Microcebus_murinus Locus ENSMICG00000014754
snOPY snoRNA Orthological Gene Database
Microcebus_murinus ENSMICG00000014754
Microcebus_murinus
ENSMICG00000014754
scaffold_1811
SNORD102, SNORA27
1511..1581, 1835..1960
4403
TGCCCGGGCTAGAGTGCTGTGTGGTCAGCCTAGTTCACAGCAACCTCAAACTCCTGGGT
TCAAGCGATCCTCCTGCCTCAGCCTCCTGGAGTAGCCCAGGACTAATAGGGCATGTGCCA
CCATGCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNATTATTGGCTTTCTGTTTAAAGGAGCAAATGGCAATTTTCAATTG
TATTTGACTGTCACACTTTCTGGTTTCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
AGAGGAGAGGCACCCGATACATGTTCTCTAGGCCTTTTAGAAAACATGGTAAGTAGGTCT
ACCTACTTGAGAGCAAGCATGGCACACATTTGTGTTTTATTAATATATCAAGCAGAAATT
TAATATAGTAGTTTTTGTAACTAAATATCAGTGCAGGATTAAACTTTGAATAGAGATGTG
TGATTCAGTAGACTGATTTTGCTTTCAGGAGAAATTGTCCATTAACAAGATTTTAAAATG
TACGTAATTGTCAAGAGCGTTGCATGTGTTGAAAGCTCATTGCATTTCTTTTGCTCTGGA
TGTTGATACTGACTAAACCAAATTATTTTATTTTGCAGGAGTTGTTCCTTTGGCCACATA
CATGCGAATCTACAAGAAAGGTGATATTGTAGACATCAAGGTAAATTATAACATTGGGAA
AATAACACTACAGAATTTAGAGAAGTTGGATTTAATCTAGTATAGAAGTTCAGTGTATCC
TGGCACTCAAGAGCTTAATGATGATTATCTTTTTGATTGCTCGAAGCAAAGTGAAAAACA
CATTTCACCGGCTCTGAAAGCTCTTTGAGTTGCCATTTAAAAGAAATCTTAGACTGTCTT
AGTTTAATAAAAGAGTTTAAAATGAAGGGGAAATGCTAATATAACATTTGTCTCCTTAAC
AGGGAATGGGTACTGTTCAAAAAGGCATGCCCCACAAATGTTACCATGGCAAAACTGGAA
GAGTCTACAACGTTACACAGCATGCTGTTGGAATTGTTGTAAATAAACAAGTTAAGTAAG
TAATGTAGTTCTCGTGGCTAGTTGGTATTCCTTTGTACCCCCTTTTCACTTTGCCAATCG
GACTTATGTCTTTATTGGTCATTCAAGTGGGGCAAAGGAAATATCCTTTTAAAACTCAGG
CAAACTGGTGTTTGTCTTGTATCCTGTCAAAGGAAACAAATGGAAATAGACTTAACTGCA
AAGCCTTAGACAGTATGATATTAAGCAGTTTTCATGTAAAAAAAAATGTAATCTTTAAAT
TTTATTAGTGATCTGGTTTTGGTTAAATTACTGTTGTTTCAAAGGGTATTCCCTCTGGCC
GGGTGTGGTGGCTCACGCCTGTAATCCTAGCACTGGGAAACCGAGGCGGGCGGATTGCTT
GAGGTCAGGAGTTCAAAACTAGCCTGAACAAGAGCGAGACCCCATCTTGGCCAACTAATA
TATAGAGAAAAAATTAGCTGGGCATGGTGGCGTATGCCTATGGTCCAAGGTACTCGGGAG
GCTGAGGCAGTAGGATTGCTTGAGCTCAGGAGTTTGAGGTTGCTGTGAGCTAGGCTGACG
CCACAGCACTCTAATCTGGGCAACAAAGCGAGACTCTGTCTCAAAAAAAGGGGGGAATAT
CACCTCATCAGAACAGAGCTTAAAAGTAGGAATGTTCTCAAGGCCTCTTCCAGTAAGATT
AATAATTGATCGTAAATTAAGTACTCAGGCTGCCACCTTGTTGATTATCGTATCTGGGTA
AAAGGCTCATGATTTATTTAGTGAGTGATACTGCCAAAACAGTTTTTTGCAATTTTGTTA
TATTTTTGATGAAGCACTTAAAAGAATTTCTGCTCTCTCCAGGGGCAAGATTCTTGCCAA
GAGGATTAATGTACGTATCGAGCACATTAAGCACTCTAAGAGCCGAGATAGCTTCCTGAA
GCGTGTGAAGGAAAATGATCAGAAAAAGAAGGAAGCCAAAGAGAAAGGTACCTGGGTTCA
ACTGAAGCGACAGGTGAGAACTTGACCTGATGATTTCTTAATTTAACTTTTTTTTTTTTT
TTTTTTTTTAAGAAGGAGTAGGGGGTTGGGGGTTGTGAGGAGGGGTGCTCAGTTGCCTAG
TTTGTTTTTCTTGAGACAGTCTCACTCCCTGCCCTGGGTAGAGTGCAGTGGTGCCATTGT
CACTGCAACCTCTGTCTCCCAGGCTCCACAACATCCTGCCTCAGCCTCCCTGGTAGCTGG
GCCTGTAGGCTCAATGCCTGCTGGGTTTTGTTTTTTTTTTCCCTTCCTTTTCTTTCTAGT
AGAAACGGAGATCTCACCTCTTGCTCAGGCTAGTCTCGAACTTGAGAGCTCGAGCAGTCC
TCCTGCCTTGGCCTCCCAGAGTGCTAGGATTACAGGCTTGAGCCACTACACCCAAGCCTT
GAAACTGTTGGTCCCTGATATTTCCCCTTGTATGAAGTTTAAGAATTGAGTGTAATTTCA
TTGATCTGAGAACACTTTTAAAGTTGAATTTTAATACTTTACATAATTAGTTTATTCCCT
TTTTTCTTTAATAGCCTGCTCCACCCAGAGAAGCACACTTTGTGAGAACCAATGGAAAGG
AGCCCGAGCTGCTGGAACCTATTCCTTATGAATTCATGGCATAATAGGTGCTTCACACTT
TGTGAGAAGCGACAGAAAGGAGCCTGCGGTGTTGGGACCTGTTCCCTGTGAATTCATGGC
GTAATAGGTATAGCACACCTGTGAGAAGCAAAGAAAGGACCTTGAGCTGCCAGAATCTAT
TCCCTATGAATTCATGGTATAGGAGACAAACCTAATAAAAGCCGCTGGACTCTAAAAATG
TTTCTCTTCATTGTGTAGAAGTGTGGTGGCCCCTTCCCCAAAGAAATATTTAAAGCAAAT
TTTAATTGTGTACTAATTTATTCATTGTGTAATGTCTTTATTATGCAAATTTAGGGTGTA
CCTTGTTGAAAGGTATGAGATGGCTTTTTGTTTTAATCTTTTTTATTTTTAGTTGTCCAG
CTAATTGTTTTTAGTAGAGACGAGGTCTCCCTCTTGCTCAGGCTGGTCTCAAACTCCTGA
GCTCAAATGATCCACCCACCTTGGCCTCGCAGAGTGCTAGGATTGCAGGCGTGAGCCACC
ACACCTGGCCTGAGGTGGCTTATTGTGCAACAAAATAAGTGGGAAGGTTATCTATTGCAT
TTCAGGTAAGCTTGAGGAAAGTTGGTTCCCATAATTGTATCATAATTTGAATAGCTAGTT
TAAGGATCTAGAGTTCGCCTTTGAAGCCTACTAATTAAGAGTGGATTGTTTAGAGCACCC
TATTCTCTGAATTACATACCAGTTTAGAATTGCTTTGGGCATTCATGAAATGGGGCTCAG
AAAACAGTAGTGTGATGGCATTTGTCATAGGCCATTTATCCTGCTGTGACAAATTGCCAC
AGACTTGGGTAAACAATAGGAATTTATTTCTCATTTTTCTGAAGGCAAGGGGCTGGCAGG
TTTGGCAACTGATGAGGGCCTGGTTTGTGCTTCAAAAGTGGTTCCTAGTTACTATATAGT
ATCCAACGTGAGCATTGATTCCTTTTCCCTCAGGTGGGAGGGGCCTCTGCTAGTTCGCTC
CAGCTGTATTATAAGGCACTAGTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1067, 1358..1419, 1682..1794, 2622..2772, 3314..3403
1001..1067, 1358..1419, 1682..1794, 2622..2772, 3314..3400
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved