Microcebus_murinus Locus Poly:7:SNORD22
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Poly:7:SNORD22
Microcebus_murinus
Poly:7:SNORD22
scaffold_48762
SNORD25, SNORD26, SNORD27, SNORD28, SNORD22
1001..1069, 1271..1347, 1548..1619, 1957..2031, 2730..2838
3838
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGAGGCATCGAAGCAGCTGTGGGGCT
TTGTGAAGGACAAAATGGCGATGGCGGGCAGTGCTCGTGGCCCTCCTATGATGAGGACCT
TGTCACAGACCTGTACTGAGTTCCGTGAGGATAAGTAACTCTGAGGAGACGGGCCCTGCA
CAGCTTTCGACTCGGCCATTGCTCCAGAAAACAGCGTTTTGCACATATCGGGTATTAACC
TTATGGTGTCTTGGGCTCTTGTCTACAGGGTTCCGGCGCACGTTTGAATAGAAGAGAGCT
CACTCGTGGAAGTAAGTGCTTATGGCGGTTTTGTACCTCTCGTTGAGTATGTGGCAGTCC
TATGGGATGTGCTACGGTGATGATTTTAAGAATTGAACTCTCTCTTTCTGATGAATTAAT
GGAGAAAGCACAAAAAATTCTGAGTAGCATCGCATGCGGCAAATATTTGAGGTCTTCTGG
TTTTCAGTTCTGAAGTGTTAGTAAAGCCTGGTGTTTTTCAGATGTTTAGCTCAAAGGAGC
TTACTGGTGGGAGTATGAGACAAGATCCATCTTTCTGCAAAGCCAGCATTGAAATGATGC
TCCAAGTAGGTGTTTATGCTATTATTGGGAAGGGGACACTAGATGACCACTCCATGATGA
ACTCAAAATGACAAGCATATGACTGAACTTAGAAGTGATGTCATCTTACTACTGAGAAGT
GGGCCAGGGGTATTTTCAGGGGTCTTTGAATGGCCACTGTTAGGTACATACATTGCCTCC
CTTTTCTGTCTCCAGCATCTCATAACCCTTCCTGAGGAACTCAACTGCCTGCCAGGGTGA
ATACAGGTAATTGGCCAAATGGGAATTCGGGGTATGTCGTCTTGTAAATGGTCTCGACAA
TCAGGAGGGCAAAATGGTCGGCAGAGTGATGTTGTATTTTTGCTCCTTTCATCTTATCCC
TCCTGAGGTGATTTTTCGGGGAGGGAGAGCACAACTCAGCAGTAAAGTTGGGTCTTTGTG
AACGTGTGCCCTTCCTTTGTCCACATATCACATCACTGTCAGATGATTTGAATTGATAAG
CTGATGCTCTGTGAGGTACAACAGTTAATAGCATGTTAGAGTTCTGATGGCAGTGGTGTT
GATGAAGAAATCTTGTTTTACCCTGATACTTTAAAATAACCATTTGCTCCCTTTTTTCCA
GATCATCCCAATGATAGTATGTCCATCTATCTTAGGGTAAGTTGATTCTCTAGATATTAT
AATGGATTATGTATTTGAGCTCATTATCCCAAAATTGGCTTTACCTTTTTGGTATTTGTC
ACTGAAGCCTGTTTGAGCCATAAAGCTTTCTGGTTCTTTTTTTTTTTTTTTTTTTTTTGA
GACAGAGTCTCACTTTGTTGCCCAGGCTAGAGTGAGTGCCGTGGCGTCAGCCTGGCTCAC
AGCAACCTCAATCTCCGGGGCTCAGCGATCCTACTGCCTCAGCCTCCCGAGTAGCTGGGA
CTACAGGCATGCGCCACCATGCCCGGCTAATTTTTTGTATATATATTTTTAGTTGGTCAA
TTAATTTATTTCTATTTTTGGTAGAGACGGGATCTCGCTCAGGCTGGTTTCGAACTCCTG
ACCTTGAGCAATCCGCCCGCCTCGGCCTCCCAAAGTGCTAGGATTACAGGCGTGAGCCAC
CGCGCCCGGCCAGCTTTCTGGTTCTTAATTGCCTGTAGTGATGTTTCTTGACCTCTGCTT
ATTTCTCCTAGATGCAAGCCAATCTGCCCAGGGTCAAGCTTCTAGGAAGAGTTGAAAGTG
GTAAGTATTTCTCAATTGTAGCTTGTCCAGTGCCAGTGAGGACACCCCTGTTCTAACCCC
AGAGCCAGTAATGGTGAACCCACTGGGGTAACTGGGAGAGAAGATGAGAACTTGTTCCCT
AAGGAACTGTCTGAGGTACAGCAAATGCTTAAAGATAGCTCTTAGTTTTTCTTGGCATGT
CCACTGACAAGTATAGCTAGAATAGCTACGGCTGTTTTGGATGCTTTGCTAATTAAATGA
TTTTGTTTAATTAAGGGGCAGCCTGTTCCTGTGTCTATTGAAAAGCCTTTGAAGTTGAGA
GGTTAGTTTTTTGTTTCTTAAGATTTATGCTACAAGTAGGTAGTTTCTGTGATGAATCAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved