Microcebus_murinus Locus Mono:246:SNORA55
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:246:SNORA55
Microcebus_murinus
Mono:246:SNORA55
GeneScaffold_3938
SNORA55
1001..1135
2135
GTTCTAGGAGATTCACCAGGGGCTCACAATGAATTATCAAAGAAAAATTCTCTCACACT
TCTAGCAGGGAGAGGGGAAAAGCAACCGTTTTGAAATACATCAGAGCACTCCATTCTTAA
CAAGGCCTGCCCTCAGAAGAAACTATTTTATGAGAGTTTAATCTGCTGGAGTTTTATCAA
AGCCTAACTTAGCTAGGGGAAGGAAAATACTCAACTCTAGCTTTCTGCAGCCTTCTTAAC
TCACTCCAAGGCCAGCATGACACTAATACCAAAATCAGACAAAGACATTACAAGAAAAGG
AAAGTATGGACCATGAACATAGATGCAAATATCCTCAACAAAATATTAACAAATTGAATC
CAACAATGTATAAAAAGAATTATACACAATGACCAAGTGGAATTTATCCCAGGTAGGCAA
GGCTGATTCAACATTCAAAAATCAATTAACATTATCTATCATATAAGCAGGTTAAAGAAA
AAAATTCAGTGACCATATTAATAGATGCAGAAAAAGTATTTGACAAAATCCAACACCCAT
TCATAATAAAAACTCTCAGAAAACCAGGATTAGAGGATAACTTCCTAAAGTTGGTAAAGA
ACATCTACAAAAACCTACAGCCAATATCATACTTAATGGTGAAAAACTGAAGCTTTCCCA
CTTCAGGCACTTATACCATATGAGGAACAAGGCAAGAATGTCCCCTTCACACCACCCTTG
TCAACTTCGTACTCAAAGTCCTAGCTAATGTAGTAAGACAAGAAAAAAATAAATGATATA
CAAATTGGGAAGGAAGAAATAAAACTGTCTTTGCTTGCAGCCAACATGATTATCTGCATA
GAAAATCAGAATGAATTGACCAAAAAAAAAAAAAAAAAATCTCTTGCAACTATGAACCAA
TTATAACAAGGTTGCTGGATATAAGGTTAATATACAAAAGTCAAGCACTTTCCTAAATAC
CAGCAATGAACAAGTGGAATTTGAAATCACAAACACTACCAGTACCTAAATCTTACCCAT
TTCTTGCTGCTTCGTGCTGCTGTGGAGACAGATGGTTCTACGGTATGAGCAGAGGAAATC
CAGAAAGGTTGCTTTTCATTTATCTTGGAGCCTGTCTCTACAGCTCTGCCACATTTTCTC
CTTAAAAAAACTTTTTTAAAAACACATTACCATTTACATTAGTATCCAAAAACATGAGAT
ATTTAGTTATAATCTAACAAAACATGTGCAAGGTCTATAGGAAGAAAACTACATAACTCA
GATTAAAATATCAAATAAGAATTAAATAAGTAGAAAATAGCCCATGTTCATGGATAANNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTATTAAAATCATCATATGTCATTAAGGAAT
TGCTAAATTCTAACAACGAGATGCTGCTATAATGCCTATTAGATTTGTTCTGTATGCAGA
ACACTGATTACACCAAATGCTGATGAGGATATGTAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved