Microcebus_murinus Locus Mono:292:SNORD93
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:292:SNORD93
Microcebus_murinus
Mono:292:SNORD93
GeneScaffold_2011
SNORD93
1001..1069
2069
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGATGATGTTTCTTCTCTAAAATGGA
TACTATTCCAGCTTGATGTAACAGGCAATGCCAGAAAGATGGTGACTGGGGACATAATAG
ATTCCCATGGTCTGTGAGCTTAGTTCACTCCATTTTACTTCTAGCTGGAAAATAGGATAT
GCTAGTGTCGGGAAATTTGGAGAAAACAACTTTGTACAGAAATTCTATTCAAAGGTAGCA
TTTTATTCATGAAAGGTAGCTAGTAGATGGCCACAATATAAAGGCCATGCTGTTTTTTAA
AACAAAAAGTTAGGGCATGACACTCTCACCATTGTTCATGTCGCTTTTTTTTTTTTTTTT
TTTTAACCAGGTTCAGTGGAGTTCAAGTTGTTGATGAACTTAAGGTATGCACCAAAATGG
AAAGACTCTGGCTACAGTTCTTAATAGTTGAATAGACTTCTTGGCCAAGGATGAGAACTC
TAATCTGATTGAATTCTGCTCTGATGGGTTAAAGGATTTACCTGAGGCCAAGTTGATATG
CAGGAATTTACTAAATGGAATCACATCACCCCATTTAAAAAATTATGCTCCAGCTAAAAA
GAGAAAAAAGCTAGTAAATGGATGATACTTCTTCATTCAGCCAAGAAAAAGACAGTATTT
TGAGCAAAAAATTTGGCAGTGCAGTGGGGGATTCTATTTACTTATTTGCCCAGTTTTTGT
AAACAATTTAGACACTGCTGGTTTTGTTACTTAATAATACATATTGTGATATTTCTTTTA
CAGGTCTGGTGCCTCAAAGAATCTGTTTTTCAGTGGATAAGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNAATATGTTTTATAGGATAGTCATAAATAATTA
CTGTTGAATATCATATTGGCAATGGTGGGCTTAATTCTACCTAAGATTAAAGTATCTCAC
TTTTAAAAACTTAGTTTGTGTGCGTGTATTTTTTGGTAGCTTCTGGGTAGTTTGTGTATT
TCATATACTACAGATTTTTCTGCGCCTGTTCTACGTCTTGATTGTGGAAGGACTATGCAT
TTGTCAAGTCTCATACTTAATAGCTGCACTTTAAATCTCATCTGTAGTATGGCACTTTCC
CCTCAGTTTTTTCATAGTCCATTCTAGTGGCCACGAGGGAATGGGGTGTGGAAATTCTAT
TAACCATTGCTCTGTTAATGCTCCTGTGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved