Microcebus_murinus Locus ENSMICG00000012828
snOPY snoRNA Orthological Gene Database
Microcebus_murinus ENSMICG00000012828
Microcebus_murinus
ENSMICG00000012828
scaffold_6840
SNORA11
5656..5786
8081
TCCGGGCTGCTGTGCTGGCAGCAGTAGGCGAGGGCGCGGCTGCGGGGTTCCCGGTGCTG
AGCACGGACGCCATTGGAGCCCCGGGGAAGGTAAGGATCCAGCCCCAGAGAGGGCCGGGA
GAGGACGAGTGGAACCCGACTCGCTGCGCCCTCCTCCCTCCTCCGGATCTGAACAAAGCC
CAAGCACTCAGAACCGGAACCACATTGGACCCAAGGTCTAGATGGGAGCACCCCCTCCCA
TCACCGTCAGTCGCAGGCGCTCGGATCCGAGCTCCTTTTACTGGGGAACCCCCGACCTGA
ACCCCTGTAGCAGCCCAGTGTGTTCTGTCCCAGCTGCGCTTACTCAGCGCGGAGGCCCCA
CCACTCCTAAATTACTCCAGCTGAGCTGACCGCTGGCCCCCTTCCTGGAGTGCCAGTCCT
TGGATGTCAGAGCTCCGGCGCTCCTACTGGAGCCTCACCTAGGTCCGAGGCCCCCACGCC
ATCCACCCCTAGCGCTCCAGCATGAGCCCTGCCTCGGGGAATCAGCTGAATCCCTCCTCC
CAGACCTGGCCAAAAGGTCCCTGGGATTCAGTTTCCCAGAGCTTGCTGCCGTCCCTGTTT
TCTGAGCCCTCCCGTGTGCTTCCCTCTCATCCTGGTGCCCTGCTCCTGCCCTTAAATTCA
AGCCCTTTGTTTCCGCCTCTCTCACTGCATCCTCTTTGGGACTCTTGGGACCCCAGCCCT
CAAGGACACCCGCTATCCAAATCCAGCCGCTGGGACGTGGAGCCTGACATGCTAAACTCC
CTATTCAGTGCGAGGTCTATCGCTTTCCTAGGGCTCTGTCCCTGACCAATTGTCCCCCAT
CAGACACTGCCACCCCCTTGTACTGCCTACTGCCTAGTAACCTCATGATTGTCGCCCCTC
ACCTCCCTAGAGATCCCAGCTCCCACTGGCTCCCGCCCCTCCCCCTGCAGCTGCCTCCCC
TCCCCTCTCAGGCTGAGCTCTCTCTCCCTGGGACCTGCAGCATGGCTGAGGGAAGCTACA
GCGTGGAATCGGAAAACCACAGTGTCGAAGACATGGATGAGGGGAGCCACGAAGTCAGGG
AGGGAGGGATGGCAGAAGGCAACGACTATGAAGAATTTGGTGCTTTCGGTGGCTATGGCA
CCTTCACCAGCTTTGACATCCACATCCTCAGAGCCTTCGGCAGCTTGGGTCCAGGCCTTC
GCATCTTAGCGGTGAGGCCCGCCCTTGGCCGCCTGCTTGGCTGGGCCTTTTCCCCTGTGA
AGGGTTGAGGGGGATTGGATGAAGGGGAGGGTGGAGTGGGAGAGGACTGCCCAGCTTCTC
CAAACCTTCCTTCTCCTGCTCGGAGGAGGAAGGGGGTTTCGGAAGTTCTTGGGGTGCTCA
GGACTGGCTGCCGGGGTTGGGGGGGGGGGCCGGCCGGCCCAGGGCAACATCACGCAAGTG
CGTAGAGTGGTCTGCCTTCCCTACCTGTCTCTCTGGCCTTGCAGAATGAGCCCTGGGAAC
TGGAAAACCCTGTGCTGGCCCAGACCCTCGTGGAGGCTTTGCAGCTGGATCCGGAAACAC
TTGCCAATGAGACGGCCGCCCGTGCTGCCAACGTAGCCCGCTCTGCCGCCTCCAACCGTG
CGGCTCGGGCTGCCGCTCGTGCCGCCGCCGCAGCTGCTCGTGCCTCCTTCAACCAGGTGG
TCACTGACCACCGGGTGGCCACACCTCAGGCCTCGGGAGACAATGCCCAGCCCACGATCT
ACACCGAGGCTCAGGGGGCCACCCCTGAGACACCCTTGGCTTCTCCACAGATCTCCCAGA
TGTTTGTCACCCGTGAGGTGGCTGTCCATGGGGCTCCAGCAATGTCCACGCAGTCCCAGA
CAGCCTCTGTGGCCCAGGAGGCTGCTACCGAGGGCCCTAGTACTGCCTGTGCTTTCTCTC
AGGCCCCACGTGCCAGTGAGGTGGATGCCACCGGGCCCAAGACAGCATTTCTGGGCCAGA
ACGATGTCTTTGATTTCACTCAGCCGGCAGGTGTCAGTGGCATGGCCTTTCCACGCCCCA
AGAGACCTGCCCCGGTCCAGGAGGCTGCCACAGAGGGCCCCAGTGCTGCCTCCGGTGTGC
CCCGGGCTGCACCTGCCAGGGAGGCAGCAGCCACCCGGCCCAAGGCGGCCAAGTCTGGGA
AGGCTTTGGCCAAGACTCGGTGGGTGGAGCCTCAGAATCTTGTGGCAGCAGCTGCTGCCA
AGGCCAAGATGGCCACAAGCATCCCTGAGCCCGAGGGTGCAGCTGCCACTGCTCATCACA
GTGCCGAGCCCTGGACCAGGATGGGAGGCAAGAGGACAAAGAAGGTGAGATCTCCCTGCC
ATCTCCACACCCCCGTGCTCCCCTCCTTTCCCTCTTCTACCCCGCCCTCCCCTCCTGTCC
CCTCCGCTCGGCTGTGTTTCTTCAACACAAGTTTTCTGAGCATGTTTTTACCCCACAGAG
TTCCTACCCTCAGGACTGGTGGGAAAAGAGGCTGGCTCGGTGCCCAGCTGTTAGTACACA
CGCGGCACAGCACGTGTCAGCCGCTGCCCGTCCTGCTCTTATTTGCACGTACCTGCTACG
GGGAAGGTGTGTGGCTTTGGCTCGGCAAGCCTGATAGCCCTGGGTCTCCGCTCTGATTCC
ACAGTCCAAGCACCTGGATGATGAATATGACAGTTGTGAGGAGGAGAGAGAGCCTCCTAC
AGTCCCACAGACCTGGAGAGCATCGCAGCCCTCGGTGACGGTGCAGGCTCAGTTGGCCCC
TCGGCCCCCGATGGCCCCGAGGTCCCAAATACCCTCAAGGCACGTACTGTGCTTGCCCCC
CCGCAACGTGACCCTTCTGCAAGAGAGGGTAAGAAGTCTGCCCTCCCCCATCTCCCTCCT
CTCCTCTCTTGGGGGCCACTTCTGTGCAGTCACCTGTGCCTCGCTTTTCCCATGTGTCTC
TCCTTCTGCAGGCAAATAAGTTGGTGAAATACCTGATGATTAAGGACTACAAGAAGATTC
CCATTAAGCGCTCAGGTAGGCAGCCCATGGCCCCTCGCGAGCCTCTACTCTGCGGCTATG
CCCCAAACCAGCAGGCTGCAGGTGGTCCCTCCAGTGTCACAGAACAGGGTCCTGGCTGTG
CCACCCTCTGCAGGGCTGACCAAGCGGCTGCAGCTCTGTGGCCCCTGCTCAGCCCACGTG
CTTGCTCCAACTGCCCCCTCCCGCAGACATGCTGAAGGACGTCATCCGAGAATATGATGA
ACATTTCCCTGAGATCATTGAACGAGCAACATACACTCTGGAAAAGGTGAGTGCGGGTGG
GAGCAGCTCTGTGGAATAAGACTGGGGGGTGGCGGGGCGTGCAGCCCCTCGGGGCAGTGT
CAGTACCGCCTGTTCAGGAGCCTTCCTTGCCTCTTCACCTTGGCGCTTCCACTGCACTGG
GGGGCTCTCCCTGTGCCTCCTGCCCTCCCTGTCCTCTCTTGTGCTCTCCGAGTATCGAGT
ATCTCCTTGTCTGCTGAGGTGGGTCTCGCTGCCTCTGCCAGTGCCAAGGCTCTCACAGGG
CGGGTCTGCCGGGTCCTCTCCGCTTCTACCCTCGCCCATCAGTTTGGATTCCCCGCTGAG
GAGGTTCTAACCAGGAAGTGACTGCCTGCCTGCAAGGTGCCCAGCATGGGGTTTGATCTC
ACCCCCTCCCCCACCACCGTTGTCTCCCCTGTGCAGAAGTTTGGGATCCACCTGAAGGAG
ATCGACAAGGAGGAACACCTGTATATCCTGATCTGCACACAGGATTCCTCAGCTCGCCTC
CTTGGAAAGTAAGAAAGGGAAGGAGGGCTGTGGCTTTCCTGGGTGGTGCCCACTCCCGGC
CCACATCCCCTCGAGAAGCGGGAACATGGGGCTTGAGCGCCAAGTACGGCTCCCACACGG
TTGTGACTACTGGATGTAAGGGACAGTAGCCTGGGGTGAGGCCTTGCTGCAGTCGAGGTC
TCCCCAGGCTGCTGCTGGGGTTTCCCCCCAAGCTTCCAAGGAAAGCACCTTGCCTGTCCC
TACTGCCTGCCCAGCTTGGCAGGGGCCTCGGGGAGAGCTGCCCGTCACGTGTCCATCCTG
ATGCGGGCCGGGCAGCCCCACGATCCGGATATACCTGTGGACACAGCTTTGCGTTTTGCC
CTTTGCCGGGCATCTGCTCCCTGCCTCACCCTGTCCTCTGCGGAGCCCTGGCAGGGAAGG
ACTAGTGTCCATGTTTTATGGAGGAGGTGATTAGGTCTCAGGCAGAGGTATGAACCGGCT
GGGAGGTGAGTGAGCTGCGCCCATTGCTGGGAAGAATTCCCCTGGCGCTGGGGCGTGTGG
GAGAGGCTAGGAGGGTGAGCCGGCTGTCCTGTCTCAGCCAAGTGGCTGCTGGACAGGATC
CCATTTTCTTCACCTTTAGGACCAAGGACACTCCCAGGCTGAGTCTCCTCTTGGTGATTC
TGGGCATCATCTTCATGAATGGCAACCGTGCCAGCGAGGGTGAGTGCTGGGCCTGCAGCT
GGGGGCTTGCCCAGAGTCTCTCCCTCGGGTGCCAATCTCTCCTACCTCCCCTCCCCTTGC
AGCCGTCCTCTGGGAGGCGCTACGCAAGATGGGACTGCGCCCCGGGTAAGACTGGGCTCT
CCCAGATCCTCCCCTCAGTGCTGTCCTCTGGCAAAAGGGGTCCCGGATTGCCATAGCCTG
GTGGTCTGGTGCAGGGGAGTGAGGCTCCCCAGACTAGGTGGAGGGCAAAGGGTCTTGCCA
GGATGGATGGGGGAATGGTGCCACTCTTAGCCACCTCTCTGCTCTACGTCTCCAGATGAG
AGGTAAGAGAGGCGGTCGGAGTTAGGAGCTGCATCACACCTTACTGGGGCATCCATGGCG
AGCAGTCATTTGGCCTCTGCTGCATGCCCAGGCCCTGTGGTGATGCCCTGTGAGCTGGGA
AGTTCCTAATGCTGCCAGGGAGTGCCCCTGCCCTCATGCAGGGGTCAGGCACTGCCACCA
TCTCTACTCATGGATTCCTGTCCTTGCCTTCAGGGTGAGGCACCCATTCCTTGGTGACCT
GAGGAAACTCATCACAGATGAATTTGTGAAGCAGAAGTGAGTATCGAGAAAGCTCACGTC
CTCGCACATTGAGGTGCTCCTTGCGTGCAGGAGTGTGGCTGAGGGGGCCTTCCCCTGTCC
CAAACCTTAAACTAGAGGGATGGGCATCTCTGGCATGGGCAGGGGTGGGGGTCAGCACGT
GTGAGCATGTGGGGAGTAGAGCGCTGGGGCAGTCTTGGGGAAAGGGAGCTCATGGTGACT
GAGAACACAGCGCAGGGTGTGCTAAAACCCCCATCTCATCGAGCACCTGCCCTGTAGGCC
ATGATGAGACTGTCCAGTTTTACCTCTGAAGAGCCTCAGGCTCAGAGAGGGGAGTTCTGT
GATCACAGCCTGCAGCTGGTCAGGGCCCAGGCCAGCTGTCCTGCCTTTCAGGCCAGGGCC
CACCCCGTCCTTGGTCCTTGGAGGTCATGGGAAATTCACACAGCCACATGCGGTCACACA
TGCATGCATACACACACACAGAAGGGAATCAGGTGTGGGCATGGAACACGCCACTCGTGG
CTGAGTGTTCCCTGCCCGTTGTTTTCCGTGGTGGGTGTTTCCAGGGCTGGCCAGGTGGTG
GTCGAAACCCTCGCAGTGGGTGTGCTCAGAGCAGGGGGCCTGAAGAATGGCTCCTCCGTT
TACAACGCACCCGACATGAACTTGGGGTCATTGTGACGAGGGGCACGGAACACTTGTGGC
CTTCCTATGAACAAATGCCCTGCACGTGTCCCCCCTGCCCTCCCCACATGGCTTCCGGGC
AGGACCAGTGGCATGAAGCTTTGCGGGCCTGCCTGTCGCAGGCATAAGTGCTGGGAGTTT
GTGAGCACCTGGGGGTCTGGAGGCGTGGGGCAGGCCTGTCGCAGGGGCTGAGCTGCAGCA
CTGGGGTCGAGGAGGGGCCCATGGAACCCATCAGTTCAACATCAGGTCTGCTGGGCTAGA
CACAAAGCTTCTTTCCTCCCACACTAAGGTACCTGGAATACAAGAAGATCCCCAACAGCA
GCCCCCCTGAGTACGAGTTCCTGTGGGGCCTGCGAGCCCGCCATGAGACCAGCAAGATGC
GGGTGCTGAGATTCATCGCCCAGGTAACGGAGGCCTCGTTTCTTGGTCGCGGCTTCCTTG
TTATATTGTGTTTCCAGTGGGAGTGCCAAGGCTCAGAGAAGTCCCTGAGCACCTTACGCC
AGGTCACAAGCATCGTCCGCCTGAGGGATGGGGTGACATCCCAGGTGTGGCACAGAATAG
TGGGAGCCTGATTCCTGTCATCTGCATTTTGATCGTCCACACCCAAGCGCACGGGAGGAG
GGTGTGAGGTGGGAGGTGGGCGCTCAGTGGGGCTGGGGCAGCTCCCCACATTGTCAGGGT
TGCTGTTTCCACCTCAGAATCAGAACCGAGACCCCCGGGAATGGAAGGCTCATTTCCTGG
AAGCTGTGGATGATGCTTTCAAGACTATGGATGTGGACATGGCTGAGGAACATGCCAGGG
CCCAGATGAGGGCCCAGATGAACATCGGGGATGAAGCTCTGATTGGACGGTGGAGCTGGG
ATGACATCCAGGCTGAGCTCCTGACCTGGGATGAGGATGGAGATTTTGGCGACGCCTGGG
CCAGGATCCCTTTTGCTTTCTGGGCCAGATACCATCAGTACATTCTGAATAGCAACCGTG
CCAACAGGAGGGCCACTTGGAGAGCTGGTGTCAGCAGTGGCACCAACGGTGGGGCCAGCA
CCAGCGTCCTAGATGGCCCCAGCACCAGCTCCACCATCCGGACCCGAAATGCGGCCAGGA
TTGGCGCCAGCTTCTTCTCCTGGATCCAGTAAGAGTTTCGGTAGATAAAGGAGAGGGCCT
CTGCGGGAAGACTGTGCAGGGGCTGTGAGATGGCAGAGGGAGGCCGTGGGGGTGGATGTG
GTGGGGGCAATGGTGTGAGTGTGGAAGGATGCTTGTTTTCTGATTTCTCTCCTTCCCTGG
TGAATGCGTGTTTCCCTTAGATGTTCCCACTTTCATTCCCTGTGCTTCCAGACACCGCTG
AAAGAGCTGCAGCAGTCTTACGCACCCAGCCAGGGTGCCTCCTCAGAGTCCTTCTGGACA
CAGCACCCCAGGTGGCTTCTATGAGTTGAAGGTGGCATGCAAGATGAAGCTTTCTTTGCT
CGTCCAGCTTTCGTTGTGTGCTTTTTCTTGTGCTGTCATGTTTGGGTATCAGTGTTACAT
TAAAGTTGCAGAATAAATTAACTCTGCCGTTCCCTCCTTTACCTGCAAACGTGGTGCTGT
CCATGGCCCGTGGCTGGGCTTCTAGCAAGGAAACTTGCTCAGGCTCTCTGCCATAGGTGG
GCCTGACTCTGCTGTAAGGGTCCCCAGGTGCAGGTGGGATGCTGGCAGGTGTGGGAGTTC
CCACTGAGCGTAGGGACCATGAGTTTGAGGAGGCCCCCGTCAACACGGTGTGTGACTTCC
TGCCAGCCTTGCTGGGCAGCCCCAGTTCCACGCCAAGAGGGGGGCAGGAGGAGGGATGGA
GTGGAGGACTGGCTTGGTGCCACTGTCCCTCCAAGGGCCAGGGTACACAGACACCAGGAC
CTGCCTCCTGCAGCCCCATCTTGGAGACAATGTTCTGGAATCCTTGGCTCATCATTCACA
CAATTCAGAACTCCGTCCTAGGTACAGAGTCTTAAGGACAGTGAGGTGGGCCTCGCAGTG
ATGTTCTCACTGGTCTAGCAGGCAGAAGGAGGAGCCGTGACTGCTGAGATCGCCGGAGTT
AATGAAGACGAGGCTTTGTGCACACCTAGACGGTTCATTGCCTGTGACAGACTGGAGGCC
TGTTTGGGGGCTTCCGTGGTCTTCTCCTTTGGAAGCAGGGCTCTCCCAGGGAGGCCAGGG
CCAGGCCTAAGTCCTGGGTGTCCAAGGGCTGAGTGATAGCTGGGGGAGGCCTGGATAGAG
CTGCAGATCCTCTGGGCGCAAGACAGTGAGGGCAGAGACAGGTTGGTCTCCTGTGAAGGA
CTCAGTAGCAGGCAGGGACACAGTCCAGGGCTTTCTGGAGCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1210, 1484..2323, 2644..2847, 2951..3014, 3206..3285, 3696..3787, 4399..4478, 4562..4604, 5013..5075, 6028..6142, 6437..6867, 7071..7079, 7081..7081
1001..1210, 1484..2323, 2644..2847, 2951..3014, 3206..3285, 3696..3787, 4399..4478, 4562..4604, 5013..5075, 6028..6142, 6437..6867, 7071..7077
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved