Microcebus_murinus Locus Poly:16:SNORA61
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Poly:16:SNORA61
Microcebus_murinus
Poly:16:SNORA61
GeneScaffold_4271
SNORA16, SNORA44, SNORA61
1001..1135, 1924..2054, 2254..2385
3385
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNAAAAAAAGGGAGGGAGGGAGGAGAAGGTAATCCCGAG
ACTGAGCTGCAGAGAGGCCCGCAGGGTTTGCCGCCTCCCTTTGAGGCAGCGCCGGGGTAC
AGAGAGGGGGAGGGGCCTTCTTCAGGGCACCCGCGCCAGGCTGCGCGGTGACGCGCGGCC
GGGCCGGCGGAGGCCGCGGGAACTACAACTCTCCAGGGTGCAGCGCCGGGCGCGCGGCCG
CCGGAGCGGCCTATATATAGCGTGCTCCCCGCGCCGCTCGTCCTTTCTCCCCGCCGTCGG
GGCTGTGCGTGCACTTCTGTCGGTCAGCCCCAGCCTCCTGCGGTCTGCGCCTCGGCCCGG
CGGCTGTCGTGCGCACTCACTGGGCTGCCTCCAAAGGCTGCGCGATGTCGACCGCGGCTC
GGAGGAGCCGGGCCTTCTGGCCCGGTGGGGCCCAGGTCCCGGAGGCCAGGTCGGCTGCAC
GCGCCGTGACAGGGGCCGGAGCCCGCGGGGGCCGCGCCCATCTCCAGCTCGGCCTGCGCA
GCCGCGCGCTCGGGCCTGACGGGTGAGTAACGCGGATGCACGAGCGAGCGCCTGGGGCCG
CGGGGTCGAAGCCCTGGATCTGAAGTGGCTTAATTTGGGGAAGGCCGCGTGCTGGTGTCA
GGAGGACCTCCGGTTGAGTCCGCCTGTCACGGTTATCAGCTCGGTGGCCTTGGACAAGTG
ACTGCCCTCGAGTTTTCTGGAGGTCATCGTGGTGGCTATAAGGACAAGGTTTTCAGGAGG
ACCCTTTTTTGCATCACAGCTTAGCGGTCGTTGGGGCTTACAGGATGACTTTCAGTCACT
AGAGTGGGTAAATGTATTAAAATAGGCAGGGACGATGCACAGGATTTTGGTGAGCTGAAC
AGCAGTTTGGGTTTGTGGCTGCCCTGTGACCTGAATTTCCCCGTGGCCCTTATCGAAGCT
GCAGCTGCTTCCACATAGCTGCTGTGGTCAAAAAGGAGCCCAGAGTGACAGTTTTCCTTG
ACGGTCGCCGTTCTGTTTGTTGTAACTGATCTGCAACATTTTGGGAAAATACAGTTTCAT
TGTCCTTGCCATTTCTCGGGAATAGCCAGAAACCTTTATTAGAATTGGCTGCTTCCACAC
TAGCAGAAAGCTGGGGTCTTACTCGTACAGTTAACCAGAATAAGCCTTTGGGGAAGTATT
TTGCCTAGGCCAAGAACCAATAGGGAAAGGCAATTGGGAGTGGGTTGGACATGCCTACGG
GGAAATCAGTGCATGTGACGTAGATCAGTCACTTACCTGAAAAGCTTAAGGCATCAGTAT
CAGGACCAAAATGAAGGGAAGAAAGAAAGAGATCATTCAGCCAGGCTCGTTGCTCACGCT
TGTAATCGTAGCACTCTGGGAGGCCAAGGCGGGCGGGTTGCTCGAGGTCAGGAGTTCAAA
ACCAGCCTGAGCAAGAGCAAGACTGCGTCTCTATTAAAAATAGAAATAAATTAATTGGCC
AACTAATATACATAGAAAATATTAACCGGGCATGGTAGCGCATGTCTGTAGTCCCCTCTA
CTCAGGAGGCTGAGGCAGCAGGATTGCTTGAGCCCAGGAGTTTGAGGTTGCTGTGAGCCA
GGCTGATGCCATGGCACTCACTCTAGCCTGGGCAACAAAGCGAGACTCTCTCTCAAAAAA
AAAGAGAGATCATTCAGGATAATTGTTCTCATTTTAGTTGTGTTCAATGAAGATTCCAGG
ATGACTGAAGTTGATTTTCTTCGGGTGTGAGGACTCCAGAGATCATGACAGTGATGAGAC
ACAATCTCAGGACACCTGGGTAGGTTTGTTTTGGAGACCTACTTTGGGAGCTGTGGGGAC
AGTACAGCATGTTCCCAAGGCCTGTGGCTGGTTGTGGCCACGGGGTCTCCAACTGCATGC
GAGAACAACCTGGAGAGACTTTGACAGCTCGGGTCAGCACAATACCTGCAGCTGCCACTC
GCCTTTCCTATAATCCTATACTGTTTCAGGAGCTGGCATTTTCCATCAGTTTCCGTGTAA
ATGGGTGTATTGGGTTAACTTCTTGGTTTAGAGCTTTCACGCTAAGCTTTTGTTCTGCAG
GTTGCCCCCGAGTTTCCCGGCAGCATCTGATACTGAAAAGACCAGCATGTTTCCCAGCTG
TGCTTTAAGGTAATGTTGATGTTGAAGACAGCTTGCCCTCCAGTTCCCTTTCCCATCAGA
TCTGAACACTGGTCTTGGTGGTCGTAAAAGGAGGAAAAGTAATGCTGAAGCTGGCCACGC
AGTGTTGTAGTTTGTTACATAGCATGTGAGCTAGTTTCAAACAAGGTTGAATTCTCTTTG
AACTTGTTTCTTCTCTCCTGTAAAATGGGAGATTACAGGGGAGAGGAAACAGCTGGGGGG
ATATATGTGAAGCTCTGGGAGTTGTGTATTGATTGCTGACCAGTTTTATTGTATTCAGGG
AGGGATCTGTCAGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved