATTTCAATTTTAAAGGCTACTGTAAAGCTATGGTAATCAAAATAGTGTGGTA
CTGGCATAAGGATAGACATATAGAGCAATGGAGTAGAATTGAGAGTCCAGAAATAAACCC
ATAAATGCAATTGATTTCAATAACGGTGCCAAGTCCATTCAGTGGGGAAGAATAGTCTCT
TCAACACATAGTGCTGGGACAACTGGATTTCCACATGCAAAAGAGAGAAATGAGACTGTT
AACTCACACCATATAAAAATTTAATTCTGAATGAATTCAAAACCTAAATGTAAGAGCTAA
AATTATAAATACCTAGGAGAAAATGTAAGGGCAAATCTTCATTACTTCGAATTTGGTAGT
GGATTCTTTTAGATATAAGAATGAAAAACACGAGCAACAACAGAAAATAGGTAATTTGAT
TTCAAAATTAAAACTGGTACAGCCACATGTACTCACCAGCAAATTGGTATTAACGGATCA
ACACTTAAGTGGACATATAGGAATAACATTTATCGGGTGTCGGGCGAGTGGGAGAGGGGA
GAGGGGCATGGGCAATATACATAACCTTAACATTTGTACCCCCATAATATGCTGAAATAA
AAAAAATAAAAACTTTGGTACATCAAAAGAGATATTATGAAGAAACAGCCTATAGCATAG
GAGAAAATATTGGCAAATCATGTATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGATTCTTTTTATTCTCCAAGTTTTATGTTATTTTTATAAAGTCAATTTAGAAAG
CAATATATAAGCAATCCAGTTATAATAGCATCCAGAAGAATAAAATAACTAGGAATAAAT
TTAACAAAGGAGGCGAAAGACTTGTATGTTAAAAACTCTAAAGCTTTGCTGAAAGAAATT
AAAGAAGACCCAGATGAATGGAGAGACATGCCCTGTTGATGGATTGGAAGACTGAATATT
GCTAAGATGTCAGTTCTACCCTAAGCAATCTATATATTTAATTGTATAGATCTATCAAAA
TTCCAACAGGCTTTTTTTTTTTTTTGCAGAAATATAAAAGCTGATCCTCAAATTCATATC
AGAATTTAAGGATCCCAAATAGCCAAAACAATCTTGAAAAAGAACATATATGGAGGACTC
ACTTTCCAATTTTAAAAGCTACTGTAAAGCTATAGTAATCAAAATAGTGTGGTACTGGCA
TAAGGATAGACATATAGAGCAATGGAGTAGAATTGAGAGTCCAGAAATAAACCGTAAATG
CAATTGATTTCAACAACGGTGCCAAGTCCATTCAGTGAAGAAGAATAGTCTCTTCAACAC
ATAGTGCTGGGACAACTGGATTTCCACATGCAAAAGAGAGAAAGTGAGCCCTTACCTCAC
AACATATAATAAATTAATTCAAAATGGATCAAAGACCTAAATGTAAAAACTAAAATTTAC
AAACCCTTAGGAGAAAATGTAAGGGCAAATCTTAATGACCTTGGATTTCAACATGATTTT
AGATGTGACAGGAAAAACAGAGCAAGAACAATAAAAAATAGGTAATTTAGACTTCAAAAT
TAAAACTTTTGTACATCAAAAGATACAAAATAACACCTTACAGAATGAGAGAAAATATTT
GCAACTCATATATTTGGTAAGAGTTTAATATCAAGAATATACAGGCCAGGTGTGGTGGCT
CACGCCTTTAATCTTAGCACTCTGGGAGGCCGAGGCAGACAGATTCCTTGAGGTCAGGAG
TTCAAAACAAGCCTGAGCCAGATCCTGTCTCTACTAAAAATAGAAAGAAATCAATTGACC
AATTAAATATATATATATATACAAAAATTAGCCAGGCATGATGGCACATGCCTGTAGTCC
CAGCTACTCGGGAGGCTGAGGCAGTAGGATTGCTTGAGCCCAGGAGATTGAGGTTGCTGT
GAGCTAGGTTGATGCCACGGGACTCACTCTGGCCTGGGCTACAAAGTGAGACTCTGTTTC
AAAAGAAAAAAAGAATATATAAAGAGCTACTATAACTAACACCAAAAAAACAACCCAATT
GTAAAATGGGCAAAGAACATAAATAGACATTACTCCAAAGAAGATATGCAAATGGCAATA
TTTGCATCTGAGAAGATGCTCAACATCATTGGCCATTAGAGAAATGCAAATCAGTGTATG
AAAGCCGCATATGCAATCTGATTATTTTGCAAGACTGAGGCTTAGGGGGTGTATTGATAA
TTAATTTTATCAATTGCTGTGCACAGACTTTTTTCTAATTTAAGTTCAATCCGCAGGACA
CACCACCATAAGCCACACCAGTTTTACTTACATTTATTAAGAAGGAAGAGAAAAAGAGAG
AAAGTAAGAGAAAAGTACCACAGGGGAAGAACACAAAAGAGTAATCTTACCACTAGGTTC
CCATTATCAGCACCAGAGGCTTATCATCACGGTAATCTCAACATGGGGGCTAATTCTCAC
GAGCAGTCTCTCAGGCAGCAATGAAGGCAACAAGCTGGGATATCAACATGGAGATGTTAT
ACAGAGAAGCAGCAGCGTAGAAGAGGCTCGGGGACTTTCTTATACTGTTTATATCGTGGT
TTGAACAAAGGAAGGCTTTGGCACCCAAAAGGCATATGCTCTGGTCACGTGAGGTCCCTG
CTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNAGTTCACGTTTGTTATATCGTATTTAATAAATTGCATG
TTTCCAAATATGATTACTGCATCATTAATGTGGCCAGTGACGAACATGGGATTATTCCAG
ACTCTCTCAGAGAAATACTATCCAAGTGGAAGCCAGAAGATTCAAGGAACCCCAAGAAAA
ACACTCCCAAATTTCTTTATACTGTCCCAAATGGCAACAACCCCTCTGGAACTTCATTAA
CAAGTGACCGAAAAAAGGAAATCTATGAGGTATTTTAAAAGAATGTGTATTAACATGTAA
TTATGCTTCTTGTTTCTTGCTGACTGTGGAAGAGAAACTGCAAGTTCCCTCTCTTATTGG
CCTGTTGCTTTCAAGCAAGATAATTTATCATAAAAGAGAGTCATCTGTGTCAATCTAGAT
GTAATAAATTTCTACTGTTTTGTTAATTATGAGATTTTTCATTTACCTTAATTGATGAGT
TAATACCAAAAATAGCATTTTTGGCCTGATGTTAAATTTTATAACATCTTTTAATATTTC
ACCCCAAGTTTGACTTTCATTATTTTTATTTGTTTCTTTAACTATTTCTTCTCCTTCCTA
CTCCATCTAAATCAGGTTGCAAAGAATTTTTTAAAAATAAGAGGCATGCTGTTCTTTTGT
AAAATCTCTTTGAGGTACCTATGCTGCCTAGCTTTTCCCCATAAACTTTTTTTTTTTTTA
AGTAACAAACCTATACTGAGCTCTATAGAAATCCTTGAAAAATAAGAGAAATGAGCCTTT
TGAAAAGTCTCTTTTATGTAGCTCACTGTGCTCCCTAACCATTTACTACAAATAACTTTT
TAAAATAAATACCAAGTCCATGTTAAACTATATAGAATTTAGTCATGTGCAGTGGGATCA
CAAGAAGGATTTCAACCGGTTTCTTTTACTTGGAAAATTCAAAGGTTCAAAATGTTGTCT
TATTCTGGACTCTGTCCTGAGTTCTCTTCTCCATTTATGAACCTGCCCAGACAGCCTGGT
CTACTTCTGTAAGTGATGACTGCCACGGTGCCTGACCCTGTACTCTAAACCTCTGTAGCC
AACTTTCTACTTGATCCCTCCACACAGATGTCTAATAGGCATTTCAGACTTCACATGACC
AACCCAAACCTCTAATCCACAACCCTCACATTCCCCAACCCCACAAATAGTGTGAGCAGA
GGAGCTCCCCTCCCCAGGCCCCCACATCTAGTTCACCCTGTGGACTCACCAAGTTATCCA
AATCCATCTTTTTTCTCCTCCCCGTCACTGTCCCCATCTTCTAAGCTCCTACCCACCCTC
ACTGGCCTCCTACAACACTGCCCACTGTACCCTGCTGCGTTTCATCCTGGTCTCTAACCG
GTCACGTTCCTTACCTGTTGAAATGTCAGTGCACAGCCAGGCTCATGGTTCTGTTACAGT
CTTCCTGTGGCTTCCCCTTGCAGTAAAAATAAAGTCCACATTCCTTTATCTGTCTGGCAA
AGCTATGTGACATGGTCAGTCTGTTCTCAGCCTTATCTCTTAAACTCTTGTATTGCCTGG
TGAGGAAGGGCTTCCCAATGATAGAATCTGAAATAGCTACCCTACTGCTCTCTCTCTCAA
ATGTCACCTGTTGTAATGCTCTCCCCAGCACTTTAACCACCCATTTAATATTTCTTTCGC
TCAGTGTCCACTGGCTTATGTGTGTTCTGTCTTTCCCACCAGTGTGTTAAGTTCCACGAG
AACAAGGGCCTTAGTGCTTGTTCACCTCTTTATCTTCACAGTCTAGGATGGGAGACATTC
AATTCTTGAATGAAAGAATAAATGAATGTGCACAGTTATGATGTTAAAGAATTATGATTC
CAAATGACTTTAATTTTGGATAGCTCTTAAGAAATATATTACTTTAAGAAATATATATGT
TGCTTTAATGTTTTTTAGCTTGCAAGAAGATATGATTTCCTCATAATAGAAGATGATCCG
TACTATTTTGTCCAGTTTGGCGAGGTAAGTGATGATGTGAACTCATGTCACTATTAGAAG
ATAACTTGTTAAGGTTATTGAACTGCACTGGATGTTAGCCTGGCTGCTGAGTCAGAGCTA
ATCCACTTTTACATTGAAACTTAAATCAATTAAGATTAACTTGCTACCACGTCACATTTC
AGTCTTCCATTTTTATCATGGGATTAATACTTTGCATTTTTGTCATTGCTGCTTTTTCCA
GAAATTACTTATTTTCAAAATAGTAGCTGCCGCTCTGTTCTATGCATTTGGACAAAGAGA
GTGAGTCAGAGCTGATGGATTCCTTGAAATCCACATCCTAGTTCATAGCTCCTTCAGTGT
CATCCCAGCAATGTGAAGTGGGTTCATCTTGGGTGCCAATTCCAGTGTCTGGTAGTGGTT
ACCTCGAGTTTGAGAAGGACTAGGAAGCATGTTCAAGCTGAAGCAGAAAGGACTGTGCTC
AATTGGTGGTGCCTCTTACAGACATAGGAGGGGGCATCACAGGGGGTGTGCCACGTATTT
GTCACCCTGTCGTCTATGTCCTGTGTCTTATCTGGAGAATAATGGGCTTTTAGATTCATT
CTCACTATATTTTAGATGTACGATACGTTTCACAATTGTTGTTTTCTAATAGACAGTAGT
CGTAGTAAGAAAACCAAGGCCCAATTCCTCAAAATTCAACACCTTCTTTGCTCTCAGGGA
TGCAAAGAACATACACTGGGAAGAACTGAGCATGGATTCTGTTCCCTGTTTAAATATACA
GAGAAGAGAGAGAAACTTTTGATTTCTCTATAAGATTTGCCAGAATTCACTTCTTTCTAC
TCACCCTCCCACTGTCACCGTGCCCATCACCCCTGTTCTCATTTGTCACTCCATCTGAAG
TAAATATTGAAGTCACTAGGTGCTGTCGACGCCATTTCTCATCTTTATTCTCACCTTTCC
AGTTGGTCCTAAGGATCAGCGTCTCTCCTGCACGATTGTGAGTGCTCCTGGCCCTCCACG
TTTTGGTCTTGTGCAAACTTCTCTTTCCTGACTTCTTCCTTTAAGTCTGTTGATCCTGGG
TTTCAACCTTTGTGGCAAGGAGGGCCTGTTTGAAGTTTCTCTAACTGTATAATAACGGCA
TCTGGCGCACATGAAGGAGCCTTGTGTGTGTGTTTTGGCAAAAAAGCCATGAAGACAGGC
AGGTGCTTAAAGAATCTGCATCTCTGTTCCTGCCCCATGTCAAAGGGTTGAAATAAAGGT
GAGAGAATACTTGTGCTGTTGTATCCAAAAACATGCCCTGTCCACTGTGTATGCAAAGTA
ATCATATGGTGACTAACAGAGTTCTCAAACCAACAGTTGTGTTTTTGTTTGTTTGCCTTT
TCATTTTAAGCCCTGGGCACCAACCTTCCTTTCCATGGATGTTGACGGGCGTGTCATCAG
AGCTGACTCTTTCTCAAAGGTCCTTTCTGCGGGGTAAGGCCACGTCTCCACCGTGAGGCT
CCGTCCAGACAGCCAGACACTGTGCCTCAGTGTCTTTTAGTCCACACAATTCTTTTCACT
GAAGATGCTTGTACTCCTCTTACCCTAAAACACAAGTTTGGTTATTAATATTCACATAGG
CGTTTTCTCTCTTCATTGATCTCCACTGGTCAAACACACTTGGCCATTGATCTAAAGTTG
CAGTGGGACTGGTTGGGCTTTTCATGTCATGTGTGAGAGAGCACATTTGGAAGGAAATAT
GCAGTCAGACTTGTTTTAGATGTACTCTTCTATTTAAAGTTGTATTGGAAATAAGAATTA
ATTAGCTTTATTAGTTCTTTTTAATTGTCTAGATCCATTTGTCCCTAGGGCATAACTCTC
TTCCTAATGAAAGTAGGAAAGGGATATGTAATAATTGTTAATGAGGGATTGGGAGTGTGC
CTTTTCTCTTTCTGTGTAGGTTGAGAATGGGGGTTTCTAACTGGTCCAAAACCGTTGATA
GAGAGAGTTGTTCTTCACACACAAGTGTCAACATTGCACCCCAGTACTTTTAACCAGGTA
AGGACAATTTAGGCAATGGGTTTTTTTAATGAGATCACAATAAAAGATAACAAGAATTCT
CAACCTGCTAGTGAATCATTGTTTTCCTTCCTGATTTATTATACATCACTGACTGTATAA
ACTTGGTTCATCTTGTTACATCTTCATGGTGGTTTACGTGTAATGCAAGAGAGGTTTGCT
TTTACCTTTGACAAACATCAAATTTTTAGAGTACGAACCATGACTTTTATTATTGTTTTA
TTTACTTTAGCTCATGATATCACAGCTTCTACACCAGTGGGGAGAAGAGGGCTTCCTGGC
TCACGTGAACAGGTATTGAATCATTAAATCGTTAAAACATTTATGAGCAAAATAGGAGCC
CAGTGGACATAGTACAGATCACCCAGAATGTTGGTTGTTTAGTCTTCCTTCCTCACCCTA
AGACAGCAAGAGGAATAGTCTATCAGAAGTCAGAAGTCCACTCACTTTATTGCTCNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCTCTGTTCC
TGCCCCATGTCAAAGGGTTGAAATAAAGGTGAGAGAAATACTTGTGCTGTTGTATCCAAA
AACATGCCCTGTCCCACTGTGTATGCAAAAGTAATCATACGGTGACTAACAGAGTTCTCA
AACCAACAGTTGTGTTTTTGTTTGTTTGCCTTTTCATTTTAAGCCCTGGGCACCAACCTT
CCTTTCCATGGATGTTGATGGGCGTGTCATCAGAGCTGACTCTTTCTCAAAGGTCCTTTC
TGCGGGGTAAGGCCACGTCTCCACCGTGAGGCTCCGTCCAGACAGCCAGACACTGTGCCT
CAGTGTCTTTTAGTCCACACAATTCTTTTCACTGAAGATGCTTGTACTCCTCTTGCCCTA
AAACACAAGTTTGGTTATTAATATTCACATAGGCGTTTTCTCTCTTCATTGATCTCCACT
GGTCAAACACACTTGGCCATTGATCTAAAGTTGCAGTGGGACTGGTTGGGCTTTTGGTGT
CATGTGTGAGAGAGCACATTTGGAAACATGCAGTCAGACTTGTTTTAGATGTACTCTTCT
ATTTAAAGTTGTATTGGAAATAAAATGCAGTTCTTCTTTTAGTTTTTTTAAATTGTCTAG
ATCTATTTGTCCCCAAGTCACAACTCTCTTCCTAATGAAATCAAGACAGTGGTATATATT
AATTGTTAATGTGGGATTGGGGTTGTGCCTTTTCTGTTTCTGTGTAGGTTGAGAATAGGG
TTTCTAACTGGTCCAAAAACCTTGATAGAGAGAGTTGTTCTTCACACACAAGCATCAACA
CTGCACCCCAGCACTTTTAACCAGGTAAGGACAATTTAGGAAATAGGATTTTTTAATCAG
ATCAGAATAAAAAATAGCAAGAATTCCCAACCTGTTCAGTGACTCCCTATATGCCTTCAT
TGCACATGTATGAGCTCTCCTAAAGACATTGGATAGAATGCATTAATATTTTAATTAAAG
TAAAATTAATTTGTATAGAGTATAAATTTTCTCACAAGCTTTGAGAAATTATTGTATCCA
TCCCAAACAAAACCTTGTAAATTGTAACAATATAAATGGAATAGAAAAATTTTTATAGAA
TAAGATACTTGTTTGATATTATACATTCCATAAAGTACAGGTATCCCCATGTTTTACCAA
GTTGGGTTTTTTCTCCACATTCTTTCTATTGTTATAAATGGAAGTTCACTGCCAATTTAT
AACATCTAGAATGTCTATTTTAGGTAGAAATCTCTAAATATATAACTTTACATATCTACC
ATATATTTTTTGTTTACAGAGATAGTATTGTAATTAATAACCTAGATGTGGAACTGGACA
GTCTGACTTTGGATCCAGGCTCTGTGACCAACTGTGTGACTTTGGGAAGGTTATCCCTCA
TGCCTTGATTTCTTCCTTAGGGAAGTAGAAATTTATAATGAAAGAATTAGCTAATATATA
TTAGTATCTTACGATAGTGCCTGACACATAACAAGTATTATACAAATATTTATTATTTTT
ACTATTGTCATTGTTATTAATTAACATTGATTATAAATCACTGTATAAGGTAGGTTCAGC
TCATTATATCTTTTTTTTTTTTTTTTTTTTTGAGACAGAGTCTTGCTTTGTCGCCCAGGC
TAGAGTGAGCACCGTGGCGTCAGCCTAGCTCACAGCAACCTCAAATTCCTGGGCTCAAGC
AATCCTGCTGCCTCAGCCTCCTGAGTAGCTGAGACTACAGGCATGCGCCACCATGCCCAG
CTAATTTTTTGTATATATATATTAGTTGGCCAATTAATTTCTTTCTATTTATAGTAGAGA
TGGGGTTTCGTTCTTGCTCAGGCTGGTTTCAAACTCCTGACCTCAAGCTATCTGCCCAGC
TCAGCCTCTCAGAGTGCTAGGATTACAGGCGTCAGCCACCGCACCCGGCCTCATTATATC
TTCTTATGGTGGTTTACATGTAATCAAGAGTGGTTTGCTTTTACATTTGGCAAAAATAAT
CACATTTCTAAGGGATGAATGGTGATATTTCTTCTTATTTAATCTCTTTTAGCTCATGAT
ATCACAGCTTCTACACCAGTGGGGAGAAGAGGGCTTCCTGGCTCACGTGCACAGGTATTG
AATCATCTGTTAAAACATTTATGAACAAAATAGGAGCCTCGTGGACATAGTACAGATCAC
CCAGAATGTTGGTTGTTTAGTCTTCCTTCCTAACCCTAAGACAGCCAAGAGGAATAGTCT
GTCAGAAGTCAGAAGTCCACTCGCTTTATTTGCTCTTCACCTAGAAAGTCTTTTCAGGAG
CATCCCGGGGATGGCTTGAAAGCAGTCTGCCCACACTCAAGGCAATGCAAAATTCCCACC
AGCTTAGCATTCCCTTAGTAACTGATTGAGAGGGTAAACTATGCACACACATAAATATTT
TATTTAATAATCAACCATGAGGGACACATGACACAGGATTTGGCTCAAGCACAGATGACT
GAAAATATAATTTGCCTAAATAATGAGCATATTTGTGCAAATGAGGAGTTATTTTAGTTA
TGTAAATATGGTACCTCCTAGTCCATTCAGAAATAAGGAGAGGTGGGGTGTCCTCATTCC
CAAACCAGGGACTCACCATGTAAGTGGTGTTTTCCTACCCTGCAGTTGATAGCCATTGTT
TCAGATAACAAATCACAAAGACTGATGCTGCTACATCCTCTACTTATAGATTTTGTATTT
TATGTGGAAATGGACTTTGCTTTATTAACTTTCATCTTTGAATTATTCCACAATAAGGGA
AAGAAGGTAATAGTAAAAAGTTTTATCACCAGGCAAGTCAAGCACATGTGTTATGTTCTC
TTATCAAGTATTCAACATTTTAATCAAGATATAAAACAGATTTTCTTACAGCCTGGACTC
CAGAGCCTTGTTCATTTCTGCAAATGAATGTACTGAACACATTTCATTGTTGTTGTTTTT
TTTTTTCTTAAAGGGTTATAGATTTCTACAGGGAGCAGAGAGATGCAATATTGGCAGCTG
CGGACAAGTGGTTAAGTGGTGAGTGGAACGTACACACCCTTATGATAAACAATAGCACCT
TTGAGAATGACTGTAAACACTGCATGTTATTAACAGTCCTAGTGGAAAAGAAACCATTCC
AGGAGTATTCTTTACCAAGGAAATGTTACCCTATAAATGATCCCAGAAACATTCTATAAA
CCATGGAACAGGTCTACCTATCTCTGCTTTACCTGTCTGCTATAAAGAATTTATGATTTT
AAAAAAAGAAAGTTTGATCTAAAAATCAACTGGCAATAACTTACTTAAACCTAAATAACA
TCAATATGCAAAAAGTTTTAGAGTTGCCTCAAAATTTTGTTCCAAACAGAAGAGGATTTG
TCAAACAAACCGTACGCTCCTTTTTGAATTAATTTGTTAAAGACAAAATAGTACAGTCTA
AGGCAGATCTCTCCTTACAATATATTTGCCTTCTAATCATTAAGCTCGTTTATCTGTCTA
ATATTATCTATTGCTATCTGATTGCAGGATGTTTTGATGTTATGAAAGAAAGTCAAATAA
AATACATGGCTTTAATTATATTATTAAAATGCCTTTGATGTAAATAATAGTAAACCAAAC
ATACTATTTCCTTATTTCTGTCATATCTCTTTCTGTATAAAGTCTTGGCAAAAATAGACC
TCTTATCTTTTTGATAAGAGTACTATTATAGTCTAAGTGAGATGGCGCATACCTGTAATC
CCAGCACTATGGGAGGCCGAGGCAGGAGGATCCTCAAGACAAGGAGTTTGAGACCAGCTT
GAGCAACACAGCAAGACCCTGGCTCTACAAAAATAAAAAACAAAAAATTAGCCAGGCATG
GTGTCATGTGACTTAGTCCCAGATATTTGGAAGGCTGAGGCAGGAGGGTCACTTGAGCTC
AGGGGTTTCAGATTGCAGTGAGCTATGATGATACCACTGCACTCTAGCCTAAGAAACAGA
GCAAGATCCTGTCTCAACAAAAAAAAAATATTCTGCCTCTTCCATAATAGTACTGAAGAA
AATTTTTTTTTTATTTCAGCATATTATGGGGGTACAAACGTTAAGGTTACGTATATTGCC
CTTGCCTCCCCTCCCCCCTCGAGTCAGAGCTTCAAGTGTGTCCATCCCCCAGACGGTACG
CATAGCACTCGCTATGTATGTAAATACCCATCCCTTCCTCCCACCTGCCTGACACCGGAT
AAATGTTTTGTTTTGTTTTTTAACATTTTGGTTACATTTTATATTTTTTCCTCTCCCTAG
CAAGGGTTAGAGGTATGCCCTTCGCCTCCATAATGCTCACCACATCCTTGAGATGTGGGA
CTACCCCCCCCATCCCCCGAATCCCTGGTGAACACCTCCACCCTTTGAGCACCATACTGA
TAATCGGTCAGTACCAATTTGATGGCGAGTACATGTGGAGCCCATTCTTCTGATCTTGTG
TCACCTCACTTTGGATAATGGGCTTAAACTCAATCCATGATAATATAAGCAGTGCTAGCT
CGCTGTCATTTCTTAGAATTGAGTAATATTCCATTGTAAATATATACCAAATTTTAATAA
TCCACTCATGAATTGACGGACACTTGGGTTGTTTCCATATCCTTGCAATAGTGAATTGTG
CTGCCATAAACATGAAGAAATGTTTTAATCAAGAGCAAGTTTTCTTTTTTAGAAAAGATA
GTAATGAAATCAAAGTATCCTGTCTTCTTGATTTCTCTATTCTAATATTCAATGAAACAT
AAAGCCTACAAATGTTTCTGGAATTCCTGAATTTTAACCACTTCTTTGCATAATTGATTA
CATTCTGATAAAAATTCTAGTCCATTGAACTTGTAAACTATTATGTAAATGATAGTATTT
ATCAAGACGCTGTGAGGCTCCAGGAAAAGCTGAAGAATTCTCTGCTAAACTTGACCAGGC
CGTGCATATCTAGGCAGGGCCCCAGCTAAGTGAAGGAGGGAGGCCCCGTGTTCCTAGCAC
TGCACCCGGGCTGAGTCCATTGCGAATGTGCGCACTTGAGCAAATCAGTCTCCCTCACCT
CTCACCCCCTCCCCCAACCACACTGACTCTCAGAAATAAAACAGCGAACATCAATTTTCA
GGGCTCTTAAAATGACAGTATTAAAATGCTATCACTGAAGGAACTTTTTGGAAACACTCA
TTGGTAATTACTACATTATGCCATTTAACATCTTGATATCACCCAAAATCCTTCCTTCAG
AAGACATTTGTTCTCTGCTTTTGTTTGTAGATTTGGCAGAATGGCACATTCCTACTGCTG
GAATGTTTTTATGGATTAAAATTAAAGGCATTTCTGATGTTAAACAACTGATTGAAGAGA
AAGCCATTAAAAAAGAGGTAAAATTGGGAGGTGAGGGATGGGGAAGCCTAAAGAAAAGTT
ATATTTTTTCTTTAAGGTCATTTTTTACTTGAATGGAAATGAAAAGAGATGTTTTTTGCT
GCCCACCACTCAACTCATAATGTTCTGATATTAGATATGTTATCTCATTATTAAAATCGT
ACTAGGTTTTTGGGTTACATAATTATTCATCTGGCCTAACTTAATGGAAATGCAGTCATT
AGCATAGTGGCTGAGAGCAGTCCCTGCAGCCCCCTCCTTGAGTTGGAGTCCCAGCTCCTC
GCCTTCCTGGTTGTGTAGCTCTGGGTCAGTCACCCTCCTGGTGCTTCATCTGTAAGATAG
AGACAGTGAGAATCCCTCCCTCATGGTGCTGTGGTAATAAATGGTGTAATACGTGCAGAG
TACTGAGAAAATGCTCAGTGAGTATTAGCCATTAGTATTTAAAATGGAGGGATTTTTTTC
TCTGATTTTGAAAGTACAGTATACTCATGGTAGGAAATTTGAAAAATGCATAAAAGCACA
ATGAAAAAAATTTTAAATACCCCATATTTTCACCACCTAAATTTGTGACCATTTGTGGTA
TAATTTCTTAAAGAGCTTGTACCATTTTTCCCCGAAAATAAGACAGGGTCTTATATTTAT
TTTTCCTCAAGAAGACACCCTATGGGTTATTTACAGGGATGTGTTATTTTCCCCTCAAAG
CCTCGGCTTGCAGCATGCAAAGGATGTCCGGGACCTGACAGGGGGAGCCAACCTTTTTGT
TGGGGCTGCCCGCACCTTTCCACTCACCTCTGGGATAGTAGCTGTCATGATGGGGCAGAT
GAGAAGGGCTGCTTGACTTCTTTACTGCTCGCCACGAAATGCATGGGTTGTGCAGATGCT
CTGCGTAGCCACGCGCATCACTAGGGCTTATTTTCAGGGTAGGGCTTCTATTGCGCAAAT
GCTTAGGAATCCTGCTAGGGCTTATTTTATGGGTAGGTCTTATTTTCAAGGAAACATGGT
ATGTGTTCTGGTGTTGTGGCTGAGCACTTATTTCACATGGTCAACATTACACAGGAAAGT
TTGCTTCCTGATTTTTCACCTAAAATTAGCTCATGAGAATGTCTTCTAGGTTTCTTTTTT
CTTTCTTTTGTATTTATAAATGTATAAGTCTACGTAGTCTTCATATGGGGGCATTGATTA
AGCTTAAAATGCTAAATATTTTTCTGTGTAGCTTTCCAGTTTACCAAGTAAATTTTGCCT
TCTCCATTAATTAATTCCATCATCATGTCTGTCAATCTTGTGTAAACACTGAGGTCTGTT
TCTGGAATGACTTGTCTTGAAGCAGTGAGACAAGTTGGGGAGACAGTGACCAAGTGCTAT
GCTAGTGCCCAGGACACAGGTGCTCTGGAAGGGAGACCTGGAGACGGCCTGTCTGGGCTG
CAGCCCCCGCTCCATACCTGGAGAAAGTCTCTCCACACCTGGGGAAAGTCATCGTCCTCT
CCAGCCACCTCCCTGGAGGGCGGGACTGATGGCGTGTTAATTATTCTAATGCTAGTCCCA
GCATGCAGTGGGTACTTAATAAATATTTAACTACCTTATTTTATAAATACATGTTAGTAT
GACAAATTGAGTTGATACATTCTTGCTTTTCTATCGCTGGCATCATCATCAAAAACATTT
GGTAGGTGGCTGGCTGTGAGTATCTGTGAGCTGGGTGCTGAGGATGCAGACTCCGTGTTT
CACTGCACGTTTCTCTGTTCCCTGCATTTATTCCTCACGTCCTGTCTCATGTGCCTTTGC
CTTGTCCACATAGTCTCCACCTTCATCACAGCACCCTAGCCCAGCTGTAAGCCCAGCTCT
TGTTTATCTTGCAGAGAGATGATTACCATCCTCTCCTCCTCTTACAGCTCCTTCCTTCTA
GTACATAACACAATCTTTGCACCACGGCTTTCATCTCATTATTAATGGGGACAGAGAAAC
CCGCCTTCTGCCTGCAGATCTTTTCCCTAAATCACTTCCCTCCCAGCTCCTCTGGTTTAC
AGTGCAGTGCCCACATTTACACTGTGCAGCAACAGGCAGCTACTCAGTGCTTATGAAGGT
CATCATTGTGCTAGCTAATGCTGCCATGAAAGATAAACTGCAAAATCTCAGAGACTTAAC
ACAATGCAAGTTTATTTCTGACTCCCATAAAACTCAAAGAGGAGACCTGCCGGCAACTCT
GCTCCACCAGTGGTTCAGAGAGCCCGGTTCCTTCCATCTCGTTGCTGTTCAGTCTTCGGC
ACACGGACTCCAAGCTCGTACGGACTGGAAAGAGCCCGTGTAATCTCACAGGGGAAGATC
TTTGTGAGCCAGGCCTAGAAGTAGCACACGCAACTTCAGCAACATCCACTGAGTAGAAGT
CTCTCTCGCGGCCACACAGGACTAGAAAGAGGCCAGGGGATGAGCGTGTCTGTGTGCAGG
ACGAGGAGGTCCTGGAGTCGCAGTCAGCGCGCTGTCTCTGCCACCGTGTCACGAGAACAG
CCGTCGTTCCCACCACCACGTCTTCACCCACTTACTGAGCATTTTTATTCCTTCACTTTC
TGCATTAAATTTTTTTCACCTCCCTTCAGTTGTTCAGATGTACCAATTTTCTTCCCATCG
CAGGGTTTTATACGCCGTATCTTCTCCCTCAAGTACTGTTCTCCATTTTTTGCCTGGCCG
ACACTTTCAGGTCCCAGCTTAAAACTCACTTTCAAACTTGATAACTTAAAAATAGTATCT
TATTGTTTGAATCACTATTACTTTTCTAGTTAAGTTAAACATTTGTTTGTATTTATTACT
ATTTCTGTTTCTTTACTTAGCTGTCATTTGCACATTAAAGCTAGAATTTGAGTGTTTTTC
TTCTCTGTTTCTGTGGATTCCTTATATATCAAGAAGAGATGGCATTTGCCATATTTATTG
AAAACATTTTTCCTGTTTCTATATGTTTAGTGTTTATTGTATAACATACATACTTTTAAT
ATACATTTTTTTTGTTGATTTCTTTAACTGCTTTTATACTTAAAGCATCCTTCCCCACTG
TGAGATTAGGTTTACCTGTATTTTCTTGTAGTTTTTCTTTAATGGCACATTCCTTATTTT
CCACAACCTCTCCTAGGTGTTGATGCTTCCGGGAAATGGCTTCTACGTCGATAGCTCAGC
TCCTAGACCTTACGTGAGAGTGTCCTACTCTTTAGCATCTCCAGAGCAGATGGACGTGGT
GAGTACAGTAGTCTCTTCAAAGTAACAATAGCTATCAGCTGCATATTTTGTCGCATGTAT
TTACGTTGTGAATTAGAACATTATGTAATGCCATTTTATGGTTTCTAAAAACCAGAAATT
AATTGACCAGTCAAGAACTACCATTAGAAGACCAATTTTGCATGAGACTGAGATGGAGTT
AAAGTTTGTTGTCTTCATGAATAATTTCTCAGAACATGCTTAAGAGTCCTGGGAGATTCC
CAACATGTTAGGAGGAAAACCTTTACCATGAGCCAAAAGTACAAATTCATGACAGTCATC
AGTCTCCTTCTCTGAAGAAAAAAGTATCAGCAGGGTCAGGTAGAATGATATCCTTAAATT
AATCACAATCTAGCTTTAAGCAAAATAACAAGAAGCAAAGAAACAGCACCCTAAGGACTG
TTTATCTGGAAATCCAGACAGAAGAGCTGTAAATTGAATAATCCCATAAACATTGAAAAG
AGTTCATAGTCATCCTTGGAGATGGAAATTTTTGTGTGTTCTTTCTTTACTTGCATTCTC
ATGTCGTTGAATATGCTTTTCAAAGTTCCCTCTGCTTTATACATATGAATGGAGTTGGAG
AATTGAAACTATAGAGAATGCATGTGCAGACGAGAGAGTATATGAAAATAGAAGATAATC
TGTGTTGTGGATAAAATAGAAAATGAAAATCTTGAGGGATATACAAACAAAAAGAGAATC
CCTGAAGTCTGATGTACTTCCATCGACATATCTTAGTAGGCATTGATGGCAGCCTGCCCA
GATAATGCTGATGTTAAACTTGACTTTTCACTGCCTTATCTCAACCTCAGGTGGATACTC
TGAATTTTTAAAGGTATGACAGACTTTTCCAATGTAATTGGAATTACATCCTAATTTAAT
TAATTTATAACTCTCTTCTATTTTAGGGATTCAGGATATTAGCCCAACTTATAGAAGAAT
CTTTATGAAGAAATCAAATTAATCACACTGCTCATGGATTTTTCTGATAAAGTTATTTCC
ATATTTTAGCAGGAAGAAATGTTCATTGGTATTGGACTTACAAATTGGATTTCCTCAACT
ATGTCCTATCTACAGTGGTTCAACTAAGGAACTTTTAAAGTGCCTTTAAATCCACCAGAT
TGCCACAATATATTTATAATCCACTTATGCATTTTGATAAATTGCCAATCTGCAAAAATT
ATTTTTATGTATTGTAAAGAATTCTGTAGTTGCTTTATAATTTCCCCTAAATTTTGTTTG
AAACTAATATTTTACACCAAATTATTTTGAAAATTTAAGGAAATAATTAAGTTCAAAATG
GTTTTTCTATTTTAGGAAAATTTAATAAAAGCATGTTGCAAAATTTGTTAACAATTTGAC
CATTATAAATGATTTTTAGTAAGAATACCAGAAGTATTATGTTATGCCACAGAAATCCCT
TTAAAATAAAATTTGAAACTAAACATACCTAAAAGGATCAGACCTGTTAATTCTAAGTAA
GGAGGGGAGATCATGGACTTAAAATTTACTATACTGTATTTACATAATACGGCATAATTT
ATTAAAGCAAATTCTTAATTATGTCAATTAAATCTGATACAACTCTTTGAAGTATTAGGA
TATGCTTTTTATTACTTTTCTTTCTCACCTTTTAAAATCCTTTTTATTTCCTTCTGATTA
TTAAAGTAATATATGTTCATTTTAGAATTTTCAAACAATCCAGAAAATATAAGGAATAAA
GTAAAAGCCACTCACTATCTTGCCCCCCAGTGAGAACTGCTGTCAGCATTTATCTCTGCT
CCTTTGTAATGATTTGCTGTGCATACACATGTAGTACCTAACAGAATGGGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1146, 2462..2594, 5964..6038, 11771..11968, 13638..13703, 23323..23405, 23867..23963, 25192..25253, 26113..26177, 28410..28516, 31636..31737, 32666..32704
1001..1146, 2462..2594, 5964..6038, 11771..11968, 13638..13703, 23323..23405, 23867..23963, 25192..25253, 26113..26177, 28410..28516, 31636..31737, 32666..32704
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved