Microcebus_murinus Locus Mono:295:SNORD45
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:295:SNORD45
Microcebus_murinus
Mono:295:SNORD45
GeneScaffold_2804
SNORD45
1001..1082
2082
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNCCCTATCCCCACCACGAAAGAGGAAGCAGCTGAAGGGGCGGAGGGAGGGAAACTCAAG
GGATCTCCAAGGCATAGAAAAATTTGCATTTGAAAAAAAAGGGCCAATGATGTAATGATA
TGTATTAGCCGAATCCACAGTTGATGTGAATTTTTAAAGACATTTAAATTATGCCGAGAT
CTTGGAGAAAACAAAACAAAATGGGAGACTACAGTTCTTTTTTTTTTTTTTTTTTTTTAA
GAGACAGGGTCCCACTCTGCCATCCAGGCTGGAGTGGAGTGGCATGATCACAGCTCACTG
TAACCTTGAACCCCTGGGCTTAAGCGATCCTCCTGCTCAACTTCCTGAATAGCTGGACTA
CAGACATGTGGCACCATGCCTGGCTAATTTTTAAATTTTTTGTAGAGATGTATCTCACAA
ATTTTATGTTGCCTCTCCTGGTCTCAAATTCCTTACCTCAAGCCATCCTCCCACCTCAGC
CTCTCAAAGTGCTGGGATCACAGGCATGAGACACCTGCATCTGGCCTCACACATTTGTTT
ATGCATAAACTATCTCTGGAGGCAGAGGTAGGTAGGAGGGAGACATTTTGCTGTCTATAG
TTTTTGATTTTTAAATGACATTAAGTATATTTGCTTTGAATACATCTTTTCAAAATGTTA
ATTTTTTTGTTTAGAAGAGGAAAAGGAAAGCAATTGCCTTTGGAGAGTGGGACTTAGGGT
AGGGAAAGGTGAAGCAGGAGATTGCTACTTTTTGTTATAAGTCTTGTGCTTCTATTTGAC
TCTTAAATCTATGTCCATGTGTAACTTTGACAAAAATAAAAATATTTAAAATTTAAAAAA
AAAAGCAGGACCAAAAAAGGAGCAAGGCCCGTGGTGACAAGGGATGGAAAGGGTATGTGG
AGAACAGATTTATTTACAACCTGTGGGAGCACAGCTGGAAGGCAAGTGTGAGCCTTTGGA
AAAGATTCTCAAAAAGGGAGGAAATAATAAAGGCTGTCCCCTGTCAACTGAGCTTACAGC
AGTGACGGCGGTGCCCTTCCAAGTCGTTTGGCACTGAGACGTGACGGGTATTAAAGGCCT
TGAGTGAACACAGAGCCTTGCCTTAAGATCCCTCTGACAGTTCCTTGTGAGAGCGCCTCC
CGGGCCGGCCCCCGCTGCCCGCCGTCCCTCCAGCCTGCTGCTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved