Microcebus_murinus Locus Mono:233:SNORA26
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:233:SNORA26
Microcebus_murinus
Mono:233:SNORA26
GeneScaffold_4391
SNORA26
1001..1111
2111
ATGCTGACTTCCTTGAATCAAAACCAGCAAGACTTTATTTTGCATTTTTACATCCTAGT
AGCAAAGAGAACCAGATACATGATGAGTGCAGAATCTGAATATGGCATTTTTGTTCAAAT
CAGCTGTATCCCGTCCTTATCTCCACTGTCCCGGTAACCCTGGGTCCAGGAGACGGGAGG
AGCCACAAATACCCCAAGAGTCCCGTGCTCCACCCCGCCCCCATGCGCACATGAGAATCA
TTTTTCATTTGCTATGAAGTCATTCCGAAAGTGCCTGCTTTTCATTAAGATGGTAACACG
ATAGCCCCTCGGGGGCCGCGCGTGCAGCAGAAGTGAAACAGCCTTTTCCTTCCGACTGTG
GCATTTTCTTTCCCAGCTCTCCTCGGCCTGAGTGTGGCGGAGTCCTTTGTCTTTTGTTCA
AAAAAACTACGCCTAAACCTCAGACTCCGTGGTGTTTTTGCTGTTGCTTTGTGTGTGTGG
TTTTGTTTGTTTTGACATGCATCTTTGCATAAAATGGGCCAGGTTCAAAAGGCACGGGCT
CTTTTTCCCACACGCGTGGCTGTCGTGGGTCAGATGCGTCCCAGGTGTGGCTCCGGCCAC
ATTCCGCTTGCACGTGATTCTCATTACGCGATCCCCAAGGGTTGTGAAAACATTTGCTCG
AGCCTCCCGCAGACAGCCACAGCCATGAACTGGCAAACGCCGATTGCAAAAGCACTGTTT
ACTTAAAATGTCTCGCAAGCAGTCACCATCCTGATGCCCACTCAGCTCCGCGCAGCCCCG
CTGTCCCCACGCAGGTGACCCCTGTTGCCTCCTCCCTCGCCGTGTTCCCGGGCCCGCCTG
GGACATCGCCATGACGGGGACGACAGCCCCGTAGACACCGGCTGGCGCAGGCGCCGTGGG
GCCTCTGACGCCCACACCTTGTTCCAGCAGCCGGCCGGTGGCAGCGCGCACAGCCCGGAC
GCGCCCTTGCAGCCTTTTGGGAAACACCCCCGCCCCTTCCTGCGCCCTTTTAAGGTCGAA
AGAGGCTAACACAGAGAGGCAAAGCGAGTCTCCATAAAACCCAGAGAGGAGGCTGCACGT
CTCCTCTCTGCATCCTGTCTGGAGTCACAGCTGGGGAAAAAACAAAACAAAAAACGAAAA
GCGTAGATTCGATCACCCCTTAGCTAAAAGCGGCGTAGAGGGAAACTGACGGGACCCCTG
AGGGACGAGAAGGAACTTCTCCTACGAGAGCACTGGCCGGCCAGGACGGCGGCGCATTTG
TGGAGGACACTTAGAGGCGACTTTGCGAAAGTCACTTTTTCCCCTCGGTGCCTCAGTTTC
CCCACTTGTAAAATCAGGGGTTGGCCCAGGTGATCCCTCAGCTACCTTTGCTGTCGAAAT
ATTACGATTCTATTTTATTGAATATGGGTCTTTTTTTAAAAAAAAAATGGAGTAAGACTG
TGAATTTAATTCGACTAATGACATTTTCGCGAAGCAGGTGAGGAAAAGAAATCTCTCACT
TGTCATCGAAAGGAATCGCCTTGAGGGCGGGGAGGGAGGGAGACAGCTTTAATCACGTAG
AGTACGTGGAATAGGAATCAAGGTGATGTGCTTCCTTTTCGCTCTTTTAAAGGACTGAGC
GTGGAAAGTATTCTTGCGAGTCGCCTCCTTCTGTCCCGGGATGTTGGAGACCCGCCCCAG
CAGCGAGCAGCCCGCATGGACGCGGAACCCGGCAGAGCAACGGCAGCGCTGGCCGCGAGC
AGAGGCCTGCAGGCCCACGCCACGCCCACGCCGGCCACGCCACGCCCACCCCCACGCCAC
GCCCACGCCACGCCCACGCCACGCCCACGCCACGCCCACGCCACGCCCACGCCAGTCCCG
AGGAAGTCCGCGGTGACCCCGCAGCCCTCAGCCTCCTTCCCGGCTCAAGCTCCTCCGCGG
AACAGAGAAAAAAGAAGGGAAGGGCAGCTCGATTTAGATCCCCATTACATGAGCTTATGC
TCGAGTCTATTTTTTTTTTTTATTCTTTTCACAAATGAAAACGGGCATATATTTGTGATA
TACGACATGATGTTTTAATATATATGCACACTGAGATAGCAAATCGAGCTGATTAACTTA
CCTGTCACCTCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved