Microcebus_murinus Locus ENSMICG00000006856
snOPY snoRNA Orthological Gene Database
Microcebus_murinus ENSMICG00000006856
Microcebus_murinus
ENSMICG00000006856
scaffold_12474
SNORD61
1155..1224
5542
AGGAGCGACCGCGCCACCGCGTTACCTGCATTGGGTTGGCGCTGGCGCTAATGATGGGC
AAGTGGACTTTTATGCAGGCTGCGGGCTCCTACTTCATTGGTGGCCCTGCAAAGGACGCT
CTTTGAATTTTCCCAGCTAGTGTTGGCGGTGGAAGTTAGTCCCCTGACCGGTGTCCGTGG
TTCTGGGCTGAATCCAAGAGTCGCCATTTTGTCTTTTACACGCGGTTTTTAATGACGAGT
TTTAATTAGGTTCCACTGCAGTCATGGAGTGTTGAGTGTTTGAGTATGCGCGTCCACGTT
CCACTATTTGGTAGGAAACGAAGTTGACACTTTGTTTTTATTTTTTTAGTCAGATAGTAA
CATTTTCGGTGGGGCGGCGGCTAGTGAGGAGGAGGAGGAGGCATAAGTTGGCTCAAACTG
AAGATTTCTGCTTAGATTGACTAGAGAATCCTAATGAGGAAAAGAGAGTTTGGTCGAGCA
TTTGGCCAGTAACCTTGAGTGGGTTGGTCGCCTTTTAAAACCCCAGTGTTGGGGATGTGG
ATAAGATTTGCATCTTTAAAAGGCAACAAAAACAGAGGATTAAGACTAAAGTTTGCTTTT
TCAAATGTTGAGTAGGTGCTAATTGATGAAGACCACCTAAGGGGGATTAGGGTTAATGAT
AAAAGCTAAGTTGGCTCTTTTAACTAGTTTAATGTAAATTGTGCTGTCACTAAACTACTT
AATTTACATTGGTTTCCTACTGTGGCTGACTTTAGGAATGTTTATTATGGGTGTCTTTAG
GTATTAAGAAATAATGGTTTAAGCTTTTTATGTGAAAAGTAAAATACAAGAAAAAATTGA
TAAATAAGCAATATTAATAAAATTAAAAAAAACAAAAAAAATAATGGTTTTGGTGAAACC
TGAAAAAAATGCACCACAGTAAATGTGTCTGATAAACTTGAGGAATTTTTTTCCAGGGAG
GTAATACTGTTTTCTTTTCAGTAGACTCACCGGGGAAAAAAATGGTTGAAGCAGATCGCC
CAGGAAAGCTCTTCATTGGTGGGCTTAATACAGAAACAAATGAGAAAGCCCTTGAAGCGG
TATTTGGCAAATATGGACGAATAGTGGAAGGTGCGTTATCTGAAAGTATAGGTGGATATT
ATAATTAAAAGATAAGCTATGATGAATTTGATTGCACTGATCATATGATATGATAACGTA
TTGTCCTCTAAGAAGTTCTGAGCTTTCTCTTTACAGATCTGCTTGGGCTATTTCAATTGA
ACTAGAGTAATGCTTTTTTATCTTTTTACACTACTTTTTAGTACTCTTAATGAAAGACAG
AGAAACCAACAAATCAAGAGGATTTGCTTTTGTCACCTTTGAAAGCCCAGCAGATGCTAA
GGATGCAGCCCGAGACATGAATGGAAAGGTGAGATTGCACGATGAATGATACTGTGTTTT
CTAGTGCATAAAATGGCACATGTTGCCCAACTCTAGAGTAGGGCAGCTCTTGAATTTTTA
TTTTATCTTGGCGTCCATAAACCATAATTTGATAACTTGGTTTTTATCTTTGGTTATTAG
TTTTTATAACAAGTTGATATCTTCCTGGCCCTATTTTAAATTTTACTGAACAGCAGTGCA
GTGGATCCACCTTACTGTTTTTTTTTTTCTTTCTTTCTTTTTTTTTTTTAGAGATGGGGT
CTTGCTCTTGCTCAGGCTGATCTCGAACTCCTGAGCTCAAGCCATCAATCCTCCTGCCTT
GCCTCTCAGAGTGCTAAGATTATAGGTGTGAGCCACCCTACCTGTCCCCACCTTAATGTT
TTTATTCAGATCATCAATATCATAATTAAAGGTTAAGATTTAAAGTAAATGGAAAAGCCT
TATTTATACAAACTATTATTAGCAATTTTTTGGCTAATTGGTGAGCAACATTTACCTCTG
ATTGTATTTTGAAGGACCTATTTGTGTCATCGTGCATAGTTGATCTACAAGTTCTTTTAA
AATCTTGACATAATTTAACCATCTGTATTTTTATTCTTTTTAGTCTTTAGATGGAAAAGC
CATCAAAGTGGAACAAGCCACCAAACCATCATTTGAAAGTGGTAGACGTGGACCACCTCC
ACCTCCAAGAAGCAGAGGCCCTCCAAGAGGTCTTAGGGGTGGAAGAGGAGGAAGTGGAGG
AACCAGGGGACCTCCCTCACGGGGAGGGCACATGGGTAATGGCTTAGGTGGACTTTGGGC
TTGGTGTGTAACTTATGGACTGCAAACTCACTGGTGTATGCTTTGGTTAATTCTTTGTTG
AAAGGCTGTAGCTTTTGAAATTGAACACTTACCTAAGTGATTATGACTTAAAAGCATAAA
AGGCATCTTAAGTTAAATTACAGTTTAAGTAGTAGACAATATACTTTGTCCAAGCAATTC
ATTCCATAAGGAAAAATGAAAAAATTTTGATAGGTATAGATGTTGGGCATGTGAAAATAA
AACAATTGGTATTTTTTGAAGTAACTTCAAGACTGCCTTTCTGTTTTTATTTCCTCAGTC
TATGTGACTGCTACTTACGCTCAGTCTTGTACAGGTGAAAACTAGACTTTCCAATAAACC
ATAGTCATATTCTTGATCAAGAAAATGGAACTTTTAAAGTCTTTTTTATTCTTGTGGGTA
TTAACATTTTCTTTCTATTCTAATGTAGATGATGGTGGCTATTCCATGGATTTTAACATG
AGTTCTTCCAGGGGACCACTCCCAGTAAAAAGAGGGCCACCACCACGAAGTGGGGGTCCT
CCTCCTAAAAGATCTGCCCCTTCAGGACCAGTTCGCAGCAGCAGTGGAATGGGAGGAAGA
GGTAAATGTTTCATGTATAATAATCTATTGCCACCAACATAACACAAGAAAGAATTGAGA
GGTGAATTCTAAATATCTTGCTTAAAACGTGACCATAGACTCCACGTGAATTTTGGGTGT
GAACAAGAAATTCTAGAGAAGAACATTTATTGATCTAGCTACATATTGTCATGTCTGGTT
GAATCACTACCTTTTTTGTAGCATGAGTATAAATACACATTTTCACTTTTCTCTGCCTAT
GTTTAAAAATGATTTATTTTTCTTAAGCTCCTGTATCACGTGGAAGAGATAGTTATGGAG
GCCCACCTCGAAGGGAACCCCTGCCCTCTCGTAGAGATGTTTATTTGTCCCCAAGAGATG
ATGGATATTCTACTAAAGACAGGTAAAAGAAAAGTGTAGCTTCTTATCCATTAATAATTA
AAGCTGAAGAAAAGCTCCTGAAAAACATGAAACAAATTGCTTTTGTTTCTGTAGCTATTC
AAGCAGAGATTACCCAAGTTCTCGTGATACCAGAGATTATGCACCACCACCACGAGATTA
TACTTACCGTGATTATGGTCATTCCAGTTCACGTGATGACTATCCATCAAGAGGCTATAG
GTAAGTGACTTTGCTTCCATGGTTTGACTGTTTTAAAAGAAATTGCTGTGAAAATTGGTA
CTCTGAAACTTAAAGATTTTCCTTTTAATTTAGTGATAGAGATGGATATGGTCGTGATCG
TGACTATTCAGATCATCCAAGTGGAGGTTCCTACAGAGATTCATATGAGAGTTATGGTAA
GATACTGGTTAAGGGTCTTGAATATCACCAGCTTGAGTTTTTAGGTTCATGAGCCAGTTT
ATTAGGCTGCGTGGTGCTTGCTTTTAAAGGGATGTTTGCTTGCTTTTTAAGGGGTGTAAC
TTTATCAGCTGGGCTTTTCCTAATTTTGTGAGGGGCTTTTGTTTTTTTTTTCTAAGTTTT
TTTTTTTTTTTTTGAGGCTGTTTGCTTGCTTTGGAGGGGATTTTGCTTGCTTAAATTGGC
AGCCTTATGTGTTTTCCCCCAACAGTGAAAATACAATTTAAAAATTTTATTAACAAGATC
AAATATTTACCATTGCAATATGAAGGAAAATCTACAGTTCAAAATTGCAACTTATCACTG
GAAAGTGGCTGAGTGTCTACTATAAAATAACAAGCTGTCTGGAATATCCTCTTGAAATAC
ACACCGTCTTCAGTCTTTTCAAACATTAAAATCAATCCATTTCCGTATCTCAGCAGATGA
GCAAATCCCTATTATGGCCAGCAATGGCAGAGTTTAAAACCTCCCAGTTGAGAAAGTAAA
ATTTTAATACAAAAATTCTGTAAATTCAGATTTAAATGTTGTATATATACAATTTATAGT
GTTGCCATATTACCTGACCATTGACCCTGCAGGTAACTCACGTAGTGCTCCACCTACACG
AGGGCCCCCGCCATCTTATGGTGGAAGCAGTCGCTATGATGATTACAGCAGCTCACGTGA
CGGATATGGTGGAAGTCGAGACAGTTACTCAAGCAGCCGAAGTGATCTCTACTCAAGTGG
TCGTGATCGGGTTGGCAGACAAGAAAGAGGGCTTCCCCCTTCTATGGAAAGGGGGTACCC
TCCTCCACGTGATTCCTACAGCAGTTCAAGCCGCGGAGCACCAAGAGGTGGTGGCCGTGG
AGGAAGCCGATCTGATAGAGGGGGAGGCAGAAGCAGATACTAGAAACAAACAAAACTTTG
GACCAAAATCCCTGTTCAAAGAAACAAACAAAAAGTGGAAACTATTATCATAACTACCCA
AGGACTACTAAAAGGAAAAATTGTGTTACCTTTTTAAAATTTCCTGTTAAGTTCCCCTCC
ATAATTTTTATGTTCTTGTGAGGAAAAAAGTAAAACATGTTTAATTTTATTTGACTTTAT
GACATTGCTTTCAACAAGCAAATGTTAAATGTGTAAGACTTGTTGTACTAGTGTTGTAAT
TTTCCAAGTAAAAGTGTCCCTAAAGGCCACTTCCTATCTGATTTTTCCCAGTAAATGAGG
CAAGCAATTCTGAGATCTTCCACAAACATCCAGCCATCTAAAATGGAGAGATGAATCATT
CTGCCTATACAAACAAGTAGCTATTAGAGGGTGTTTGGGTATACTACTTCTAGGATTCCA
GGGTGCCTTCAAACTGAAATCAAAATATTCTCAATATGAAAAACCTGTGATCAAATGCTT
ATGTAAGGAAAGTGCTGTTCACCCAGTAAACCCAATACAAATGGAAATGCTGGCCATATT
TTGCCTTTCTGACATTTCCTTGGGAATCTGCAAGAACCTCCCCTTTCCCCTCNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTTCTAAAAAGTGAAT
CTATCAGCATTCCACATCAGATTTAAAGCATCAAATGCCTGTGAAACAGCAAAGATGGTA
AGCAAAGCAAACTAGTTTTTCCGTCTAAGTCGAAATTGAACACTTAAGCCTTCCTCATAG
TACAGTGAAACATAACTGTACCTCATGGCAATGGAAATGCCTTCTAGATTAAAAAAAAAA
AAAACTTTTGGAAAAGCAGATGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1109, 1301..1407, 2023..2194, 2668..2820, 3087..3201, 3294..3419, 3513..3595, 4232..4542
1001..1109, 1301..1407, 2023..2194, 2668..2820, 3087..3201, 3294..3419, 3513..3595, 4232..4539
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved