Microcebus_murinus Locus Mono:140:SNORD45
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:140:SNORD45
Microcebus_murinus
Mono:140:SNORD45
scaffold_17460
SNORD45
1001..1081
2081
TGAGAAAATGGTGGCTTCCTGGGGCCATGTGTCGCATTTGAGAGGGGCGGGGGACCTGG
TGTTGAGTCACACCACGAAGTTTCAGGAGGCTGAGGCAGTACTGTCCCGGGGCTTTCCTG
CTTGGCTGGGCACCGTCAGATTGGGTTTCCCTGGGTCACGCGTGTCCACGTGGGCCTGGG
GAGAGAGCCGGCCTGGGTGCTCGGGCGGTGCAGACTTGGGTGGGCTCAGTAAGGCACACA
GTCGCCCCGGTCCAAGACGCTGGCATCTAGAGAGGTAGGGGGACCTAGCCAAGGTCACGG
GGCAAGCTTATGGTGAACCCAGGATTAGAACCTACATCTCTTGCCTCCTGGCCCAGAGAA
TGTTCCGCTTTAGTCTCTCAACCAACAGGGTTCGGTGGTTGTAGGGCTGGGGACTGTAAA
GCGAGGCCAGGCCCTCTGGCCATCCCTGCCATTTGCTCCTTTACTCCTATCTGGGGCCAG
CTTCCATTCCTGTTAATTTCGCAGATGCCTGCAGGTGGTGGCCATTTAGGGTTTTGACAT
CTGGGCAGGGACGCTGGGCTCTCCCTGCACGTTCGACGGGCTCCGGGACCCCAGGCCGCT
GGAGAGCCCTGGGCTGAGCACACTGAGGACACATAAAACCTGCTTCTTGCAGAACGTCAG
AGCAGCTCACTTTATCGGTGGAGAAACTGAGGCCCAGAGAGGTGGAAGGACTTCGCCAGG
CCATGCACGTGGCCCAGTGGAGCCAGGACTAACGCCCCGCTTGGACTCCTTGTCAAGTGC
TCTTCTTCTTGGTCTTTCTGTTTTACTCAGTGGGTGACCCAGGACAGACTGTAGGCTTGG
TCCTCTCAGAGCCTTTTACAAAACGGAAAGACTCAAACGACCGCAGGCTGAGTAAGGTCC
TTACACCCCTCTGTTCCGTAAGGCAAGGTTACGCTGGCCCTACGTCTCACACTGGCGGGA
AGGAAGTCCCTGTGATCTTAATACTTTAATCATTTAAAACTGGTCGATGATGAGTTGGCA
TGGATTCTGAATCTAAAAAGTTGATTATTACTACTTTAGCTCTAGAATCACTCTGAGACC
TGAAAAAACAAAAACAAAAAAAAGAAAAGTTCTTCCCTCATCATCATAGAACGCCAGGTC
AATAAAAAGAAAAGCAAACAAAAAAAGTAAAAGTTCTTCTCCCTGTTTATGCTAAAATTG
AAAGATTTTAAGAGATAAAAATCTATCCTCCTGCTGCAGATTTTCGCTCCTGTGTGTTTT
CCTTTGTGGATATGAAGAACAGAAGGCTGACAATATTTATGGTTAAATGTTTTCCTTAAG
CACCCTCCCATGTCCCCAGGCCCCAAGGCCTTCTCAGGTCTACACTGACACCATTGAATT
TCTTTAAGGAAAATGCAGAGAGGAGGGGAGTCTTGGAGCTCAGGACAGCAGACAACTGCC
TATTCCGTTCTGGCACTTGTTCCATCTCTGCCGGCCTGGCCAGCTGCCTCCTCCCTGGAC
AGGGCCTCTGTGCTCCTCCAGGGACACCAGCCAACCCTGACAGTCCTGGGAAGAGCCGGG
GAAATCCTCTCTGTGCTAGCAGTGGGCACACCCAGGCCTCGGGCGAGGCACCTGCTGCTC
ACCACCTTCACATGAGAGAAAAGAATACTAACAATAAGTTAGCTCCAAAGTTGAGCAATA
AAGATAAAACAAGAATCTTCAGAACCATTGGACCATTTCACTGTTTTTTATGTGTTATCT
CAAAGCTCGCACAGCCCAAGACAAACCCAGAAGATTCTGCATACTGGCCTTCCCCTTAGG
AATGTCATCTGTCCCCCACCCCTGGGGACTTCACTGCCCGTTGCCTCCTCTGGTCTGGCA
GCCCTGTAAGATCAGAAATCGCATCTCCCTGGGGTCCACTGCAAGACCAAGTACCTGGTT
AGGAAAGCAGGCGCTAAGTGCTGATTGGGTTCAGTTGCTTTGTCTTCTCTCTTGTGTCCT
GTACAATCAGGATGGACTGAATTACAACAAGCAGCCCCTGATTTTCAGTCATTGAATCTA
TTAAGAGGTTTATTTCCCCCTTTATGTAAAGTTAAATTGGCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved