Microcebus_murinus Locus Mono:171:SNORA16
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:171:SNORA16
Microcebus_murinus
Mono:171:SNORA16
GeneScaffold_1468
SNORA16
1001..1134
2134
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNAGAAAACAAGGATGTGCTTACTGAGTGCTGACTGT
GCCTGGCCCTTTACAGACCCTGGCTTATTGGATCTTCACAATGATCCTAGGATGTCATTT
TTATCTCATAGTTGAGGACATTAGGATTGGAGAATCCCGCATTCGATTCTGAGACCCAGA
AGATTTCATAGTAAGCTGAGTGGTCTTATATTACCAGGATGCAGTGGAGAAACACACATC
CGCCACTTTCACAGTCATTAAGGAGTCCTGTTGAAGTAGGATTGTATAGCTAGGATCTTT
CCACATTCTCTTCCCACGTGTTTTAAGGGTATATCGAAGGAGAGGGTCTGCGGGGGCTTT
CTCCACCTGCGGTAGCGCCTCTCACCATTCTTTCCTCTGCACCTTGGCTTTCTTTTTTTC
TTGGCATTGGCACCAGCTGACATAAACTTTTGTTTGTTATCCATTTCTTTTACTAGAACA
TAAGCCATGAGATATGACATAAGTTCCATGAGCTCAGGAGCTTTATTCTGTCCAGCTCCT
AAAAGAAGGCCTGGGACACAATAGGCATTCACTGATCAGTTGATGAATGGATTTGTTAAT
GAAAGGCAATGTGAGAAGCCTCCTAAGAGGAGGAAGCTTAGATGTCAGCATGGCTCTTGA
GTAAAGAACAAGACCAAAGAGGAGATTATCCGCATAAAGAGAAATGTGGAAGAATGAATG
GGAAGTGGAGAACAGATGAGAAAAACGTGGAGAAAAGGAAGGAATAGAGCCACTCATTCC
ACAGTTCTCTCCAATTCAGTACACAAGATGACGATTCCATGTGAAATGTTTGATGTGTCA
GCTCCTTCACCTAACAGTTACACTAAAAAGGAATTTAAAATTTAGGATCAAAGATGCAGC
TGCTTTCCCATTTAAGCAGCAGTCAAGAGAGTGCCCAAAGTGACAGTTTTCCTGTACGGC
TATAGCCTCTTCTGTTATCTGTAACTAATCTACAACATTTTGGGAAAAGATAGCTAAAAA
AAAAAAGTTAGTGCTGAGGTGGGTAGGCCTGGTTCCTTCATCTGAGCATGATGAATTGAC
CAACAGAACGCAGACACAGGGGAAACCCCGCACCGTTGCGACAGTCGACAGAGGGCGCTG
TTCACGTGCAAGGTGCTGAAAGGAATTTCTGCCTGACGGAGTAAGCGGGACCGCACTGAC
AAATGAGAATGAGGGCCATCTGGGAGTCTGGCTTTGGATCTTAGAAACATGACCTACTTT
GGTGGCATGGGAGGGGTAAAGGCAAGAGTGAGTGGGACAGATCGGGAACTCTTTACTGGC
GCCCCCTTAGCCACTTGTGGCTTGGTGACACTGAGGGTGGCAGTGATTGAGGTCTGACTC
TCCAAGGGCAGGGCTCAGCCCTGGCGAGGTGGTTGGCAGCACCACGAAGGTCAGGGCTCA
GGGGAGACTGCCCACGTCATCGATAGCCTTGGCTCCCTCCCTGGCCTCAGGCTGCTGGGC
CATGGAACCTGTTTTCTACCTCCCAGTTTAAAGTCCTGGAGGAGAATTCCAATAGCATCC
AGAGGAAGTGCTGGGATCCAAGAAGAATCCTTTCCCCCAGTCTCCTTTAGGGGATAAATT
TCAGGTTTGGGTAAAATTCTCACTGTACAAAGATGAGTAAATAGAAATTCTCCCCTATAA
AAGAGTTTGCATTAATTAGGGCGAGAAAGCATTACATGCAAGAGCCATTCATACATTCGC
CAAATAGTTATTGAGCGTCCTCCGTGCCTGGCATTCTTCTAGAGTCTTAGAATAGAGCAG
CAGACAAGAGAGAAAATCCCTGCCTTCATGGAACATAAATTCTATCAGAGAAAAATATTT
TCTGAAGGAAAGGAGGCCATTTTAGACAGCATCTCTCTGTCCTCTAGAAAAACAAAGTAT
CCCGAGGCTATTCCACTTGATATCAGTATCCCCAGGAATTGTCCACAAATGCACAAGAGA
TAGGCATAATGAAGCCCACTGAAACTTGTTCATGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved