Microcebus_murinus Locus Mono:37:SNORA30
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:37:SNORA30
Microcebus_murinus
Mono:37:SNORA30
scaffold_41780
SNORA30
1001..1119
2119
ACCTGTGCTCTCAGCTACTTGGGAGGCTGAAGCAGGAGGATTGCTTGAACCCAGGAGTT
TGAGGTTGTAGTGAGCTATGATGACGCCACTTCACTCTACTTAGGGTGACAGAGTGAGAC
TGTTGCAAAAAAAAAAAAAAAAAAAAAGAAAGTTGTGAGATTCAAGCGGGAATGTTAAGC
AAAGAAATTGGAAAATATGTGAATAAATCCAAACAAGTATTTTATAAGACAATAATAATA
ATTACTGATTTAGCAATATAAAAGTAAGATAGACCTGAAATACTAGATCACAGTAACACG
TAAATTGAAAGAGGAATGGAAGGATTGGAGTTAAAGCCTTCTAAGATCTTTTTATTTTAT
TCAGAAAGATGGCTCAGATGCTGGTTACTTTAGACTTTGTTAAGACAAGAATGCCTGATA
AAGCTTTAATAATAACTACTTTAGGGGAAAATAGGAAATAAAACAGCATGTAATTTCCAG
ACCAATGAGGCAGAGGTTAAAAAAGACTTGCTTAATTCAAGGAGGGCTACTGCCAGCCTT
GGAAGAAAACTTTGGTTTAGAGCGAAGGCCTATTTCGTAGTTCCTCTGCTGCCTGATGCC
CTTGGGAAATTCTGCCTGCCATTCTCTGTGGGAATGGCTCCATTTGTTCAGCATACACTT
ACTGAGAACCTGCTGCACTCTAGGCACCATTTCTAGGTAATTGGGATACCTCTTAGAGTT
TGCAGAAGAAAGAGAGACAATAAACTTAATTATATAGTATCTTAGAAGGTGATAAATACT
ATTGGGGAAAAAACGGTGAGTAAAGGGAATCAGGGGAGCAGGGTATTGGGAAGGTGACAT
TTGAGTAAAGTCTTGAAGGAGTGAGGGATTTTTACCATTGCGTAGCTGGGAGAAGAGCAT
TCCAGGTAAAGGGAACAATTAACGCAGTGGTCCTAGTAGCTAGATGTGTCTTTGTGAAAT
TAGCAGCCTATTGGAAGAAGGAGAGGAGTGAAATCATCCGATTTGTGCTTTGAAAGAATC
ACTGTGGCTAGGATTTGGTAGCTGGTGCTGAGAGAAAACCCTTGATTGCATCCTTGCCCT
GGGATTGTACCAGTGGCAACTGTCACTCAATGGGACAGAGACCATTCTGTGACTTCTTGC
TCAACTTTATGTCTTTCTCCTGTTACTCTAATCTTAAAAAAATGTAGAAAAAAAGAAGAA
GAAAAAAAAGAAAGAATCACTGTGGCTTGCTTCTTTAAGAATAGATTTGGGGTAGGAGAC
AAGGGTAAACCAGAGAGACTAGTTAGCCAAGTATTCAAAATAATGTGGGCAAGAGGTAAA
TAATGTATTCTTAATAATAATATAATGGATAAGTAACAATAATATCTCCCTTTATTGGTG
AGAAAATGTAACCGGCTCTATGAACCTCTGTGTGTTTTTTGTAACTCTCTCCTTTAACTA
ACTACATGAACCTTGGAGTTATTTCTCAGAAGTGATGGACTTGAATAACTCTTGGCCTCA
AATGATCCTTCTGCCTTGGCCTCCCAAAATGCTGGGGTTACAGGTGTGAGCCACCACACC
CAGCCTGAAATAATAGATTTTGTACAAGACAAAGGAGTTGAGATTCTGAAGGCGCCAGGG
CAGACCTCCTGTAGTCAAGATTCACCATCTCCCACAACCTGCCCCCAAAGCTTGTAGCCC
TTGTGAGATACACCACCACCTGCCCCAAGGCATGTGGCTCCTCCCTTAAAAGCCCATGAT
ATATCTTAGTCCTGGAGAGGGATTTTAGGCAGTTTCTCCTGTTCTTCCAATAAGACATCT
ATTAAAAATTCCTTTCTTCGTTGGCGATCCTCATTGTCTCAACAATTGGATCTTTGTGCA
ACGAGCAGCTGGATCTAGACCAAAATCCCCTTGTGGTTTTGGCTACGAGAACATGTCTTT
TCTCCCACTCTCACTTCTCAGTCTTAACTGGGACATCATTTTGATTGTTACTCTGAAATA
GCATCTGGAAGTACTTGACCTTAACTGGCTTCACTTTCTTCTCTATATTGTTTACACTTA
AGAGACAGAAGTGGTCTTTTCTCAATCTGAATTGTAAAAGAAAGTAGCCAAGTGCTAGCC
AGTCACCAAGTGCTCAAGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved