Microcebus_murinus Locus Mono:51:SNORA33
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:51:SNORA33
Microcebus_murinus
Mono:51:SNORA33
scaffold_68964
SNORA33
1001..1130
2130
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNGAAATTCATCAATGAAGCTAATTGAGCAAGTGAGCTCGAA
AGAAGTCAGTGATCGTCAGGTGGTGCTTGAAATTATGATTCATAGACAGTGAAGTTTCCA
CTATAACAAATTCTAGGTTTGGCTGTAGAGCAATTTAAGAAAAGTAGCTGAAAAATAAAA
AGTCCAAACAACTCAACAGTCATGGAGAGAGATGGATCAAACATGAAGATGATAGAGGCA
ATGTAAAAGGCATAGCAGTTTTGTTCGAATGGAAGAATGAGATCCATTTGCTGAAGTTAT
TAATAAATGACCAAAAGTATTCACAAAGTTGGTAATGAACAGGAACAGGGAGTAGGAGAG
GGTACTGTGGTTAAACTGTATAAACCTCAAAGGAAAATAACTTTTCACTTAAAAAAAAGT
GAGAAATAAAACTTTGGAATGGAAGTTACATTGATTAGTGTTCAGGGAACATAAGAAACT
TACTACCCAATCCTGAAATCCTGACATATCAAGAGTGTTTGAAGCCAGCCAATGAATCTG
CTTACCTGAATGTGTTTCTGCAGAAATTTTTAAAAAGCTGGCAATGGGAAAGCCATGCTA
TGAGTCTTAAGGACACTGAAGTTATTAAGGTCACTGAAAATGGCTATACCAAATTTTAAT
GATGGGATGTATTTCATAAGACATAGTTAATTATTAAAGCTTCACTGTGAGTAGTGCTAA
GAACTTAGTGAAATTCCTAAATGTTAACAAGAAGTTCCAAAAAACAAAAAAACAATCACA
CACAAAAAAGAGTGCTTCAGAACCAGCAGCCTACCCTGAAGAAGGCTGTGGCACGAATGT
AATATCCCTGGGAGACAGATTTCGGTTGTGGCATAAAGCTGTGCTAGGAAAGAAGTTGAG
GGTGTTTGGGAGATATTCGAAAGAACCAGGAGACTTCCCTGAGTGTCAGCTGTCTCCCTG
TATCGTTCTTGGCGCTGGTTCCTTCACTCCTCATATGCTGTGCTTTCTGCTTGTCTAGAA
TCTGTACTTCTCATCAGTTATTTTTGGCGTCTTGACTCTTGCCAGATCACCTTGGTCTAA
AATACACTCAACCCATCCCCTCTCCTTCTGCCAGTAGATATGTAGATCTATTTCAAGTGG
AGAATGAAATACAAGAAAGAGGAAAAAAATAGTGAGGCAAATAGGCAGCAATATTTTTCC
CCTCATTTCGGGCTGCCAACATTTTTCCCCTTTCTCTTCTAGATGTCTCTTGTTCTATGC
TTTTTCAACCAGGCAATGGAACTATTATTGGTAAGGTTTTTTTTCTTATGCCATTCATGC
ATCTTAGATGTACTGTTGGTTATGTAACATATGCCTAAATCTACCAGTAAAATACTATAA
AATATTTAAATGTTGCTTAAAAATTTACTACTCTTCTAAAAAGATGAAAACATTGAAATG
GGAGCTATATTTGTCCATAATAAAATCACAAATTGCCCTCAAAGAAATATTTTTTTCTAT
TTCTAAACATATTTTAGATATTTAGGCTTCTCAATTAAATAACTGAAATACTTCTGAATC
TTTATTTTTATCCTCTTGCACCCAAATCTCAAAATGTTAATGCAAAAGTAAATTTTGAAT
AGGTAAAAACAAGGATTAGAAAATATGAACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved