Microcebus_murinus Locus RPS11
snOPY snoRNA Orthological Gene Database
Microcebus_murinus RPS11
Microcebus_murinus
RPS11
scaffold_21344
SNORD35
2193..2280
5315
TGGTGGCACCCACCTATAAGTTCCAGCTACTGGGGAGGCTGAGGCAGGAGGATTGTTTG
GTCCCAGGAGTTTGAGGCTGCTGTGAGCTATGATGACGCCACAGCACTCCAGCCCAAGCA
ACAGAGCGAGACCTTGTCTTTAAATAGATAATTCTTAAAAAGAATATACAAAATAATTAA
GTTATAGACTTGCGCTATTCAACACAGTGCCACTTATGGCTATTTAAAATTAAAAGTTGA
AAATTCAGGTCCTCAATTGCAAAAGCTACACTCCAAGTGCCCGTTGCTACCCCGTCGGAC
AGCGGAGAGGTAGAACATTTCCATCGTAGCGAAAAGTTCTGTCAGACAGCCCTGTCATAG
ACAGAAAAATAGAAGGATGAAATGGGAAATAAGAGAAGACTATCGAGACCAGCCTGAGCA
AGAGCGAGACCCAGTCTCTACTAAAAAAACAAAAGAGAGAGAGAGAGTGAGAGAGAGAGA
GAAAAGAGAAGACTAATTTTCCTTAAACTTCTAAAATCTGGCGGCAGCACACGCCCCTCA
CAAAGATGGCGGCGGCGCTGCACATGCTCCTGGGTCCCTCTGGTCTCCCGCCCTACAGAA
AAATGGCCGCCGCCGCATGCGGGGTGAAGGCTGAAGGAACGCAGCCACGCGGTTCCCAAA
TCCCACAGGAATCCACGCCCCGCAGAAACATGAGAGCGTCCCAACGACTCTCGCGATAAT
ACAAGTGGTCTCAAGGCTGGCCACGCGTTTCCGACTGAATCCCGGCCGATGAAATAATGG
TTTCAGACTCTCGCGAGATAGTGTCCACCGCTGAGCTCCCGTCAGTCCTTCACTGCCAGC
GCCGCGTCTGTTAGGGCCGCCTGTCAATCAAAGCCTCATTCGAGGCCCCGCCCAAAGCCG
CGCTAACCCGCCCCTTCCGTCACTTCCTCTCCAGCCCCTGCGCAGTCGATAAGGAAACCC
GGGCGCCGCCTCCGCTTTCTTTTCTCCAGGCGGCCGGAAAGATGGCGGACATTCAGGTGC
GGGTTCGGGGCTGGTACTGAGGCTTCAGGGTCTCCCCCGGGCTTCAGAGGCGCCTCTGGG
GGAGTAGGACCCCAGACCCCAGTTTGGGGGCTAATTCTTCGGTTTCCTAGGGAATCACTG
GGGCGGAAGGGCTTGTGCTTTGTGTTAATCTAGATTCGCGCTTCCTAAATCCTGGGAGCT
CCGTACGTTAATGGAGGCTCAGGCGTTTAGGAGTTAATCTTAAGATCCACGGTTTAAGAG
GTGATTTTTTTTTTGGTGGTGGTCTCAGGTCTTAAAGGTTAATCCTGTGGGAACGTGAGT
TGTAAGGGCGAAGCTAGGGAGCTTGTTGTATTCAATTCTGAGTCCTCATGTATTAGATAA
GGAGTGAATCCTGAGTGAGTGACCTCGTGTCTTGGAGAGTAGTCCTTGCTGCAAGGTGCG
CAGGGTGTTTGAGGAACGAATGTGGTTTAAAGGATGAATCTTTCCGACGGTGCAAGGTGT
TCTAGAACATACAAACTGTAATAACTCCGCGTTTAGAGCAGAATCATAGGCAAATGCGGG
GTGGTGATGTCGTCTTAGAGGGTCGTTCTCGGGCACTGGGCCTTGGAGGCCACCGTATCA
GAGTAAATGGTGTGCAGTATGGGGTCAGGGAGGATCCGGGAAGATCTCCAGACCACGTAG
CTGCCTTCTCCGAACTTACCAGCTCCCTCTTCATCCCTGTAGACAGAACGTGCCTACCAA
AAGCAGCCGACCATCTTCCAAAACAAGAAGAGGGTCCTGCTGGGAGAAACTGGCAAGGAG
AAGCTCCCTCGGTACTACAAGAACATCGGTCTGGGCTTCAAGACTCCCAAAGAGGTGCTG
GGACACTCAGAAGAAAGAATGGGATCACTGTGTCCCTACACATGTGCCCAAGCAGAGAGT
TTCTCTGCCCCCATCTGAGTGGCTTTCCTGGGGACTGCTGGGAATTGTAGTTTGTTTCCC
TGAGACCACGCCCCCAGTTCTTTTCAGGCACCGGCTCACCCTTGTTTTTCTCATCTCTTC
AGGCCATTGAGGGCACCTACATTGACAAGAAATGCCCCTTCACTGGTAACGTCTCCATCC
GAGGGCGAATCCTGTCTGGTGAGTGAGGAGTTCTGGGGTCCTGGGTGAGGGAAGGGGTGG
GAAATGCAAACTTTTGGGTCTAGGGACACTGGTGGCAGATGATGTCTGTTTTCACGATGG
TCTTCAGATGCCCACCACGGGCACTGCTGAGGAAGCCACTTGGTAAAACTGATGCCAGCA
ACTGGGTTTCTTGGGGTCCCCACTTTAGCAGCTTCTGATTCTCAACATGCCCTGGGTTAT
CCTGGCTCTCTTTCTTGTGGGGTCTGACCCATGATCTGTCTCTTCCCAGGTGTGGTGACC
AAGATGAAGATGCAGAGAACCATTGTCATCCGCCGAGACTATCTCCACTACATCCGCAAG
TACAATCGCTTTGAGAAGCGCCACAAGAACATGTCTGTGCACCTGTCCCCCTGCTTCAGG
TGAGCACAGTAGCCCCTCGGGTAGCCCAAGCCACCCTCCCAGCCTTCATTTTCCAGATTT
GGAGGCCAGCTGAAGGAGTAACTGGGGTGGCATTTCTTGCAAGCCCCCAGAATCCTGGGG
TTTTTATATATCACGTGTTCCTCAGAGTCAATGTTCTACAGTTGACTATCTTTTGTTTTG
TTTTGTGTTTTCGTAAATTTTTTTTCTTTTATATTATTTGTTCATTTTTCTGTCCTGGAA
CAGTTGAGTATCTCTTATCGGAAAGGCTTGGGAACCGTGTTTCCAATTTTTTAGGATTTT
CAAATGTTTGCATATACATAATGAGATATCTTGGGGATGGAACCTAAATCTAAATATGAA
GTTCATTTATGTTTCATGTACACCTTATACATATAGTCTGGAGATAATTTCATACAATGT
GGGATTTTTTTTTATTTTTAAATTTTTCAGTAGATTTGGAGATACAAATAGTTTTTGGTT
ACATTGCAGAATTGTATCATGGCGATGTATGGGTTTTTGATGTACCCATCACTTGAATAG
TGCATATTGCATCTGATTGAAAGTTTTTCTTCCCTCACCCCATCCTCCCCTCACCCCTTC
TAAGCCTGCAAAGTCCTTTATACTACTTTATGCCCTTTAATTGACTTTTTTTGTGTTTTT
ATTTTTCTTTTTTTGAGACAGAGTCTCACTCTGTTGCCCAGGCCAGAGTGCCGTGGCATT
AGCCTAGCTCACAGCAACCTCAACTCCTGGGCTCAAGTGATCCTCCTGCCTCAGCCTCCC
GAGTAGCTGGGACTACAGGCATGTGTCACCATGCCCAGCTAATTTTTTCTACATATTTTT
AGTTGGCCAATTAGTTTCTTTCTATTTTTAGTAGAGACAGGGTCTTGCTCTTGCTCAGGC
TGATTTTAAACTCCTAACCTCAAGCAATCTGCCCGCCTTGGTTAAATGATGTTTTCAATA
ATTTTGTACATGAAACGAATTCGTTTCCATTAAACCGTCAGAAAGCAAAGCTGTCGTGTC
AGTACTCAAAAAGTTTCAGAATCTGGATTTTCAGACTAGGGATGCTCACCCTGTAGGAGT
CAGAAGTCTTGGAACCCAAAGATTAGAGTATCTTATACTAGATGGGAACCTCAGAAATGA
TTAAAACTAAATGCCTGTTTGTTCGGCATGTTTCGTATTACTCACTGCTAGGCCTGCTGT
TAGACACTGGGGCTTCAGTGGTAAGCAAGGGGCACAGTGCTGCTCCCCAAGAGCAGGGAA
CATCTAGCAGGGAGGTTGCCCAACAGTGGGCCAAATGGAAACGTGCTGGGTGATGGGACA
GCTGATGGGCCGCATAGGGGACTTGGGATCAAGATGGGGAGTTGTATGGGCAGAGCAGCA
GGGTGGCCTAAACTGATTCTGATAAGGGACCTGACGTGCTAGGGCTGCTAGCACGGGGGG
AGGGAGTGAGGAGGCTGGGAACCATCCTTGGGAGCCTCCAAGCCTGCTCTGTGTCTACAG
CCTTGAGCTCAGTGCCTTGCACATACTTTGTGCTCAATAAATGACAAGCAACTGGAGCGT
GGTTGGAGTTTGAAGCCAAAGCAGGGAGCCCTCAGTCTGGTGAAGGGAGGGTCTCCCAGG
GGTCTGCTGGGGTGGCCCCTCCTGAGGACACAGCCCCTACCTGTCTCCACAGGGACGTCC
AGATTGGCGACATTGTCACAGTGGGCGAGTGCCGGCCCCTGAGCAAGACGGTGCGCTTCA
ACGTGCTCAAGGTCACCAAGGCTGCCGGCACCAAGAAGCAGTTCCAGAAGTTCTGAGACT
GGATATCTGCCCACTCCCCAAAACGAAATAAAGTTATTTTCTCATTCATAGGCCAGATGT
GGGATCTCTGGACCTTTACCAGAGGGAGCGGTTGTCCCTGGGCATTGAGCAGGGCTGAGT
GGAAGAGGAGGCTCTCATCCTCTGGGGGAGCAGGGATGGGAACAGGCCCCAGTTCCTTCC
TTCTGTCTGCCCTCATCTCTGGGTGATGACAGTGCAAACGGAATTAAGATGGTGCCCCTC
TCTTTGGGTCTCCTTTTTTGGTCCATGTCACCTTGGTGTCTGAATAAGGCTGATCTACCT
GGTGTTGCACTGTTCCTCCACCCCCCAAATCTCTGGGGAGGAAGTGAGTGAGGGCGGAAC
CCCCTGGGTCCCAGGCTCTGGTCTAGACCCTGGCCTCCCTGGGTGGGGAGGGAGGAAGCA
GCAGCGACCCGTGTTGTGGGTCGTGGGCCATACTTAGCTCACTATAGTCAGGTGGGCTTG
ATGCGTTCTCAGCGTCTTGACTTCATCCTGGGCCTCCTGTTCCCCTGACAGCCAAGGAGT
GGGGCCGGGACACCAAGCAGGCTATCATACCCATTTACAGATGAGGGAACACCTAGGAGG
GGGCACATGCTCCTCCCAGAGTCCCATGAGAAGCTGAGTTCCAGGTCTCAGCTGGAAACT
TAACTGCATGCCTGCCTCAAAAATCTCAGTAAGGAAATTGGTATTGCGGGCAGGTGGCAT
AGTGAGGCCAAGTAGGAGCCAGTCTGGAAGCCACCCCTGCAGTGCCTGGGGTGTGCTGCT
CAGGAATGGGCAGGAGGCCCCCAGGGTTGAGCTGACGCACACAAGCTGGAGAGGTGGGGG
ACTTGAGAAGAGGGGACGGGCTGACTCTGGCAGGGGGCCCTTGAGTGTCACCTGCAGAGT
TAGGCAGTCTGGGCACAAGGAGAGGCAGGTACCATAGAAACAGGTGAGCCCTGGGCATCA
TACCCAGGTGGGATGAGGATGACAAGAGGGGTGACA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 1722..1853, 2042..2117, 2389..2518, 4192..4315
1001..1015, 1722..1853, 2042..2117, 2389..2518, 4192..4312
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved