Microcebus_murinus Locus Poly:17:SNORD42
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Poly:17:SNORD42
Microcebus_murinus
Poly:17:SNORD42
GeneScaffold_49
SNORD42, SNORD42
1001..1067, 3470..3536
4536
TCGCAACCAGCCTGAGCAAGAGTAAGACCCCCCTCCCCGCCCTTCTCTACTAAAAATAG
AAGGAAATTAATTGGCCAACTAAAAATACATAGAAAAAATTAGCCGGGCTTGGGGGCATG
TGCCTGTAGTCCCAGCTACTTGGGAGGCTGAGGCAGGAGGATCGCCTGAGTCCAGGAGTT
TGAGGTTGCTGTGAGCTAGGCAGACTCCACGGCAATCTAGCAGAGCCAGGACAACAGAGA
CTCTGCCTCCAAAAAAAGAAACTACAACCCCCAAGAAGCCTTAGGGCTTTCGGAGGGGCG
GGGTACCGCATGTGTGATACCTCTCGCGGAACAATTTAAACGAAACTACAATTCCCAGCG
GGCGCCACTCTACAGATCATCCAATCAGCTCTAAGTAAAAAGCATCGCGAGTCTTTGGTG
AGATTTGGCGCTATAAGCCCGTGGAAACGGGACTCGATGATCCTTTTCACAAGATGGCGC
CGAAGGCAAAGAAGGAAGGTATGTGTGTGAGTTGGGAATGAGGGCCACAGCTGGTTTGTC
TGGGGTCCTCGCAGAGCGAACGAATTGAGAGGACGGCGGCTGGGCTAGGCCCAGAGCGCC
CTGCTACGGAGCTGTTTCCCGCGTTTGGGCCATGCTGCGGCGTCTGTGGGCCGCGTGGGC
CCAGCCGCATGGGCTGGGTCCCAGTGAGGCAACCCGGCCGGCTTCGCCTTCCAGGGAGAG
CCAAATAATCGTCCCTGGGAAGCTGCATGGGTGCACAGGCTGGCGCTCCATGTTTTCAGT
CATGTGAGGAATTGGTGTTCTCTGCTTTACTCTTTTTCCTTCCGTTTCATTTTAAACGGG
ACTATATGCCCACCACTTCCCGTCGTTTTGCGATTGTATGTATAAAAGTCCTAGCACACA
TCTCGGCAAGTACGGAGTGTTCGTTCAGTGCTGGTTACTTTTTGTTTGTTTCGTCTTATC
CCTGGAGTTACTCCAAGTTGGTCACCTTCGCCCCAAGTATCGTGCATATGATGGAAAAAT
CTTAATCTCCTGAGACTTGTGATGTCTTCAAAGGAACCACTGATGCACGTGCGACCATGA
CAGATCTTGAGACCGTAAGTGAGCGATTTTCTGAATCCCGCACTCTCGTTTTCTTTCCTT
CTCTACCAGCTCCTGCCCCTCCCAAAGCCGAAGCCAAAGCAAAGGCTTTGAAGGCCAAGA
AGGCAGTGCTAAAAGGCGTCCACAGCCACAAAAAAAAGAAGATCCGTACGTCACCCACCT
TCCGGCGGCCAAAGACACTGCGGCTCCGGAGGCAGCCTAAATATCCTCGGAAGAGCGCCC
CCAGGAGAAACAAGTCAGTACTGCCCCCTTATCCGTGAAAAGATGCTTGGGTATTCTCCG
TTGGTAATTTGGAAATTTACCTACTCCAGAGCATGGCTTCTCAAACATATATTGGCACCT
AATGTGCTTCTGTAATGGGAATATGACATTATTCCTGTTTTATTTAAGAACAAGAGAATT
TTTTTTTTTTATAAAACTGGCAGGAATTCTGTTTAAATCGACCCAGAGTTTTCTGTTAGG
TTAATCATTACTTCACATGTGGTCAAGGTTTGAAAATTCTTTCCTTTTTTTTTTTTTTCC
TGAGAGTATAAAGTAGAATTAAAGCGATGCTCCTTACCTTCGAGTTCCAGCTTTAGTTCC
TTGCTTTTGGCATTACTGCTGTAGGGAACAGTCTCTTGAGTGTAAGGATATGGGTTGATT
CTTGATTGATAATGGGGAATTCAGTTATCTGTATTGGGTAATGATGGCTTACAGCAGTGT
ATAGAAGCTTCTTTTTTTTTTTTTTTTTTGAGACAGAGTCTCACTTTCTTGCCCAGGCTA
GAGTGAGTGCCGTGGCGTCATCCTAGCTCACAGCAACCTCAATCTCCTGGGCTCAAGCGA
TCCTCCTGCCTCAGCCTCCCGAGTAGCTGGGACTACAGGCACGAGCCACCATGCCCGGCT
GATTTTTATATTATATATATTAGTTGGCCAATTAATTTCTTTCTATTTTTATGGTAGAGA
CGGGGTCTCGCTCAGGCTGGTTTTGAACTCCTGACCTTGAGCAATCCGCCCGCCTCGGCC
TCCCAGAGTGCTAGGATTACAGGCGTGAGCCACTGCGCCCGGCCTAGAAGCTTCTTTTTG
TTCTCCCAAATTTTCACACTGTGCTCAAGGGATGGGGGTGGAATGGACAAAAAGTTTGGG
CACTTTATTTTTTTTTGGTATCAAACTACTGGTAATAACTGACTCTTAAGGAACCACAGA
TTAGAGCAAAGCCATGGTAGTAGTTGCTACCAATGAGTTTTTGCTGCTCCCAATGTTTCC
AAAGAGAATGGAGTGGGTTGTGTCCATGGAGGAAAGCAGTTAGAGCATTCCTCTCCAATT
GGGCCTAGAATTTAATGTGATGAGATTGAGTCCTGAACAGGAAAGTAGTGTCTGGATAAA
CAGCATGGTTTCTGAGTTTCAGGTGGAAAGCTCTGTTCTAGCTGTGTGTGCTCAAGCCAC
TGCAAGTTTAACCTGAGCTGTAAATAATCTTGCTCTCAAGATTTGGTGGCCCTGGAGCAT
AGAGCCCATTTCCAGCAACCAAAAGAGGCAAAAATGTTGTGATCCAATCTCATAATGAAG
CACCAACACAGAACTCTAGCAAATGAAAGAGTTTAAATAAAAGATGGTTTTTTAATAACT
TAAAGAATGAGAGCCTTTCAAGTCAAAGAAAATGCACACGGTTCTATCCCCCATTTGGGG
TGTCAAGCCCTTAGATTTCTGGGTGCAAATGATGACACTGTAAAGCGACCAAAGTCTGAC
CAAAATGATTTCTACCTCATTATCTGATGCACCTAGGCTTTCCTGGGCTTGAGCTCCCCA
AGATGACCCATCCTTCTGCTAGGGCCCAGGCCATATGACCCCATTTTGTCTTTCCCCCAG
GCTTGACCACTATGCCATCATCAAGTTCCCCTTGACCACAGAGTCTGCCATGAAGAAGAT
AGAAGACAACAACACACTTGTGTTCATTGTGGATGTCAAAGCCAATAAGCACCAGATCAA
ACAGGCTGTGAAGAAGCTCTATGACATTGATGTGGCTAAGGTCAACACCCTGATCAGGTA
AGTGGGGCCCCAAGGGATGGGGAGGCCAGGCTACAGTCAAAAGCCAGAAAACCTGTATGT
TATAAAGTTCCTTGCAAAACAGGGTGCAAGCCTTGAGGCACAAGCGTTCCTGTTGTAATT
AAATTGTAATCCTCTGTGGAGTATAGACCAGAGGAAAATGTCCTCCTAGGACTTAATTTA
TAAGGTTAGTACGTGCTCATTTTTTGGGCCTATACCTCTGTTGGGAGAGGCCACTAGAGT
TAGATAGTTCATATTAGATATTCTTGGTCTAAGTCTTGAAATGACTTGTGATGCTGTTTC
TCATAAAAAGGAATTGGCTTTGTGGCCTTTTGCTTTCTCTAGCCCCCTCAGGGCAAATGA
GAGAAAGATAATTATCTGGAAAAGAGTGACAGGAACAAAGGAACCACTTAAATGCCAGAA
GATGGGGGGAGGGTAAGGGGGGAGAGTTTGGGTCAGGGAGGGCAGTGGGAACTGAAGCTT
CCCTCTCCACCCCAGGCCTGATGGAGAGAAGAAGGCATATGTTCGACTGGCTCCTGATTA
TGATGCTTTGGACGTTGCCAACAAGGTAAGCTTCCTTTCCTATAGATGCCTTAATACCCA
CCCCTGGGTGTAAGTGACGCATCTATTAGTGACCAAAGTCTGAGTTTTGCTGATGAGCCA
TAATTGACTGTGCCCTATCTTTAATAACCCTTACCCTCATTTTCCTTTTAACCATGACAT
TCCAGCTTAATCTGAACATTTCAGCTCCAATAACAAAGCTCCTTTTGTTTTTCAGATTGG
GATCATCTAAACCAAGTCCAGCTGGCTAATTCTAAATATATATATCTTCTCACCTTATCT
GCGCCTCTTGTCTTTGTGTCAGATTCTGTTTGGGTTTGTGGGGGTGGGCATTCTGTGGTA
CACAGGTAGTGAGGTTGTTAAAGGGTCTTGCACAAGACTCTTATTCTACTTACCCTCTTG
TAACACCACATCACTCCACTGTTATTAACTCCTGGTGGCAGGAGCTTAGGTACATGAGAC
ATTTGTGAGTCTAACTAGGGTTAGTTGTCCTAGAAAACTACAAGAACCACTTTATCCCTT
GAAGGAGCTGTGTGTAAAACCAGTGCTGCCCAGAGTTTGCAGGAGAGGAGGGATAAACTC
GAGAGTTTTCATTAGCATCAATTTCAGGGCAGTGTGGGTTGGCTGGCTTTCTGGTAGCAC
CTTGTCCTCATACACCCATCTACTATGTCCAACCGGTCTGTCTGCTTCCCTCACCCCTTG
CCCAAGAAAGGACAAGGACTTCAGAGGAGTGCTTTCATTAGTGTTTTCAATAGGGTGGAT
GCGGGCTTTGAAGGTGGAGAGGCTGGCCCCAGAGGACGCCCAGGCTTGGGGCTAAGTCCC
AGCTTATATTAGGCTGTTTCTGTTCTTGGCTGTGTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved