Microcebus_murinus Locus Mono:174:SNORD22
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:174:SNORD22
Microcebus_murinus
Mono:174:SNORD22
GeneScaffold_2693
SNORD22
1001..1131
2131
GACATTCCATTCATTGTCTTTGCAAATGTCAAGTACTGAGACTTTGATACTTGCACCCA
TGGTGTCTGCAGAAATTGAGAACTAAAACAGGTGCTATGTCTCACTGCTGAATAATTTAA
TGTTGATTCCAAGGCAGCTGGTGAAGTGTATGTACTATATATTATCCTCGGTTTGGTTTT
TCTCTTTTTTAAAAAAAAATCACACATTTTAATTAACCTTCCAGCCCTTGCCAGGGCTTT
GAAAGGACTTAATTGGCCTGCAGGGATTGGAAGACACAATAGCCAGAAAAAGGCTACATC
TCAGTTGTTTTCACTCCAAGGGCTTATAAAATTAAAATTATTGTTTTATTTCATCCTTCG
AAGCCCAGAGCTACAGGCAGATTCATATTTGGAACTGTGAGAAGCATCCTTGAATGCCTA
AGTGAGGATTGCAGATAGGTATTTAAACAGCAGTTACATGTGAGTACTTAATACTTGAAT
CTTTTATTCATCTGGAGCCTTTGGGTTAGCAATAAGAGTTGTACTTTTCCATTTTTTGGC
TTTCTTCATTGAAGATGGGAAATATTTTGGCTTTAATTTAATATGCAAACTTTCACAGTC
AGGTAGGAAGTCTTTCAATATCAGGACCCTTTAAGAGATTTCCAGTGGTTTTCAGTTTTG
TCAAACATAATGCTTAGAATCACAGTCAATGTGCATGTTTCATTTTCCACATGAAAAAGC
GACTTACAGGTATTTATGGAAAACCAGTGATATACAGATACCAGAGCTGTAGGTTAACAC
TTGCTTGTCCTCTGGGTAGAGATGAAAATTCTCAGGTCAAAGCCTTAAGAGTGGGTGAGT
TCGCCACAGGAGTGAGATGGGCAGAGAAGAGCAGAGTCTCAAGAGCTGGTGTGCTGAATG
TCCCAAAGAAAAGAAGCTAGAAAAGGTGATTAGAGGGAGAAGACTGGGAGGCAGAGGAAT
GAATGCCCAAGAAAGAGCAGTGAAGAAAACCAAGGGAGGCATTTCAAAAAGAGAGTCGTC
AGTAACATCAAAGTTTATAGAAAACGAGTTCCAGAGTCTATAAAGGTGAACCCACTGGGG
ACGATCCGGAGAGAAGAGAAAAGTTTGTGTCAAAAGGAACTGTCTGAGGAATCATGAGGA
TTCCTAAACATGGAAAAGATGAGAATAATCACTTATTGAAAAAATCAGTTTATTTTTTCC
AGGTATATGGAAAGAACAAAAAATATATAAATGGAATCCAAGTCTTGGAGTACATTGGAA
AGGGAATTTTTAAGTCCTGTCTTATACAGCCTACTTGTTCAAGTTAGCATACAATCATTT
TAGCCTAGTAAAGATGCTTGTAAAAATATAAAGGCAAGAAATGAAGAAAAGAAAACTAGA
TATAATAAAAGTGGGAGATGGGGTGGCAAGTTTTCTGGGCTTAACTTTTATTTGTTATCA
AAAGTTTACCAAAGTTTTTTTTTTACCTAGTGGTCAGTTATTTATTGCTGGGTAAGAAAA
CCAAACCAGAAATTAATGGCTTAAAATTATAAGTCTATATTTGCTCACAATTTTTTTGGT
TGGAAATCTGGGCTAAACTCCACTGGGCGCTTCTTTTATTTCACTAATGTAGGCTGGGCA
CATTGGCATCACCTTGGGGCTAACTGGTCCTAGGTGATCTCAACCAAGTGTCTGGGGGTA
GCTGATGTCGGTTCCTGGCTGGGCCTCTGTTTTAAAGGCTTCTCATCTTCCAGTATAGTA
GATAACTTCTTTACATCATGGTGAAAGCATTCTAAGAAAGTCAAAGCAGAGGCTGCATTT
TCAGGCTCAGCCTTGGAAGTCCCACACAGTCACTTCACCACCTTCTACTGGTCGAAGCAA
GGCACAAGTCCATCCTAGTTTCAAATAATGGAGAAATAGACTCTACCGCTTGATGGGAGG
AGTGGCAAGTCACATTGCAAAGAGGTATGGACACAGGAGATGCCATTCATTGAAAGCCAT
TATTGTAACAATTGGCCATATATACGATGATGAACAGCCAACTAGAAACTTCAAAAAGAA
TCAGAGTTTTATGACTCTGTACTATTTCATGTGTGTATAAAAGTTTGGTCACATATCAGA
ATATATCCTGCAATGGTATGTTGGTACTATTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved