Microcebus_murinus Locus Poly:10:SNORD116
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Poly:10:SNORD116
Microcebus_murinus
Poly:10:SNORD116
scaffold_17232
SNORD116, SNORD116, SNORD116, SNORD116
1001..1075, 4032..4106, 7063..7137, 10093..10167
11142
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNCTCCGTGGTGAACAGGGCCAGCACGTCTTTGTCCCGTGCACGGG
ATGGTTGACGGGGAAGGAGGATCCCGGTAGCGCCCTGGGGTAGTGACCGAACCGTGGTCA
GTTCGTCTGGGCCACTTGGGTGTCTGAGAGTCCTTCGAGGGTTGGAGCGATTCCTAGGTA
GTGCCAGGAATGGCTTGACACGAAGCCTGTGAGGCCTTCGTGACCCGAAGAGCCATCGTG
GGCTTCTGTCTCCCTGACGTGGGGGCCGCTCGTTGAGCTGAGCATCGTGCAACGTCAGAA
ACGCCCGAGAGGGGCGACGAGAAAGCTTAAGAGTGCTTTACGCACGGGAGTCATAGCGAT
CGGAGGATAGGCAGCCTTGTCTTTGGTCGTCGTCCCCCGGCCTCGGGAGACAGCCACTGT
GGCCTGGGCCCCTTACCTTTGCCGATGGGAATTTGGAAAAGGAACACGCGCGGTCCCCGT
ATGCCCACACGTGTGATCTCTTGCCGCAGGACGCAGTGGAGTGAGACCTGGGCTCCTTTC
CGGGGGATGAATTTCTCCTCTCCCCTGTGTGCCGATGTCAGGGAAGCCTACGGGGGAGCA
GTTCCGGCCGCCATCCCCAGAGTCCCGTGGGAATCCCCTCCTACGGTAAGGGTCCTGTCC
CACGGTCACCGCGGTGCCTGGTTGGGGTGGGGATGGGACGGTGACTCCGCGTGGAGGCGG
GGCCCTGACCGTGCTAGCCCGGCACGGGGGCCGGTCATGGCTTGTGACGCCGGTCTCCCT
GGTGGGAGAGGGTGGCTCGGCGAGTCCCAGGGTGACAGAGAGCCGAGTGCTCAGTGTCGG
ACCCGTATCTGGGGCCCCAGGTCCCTTTCGCACGCGTGCCTGGATCGATGATGTCTAAAA
AAAAATGGAAACTTTTGAAATCTGAACAAAATGAGTGAGGACTCGAGCTGAGGTCCAGCA
CGGGGATCGCCACGCTACCAGGGTGGAGGGAGCTCAGTCAGCACAGCTAGGGGTGTGTGG
CAAGGCCTGTGATGTTCGGAGAGCTAAAATGCTCACGCGCTTTGAAGCGAATTGCTTGGG
TGGTGGTGTGTCCAGGCCCAGTTGGTGGCTTGGGGTAGCATGGAAACCCTTTGAGGGCGT
GGCCGGTGGCTTCCTTACCGCCCCCTCCCGAGACCCCGGGGAAGTGAGCGGGAATTGGCG
ATTCCCCCTGGGAAATCAGTGCGCCTTCCCATGAGCCCTTCTCCCACCTGGCCGAGCTGG
CCAGGGGCTCCGATGGGTGGTCGATCTCTGTTTTCTCAGGAGGGCAAATTGAAAGGTATG
GCCCACATGCAGGGACGGGACCCCGCTTTATTTCCTGGTCCCTTTCGCCTACGTGAAAGC
ACTCGCGTGGAGATCGAAGAGCAGACGCCCCCTGTGGAATCTTAGCGATCTTTCTTATCA
AAGACCGGGCTGGCCACCCAGCCAGCCACGGGATACGGCGTGCTCGACCCTTGTGGGTTC
CCTCATCCACCCAGCAAGCCCTTTGGAGCCTACGGCTGAGCCGGCTCCAGCCGCGCGCAG
CGTCCGTCATTTCGGAAAGAAAGCGACGTGGCTCTACGTTTCAAATGCTGAACTTCCCAC
GTGGGTGGCAGTGGCCAGCCTCCCGGGTCCTCGGTGGGTTTCCATGGTCTTTGAGGTGAT
GATGAATGATGACGCAGCGGGTGTGCCAGGGAGACCTTGAGTCAGGGGCCTCGGGACAAG
GCATTTCTATGCCATGCTCGTGGGCGATGTGAGCGTAATGCCTCTGGTGTTCCACGTGGC
CAGACAGACGTGGAACGTGAAATCCTAAGAGCGCTTGCAAGGAGAGGTTCCATTCGGCAA
ATTGTGTTTCCCCTTGTACTCTGCAGATCGTGCTGTACGCGATCGCGGGGGCGTTCGCCG
GCGGAGTGGGGAAGTGCTGGTCTGTCCACGTGCGGTGGCCCGCCTACGCGGGCGGGACCA
CCAGAAGTCACTCCCCAGGTAACGTCCGGTTTTGAGCGGACTGAGGATTGCGGGCCCAGC
TAGTTCCCTGTGAGCAAAAACGCGGGACGTGCTCAGTTTGGAGGGTGGGTTGTTCCCCAC
GGGGAGGTTGTGGGCGTCGGGCCACTGGTCAGGCATCTAACCTTGTCAAGACGCATACAG
ATTTTGTGCGCCGGCCTCCACGTGGAGTGACCCCACGCTCCCTGTCTGAGCGATGGCGGG
AGCGTGATTTGCACGCGATGACGTTGAGCGAGCTCCTCCCTCCTGCGGGTTTGAGAAACA
GACAGCCGCACTCCCCCTCACACACGTCCCCTTGTGTGTCCCCTCTCGCTCCAGGAAGAC
GCGGCCAGGATCTGGATTTCGCGCGGGCGAGTTCACTCTTGTCCCTGGAGACCTGACGAG
AAGGAAGGCCGTGCCGGAGGTCATTCTTCCATCCCGTCCCCTCGGGCCTGCTGCGGGCAT
TCCGGTATCGGTGAGCCGCGTGTTCTGAAGTGTGACTCAGTTTCCTCGGGGCACCATGAG
CGCCTAGTGACAGGGAGAGCCCGGCGATGCCGGCCGGCCGCGAGGCTGGCGCCTGCCTGT
GGTGCCGCTCTCCATGCTGGAGCGCCGTGGGTGGGCTCTCCCCGGGGTGACGGAAAGCTG
AGTTGAGCGGTGTGTGCCCCCTGTCTGGGGCTCAGGGCCCCCTGGCGAAAATGTGCCTGG
TTCGAAGGTGACTTAACAAGGCGCAGTGGATGTCCTTGGAGCGTGAACATACTGGGTGAG
GGCGCCACGTCTTTGGGCTGAGGTCCAGCAACGGGACCATGCCTGGCACACACACCGGAG
GCCGTTGAGTGGGCCCGGTGGCAGTAACGCCAGGGACTAGGCTTGGGGGTACGTTATCTG
AAAGCTACATGGTTGCATCGACCAGGGGGGAGTGACTGGTGCATGCGTGTTCTCTGAATG
TCAACGTGTGGGGTACAGTGGAAGCTCTCTGAGCGTTTGGGTGGCAGGAGTGCCTACGAT
CCCCGTGTCCCTTGCGGTTTGGGCGTCACCGAACGCCACGGCGGGGCCTCCGTGGTGAAC
AGGGCCAGCACGTCTTTGTCCCGTGCACGGGATGGTTGACGGGGAAGGAGGATCCCGGTA
GCGCCCTGGGGTAGTGACCGAACCGTGGTCAGTTCGTCTGGGCCACTTGGGTGTCTGAGA
GTCCTTCGAGGGTTGGAGCGATTCCTAGGTAGTGCCAGGAATGGCTTGACACGAAGCCTG
TGAGGCCTTCGTGACCCGAAGAGCCATCGTGGGCTTCTGTCTCCCTGACGTGGGGGCCGC
TCGTTGAGCTGAGCATCGTGCAACGTCAGAAACGCCCGAGAGGGGCGACGAGAAAGCTTA
AGAGTGCTTTACGCACGGGAGTCATAGCGATCGGAGGATAGGCAGCCTTGTCTTTGGTCG
TCGTCCCCCGGCCTCGGGAGACAGCCACTGTGGCCTGGGCCCCTTACCTTTGCCGATGGG
AATTTGGAAAAGGAACACGCGCGGTCCCCGTATGCCCACACGTGTGATCTCTTGCCGCAG
GACGCAGTGGAGTGAGACCTGGGCTCCTTTCCGGGGGATGAATTTCTCCTCTCCCCTGTG
TGCCGATGTCAGGGAAGCCTACGGGGGAGCAGTTCCGGCCGCCATCCCCAGAGTCCCGTG
GGAATCCCCTCCTACGGTAAGGGTCCTGTCCCACGGTCACCGCGGTGCCTGGTTGGGGTG
GGGATGGGACGGTGACTCCGCGTGGAGGCGGGGCCCTGACCGTGCTAGCCCGGCACGGGG
GCCGGTCATGGCTTGTGACGCCGGTCTCCCTGGTGGGAGAGGGTGGCTCGGCGAGTCCCA
GGGTGACAGAGAGCCGAGTGCTCAGTGTCGGACCCGTATCTGGGGCCCCAGGTCCCTTTC
GCACGCGTGCCTGGATCGATGATGTCTAAAAAAAAATGGAAACTTTTGAAATCTGAACAA
AATGAGTGAGGACTCGAGCTGAGGTCCAGCACGGGGATCGCCACGCTACCAGGGTGGAGG
GAGCTCAGTCAGCACAGCTAGGGGTGTGTGGCAAGGCCTGTGATGTTCGGAGAGCTAAAA
TGCTCACGCGCTTTGAAGCGAATTGCTTGGGTGGTGGTGTGTCCAGGCCCAGTTGGTGGC
TTGGGGTAGCATGGAAACCCTTTGAGGGCGTGGCCGGTGGCTTCCTTACCGCCCCCTCCC
CAGACCCCGGGGAAGTGAGCGGGAATTGGCGATTCCCCCTGGGAAATCAGTGCGCCTTCC
CATGAGCCCTTCTCCCACCTGGCCGAGCTGGCCAGGGGCTCCGATGGGTGGTCGATCTCT
GTTTTCTCAGGAGGGCAAATTGAAAGGTATGGCCCACATGCAGGGACGGGACCCCGCTTT
ATTTCCTGGTCCCTTTCGCCTACGTGAAAGCACTCGCGTGGAGATCGAAGAGCAGACGCC
CCCTGTGGAATCTTAGCGATCTTTCTTATCAAAGACCGGGCTGGCCACCCAGCCAGCCAC
GGGATACGGCGTGCTCGACCCTTGTGGGTTCCCTCATCCACCCAGCAAGCCCTTTGGAGC
CTACGGCTGAGCCGGCTCCAGCCGCGCGCAGCGTCCGTCATTTCGGAAAGAAAGCGACGT
GGCTCTACGTTTCAAATGCTGAACTTCCCACGTGGGTGGCAGTGGCCAGCCTCCCGGGTC
CTCGGTGGGTTTCCATGGTCTTTGAGGTGATGATGAATGATGACGCAGCGGGTGTGCCAG
GGAGACCTTGAGTCAGGGGCCTCGGGACAAGGCATTTCTATGCCATGCTCGTGGGCGATG
TGAGCGTAATGCCTCTGGTGTTCCACGTGGCCAGACAGACGTGGAACGTGAAATCCTAAG
AGCGCTTGCAAGGAGAGGTTCCATTCGGCAAATTGTGTTTCCCCTTGTACTCTGCAGATC
GTGCTGTACGCGATCGCGGGGGCGTTCGCCGGCGGAGTGGGGAAGTGCTGGTCTGTCCAC
GTGCGGTGGCCCGCCTACGCGGGCGGGACCACCAGAAGTCACTCCCCAGGTAACGTCCGG
TTTTGAGCGGACTGAGGTTTGCGGGCCCAGCTAGTTCCCTGTGAGCAAAAACGCGGGACG
TGCTCAGTTTGGAGGGTGGGTTGTTCCCCACGGGGAGGTTGTGGGCGTCGGGCCACTGGT
CAGGCATCTAACCTTGTCAAGACGCATACAGATTTTGTGCGCCGGCCTCCACGTGGAGTG
ACCCCACGCTCCCTGTCTGAGCGATGGCGGGAGCGTGATTTGCACGCGATGACGTTGAGC
GAGCTCCTCCCTCCTGCGGGTTTGAGAAACAGACAGCCGCACTCCCCCTCACACACGTCC
CCTTGTGTGTCCCCTCTCGCTCCAGGAAGACGCGGCCAGGATCTGGATTTCGCGCGGGCG
AGTTCACTCTTGTCCCTGGAGACCTGACGAGAAGGAAGGCCGTGCCGGAGGTCATTCTTC
CATCCCGTCCCCTCGGGCCTGGTGCGGGCATTCCGGTATCGGTGAGCCGCGTGTTCTGAA
GTGTGACTCAGTTTCCTCGGGGCACCATGAGCGCCTAGTGACAGGGAGAGCCCGGCGATG
CCGGCCGGCCGCGAGGCTGGCGCCTGCCTGTGGTGCCGCTCTCCATGCTGGAGCGCCGTG
GGTGGGCTCTCCCCGGGGTGACGGAAAGCTGAGTTGAGCGGTGTGTGCCCCCTGTCTGGG
GCTCAGGGCCCCCTGGCGAAAATGTGCCTGGTTCGAAGGTGACTTAACAAGGCGCAGTGG
ATGTCCTTGGAGCGTGAACATACTGGGTGAGGGCGCCACGTCTTTGGGCTGAGGTCCAGC
AACGGGACCATGCCTGGCACACACACCGGAGGCCGTTGAGTGGGCCCGGTGGCAGTAACG
CCAGGGACTAGGCTTGGGGGTACGTTATCTGAAAGCTACATGGTTGCATCGACCAGGGGG
GAGTGACTGGTGCATGCGTGTTCTCTGAATGTCAACGTGTGGGGTACAGTGGAAGCTCTC
TGAGCGTTTGGGTGGCAGGAGTGCCTACGATCCCCGTGTCCCTTGCGGTTTGGGCGTCAC
CGAACGCCACGGCGGGGCCTCCGTGGTGAACAGGGCCAGCACGTCTTTGTCCCGTGCACG
GGATGGTTGACGGGGAAGGAGGATCCCGGTAGCGCCCTGGGGTAGTGACCGAACCGTGGT
CAGTTCGTCTGGGCCACTTGGGTGTCTGAGAGTCCTTCGAGGGTTGGAGCGATTCCTAGG
TAGTGCCAGGAATGGCTTGACACGAAGCCTGTGAGGCCTTCGTGACCCGAAGAGCCATCG
TGGGCTTCTGTCTCCCTGACGTGGGGGCCGCTCGTTGAGCTGAGCATCGTGCAACGTCAG
AAACGCCCGAGAGGGGCGACGAGAAAGCTTAAGAGTGCTTTACGCACGGGAGTCATAGCG
ATCGGAGGATAGGCAGCCTTGTCTTTGGTCGTCGTCCCCCGGCCTCGGGAGACAGCCACT
GTGGCCTGGGCCCCTTACCTTTGCCGATGGGAATTTGGAAAAGGAACACGCGCGGTCCCC
GTATGCCCACACGTGTGATCTCTTGCCGCAGGACGCAGTGGAGTGAGACCTGGGCTCCTT
TCCGGGGGATGAATTTCTCCTCTCCCCTGTGTGCCGATGTCAGGGAAGCCTACGGGGGAG
CAGTTCCGGCCGCCATCCCCAGAGTCCCGTGGGAATCCCCTCCTACGGTAAGGGTCCTGT
CCCACGGTCACCGCGGTGCCTGGTTGGGGTGGGGATGGGACGGTGACTCCGCGTGGAGGC
GGGGCCCTGACCGTGCTAGCCCGGCACGGGGGCCGGTCATGGCTTGTGACGCCGGTCTCC
CTGGTGGGAGAGGGTGGCTCGGCGAGTCCCAGGGTGACAGAGAGCCGAGTGCTCAGTGTC
GGACCCGTATCTGGGGCCCCAGGTCCCTTTCGCACGCGTGCCTGGATCGATGATGTCTAA
AAAAAAATGGAAACTTTTGAAATCTGAACAAAATGAGTGAGGACTCGAGCTGAGGTCCAG
CACGGGGATCGCCACGCTACCAGGGTGGAGGGAGCTCAGTCAGCACAGCTAGGGGTGTGT
GGCAAGGCCTGTGATGTTCGGAGAGCTAAAATGCTCACGCGCTTTGAAGCGAATTGCTTG
GGTGGTGGTGTGTCCAGGCCCAGTTGGTGGCTTGGGGTAGCATGGAAACCCTTTGAGGGC
GTGGCCGGTGGCTTCCTTACCGCCCCCTCCCCAGACCCCGGGGAAGTGAGCGGGAATTGG
CGATTCCCCCTGGGAAATCAGTGCGCCTTCCCATGAGCCCTTCTCCCACCTGGCCGAGCT
GGCCAGGGGCTCCGATGGGTGGTCGATCTCTGTTTTCTCAGGAGGGCAAATTGAAAGGTA
TGGCCCACATGCAGGGACGGGACCCCGCTTTATTTCCTGGTCCCTTTCGCCTACGTGAAA
GCACTCGCGTGGAGATCGAAGAGCAGACGCCCCCTGTGGAATCTTAGCGATCTTTCTTAT
CAAAGACCGGGCTGGCCACCCAGCCAGCCACGGGATACGGCGTGCTCGACCCTTGTGGGT
TCCCTCATCCACCCAGCAAGCCCTTTGGAGCCTACGGCTGAGCCGGCTCCAGCCGCGCGC
AGCGTCCGTCATTTCGGAAAGAAAGCGACGTGGCTCTACGTTTCAAATGCTGAACTTCCC
ACGTGGGTGGCAGTGGCCAGCCTCCCGGGTCCTCGGTGGGTTTCCATGGTCTTTGAGGTG
ATGATGAATGATGACGCAGCGGGTGTGCCAGGGAGACCTTGAGTCAGGGGCCTCGGGACA
AGGCATTTCTATGCCATGCTCGTGGGCGATGTGAGCGTAATGCCTCTGGTGTTCCACGTG
GCCAGACAGACGTGGAACGTGAAATCCTAAGAGCGCTTGCAAGGAGAGGTTCCATTCGGC
AAATTGTGTTTCCCCTTGTACTCTGCAGATCGTGCTGTACGCGATCGCGGGGGCGTTCGC
CGGCGGAGTGGGGAAGTGCTGGTCTGTCCACGTGCGGTGGCCCGCCTACGCGGGCGGGAC
CACCAGAAGTCACTCCCCAGGTAACGTCCGGTTTTGAGCGGACTGAGGATTGCGGGCCCA
GCTAGTTCCCTGTGAGCAAAAACGCGGGACGTGCTCAGTTTGGAGGGTGGGTTGTTCCCC
ACGGGGAGGTTGTGGGCGTCGGGCCACTGGTCAGGCATCTAACCTTGTCAAGACGCATAC
AGATTTTGTGCGCCGGCCTCCACGTGGAGTGACCCCACGCTCCCTGTCTGAGCGATGGCG
GGAGCGTGATTTGCACGCGATGACGTTGAGCGAGCTCCTCCCTCCTGCGGGTTTGAGAAA
CAGACAGCCGCACTCCCCCTCACACACGTCCCCTTGTGTGTCCCCTCTCGCTCCAGGAAG
ACGCGGCCAGGATCTGGATTTCGCGCGGGCGAGTTCACTCTTGTCCCTGGAGACCTGACG
AGAAGGAAGGCCGTGCCGGAGGTCATTCTTCCATCCCGTCCCCTCGGGCCTGCTGCGGGC
ATTCCGGTATCGGTGAGCCGCGTGTTCTGAAGTGTGACTCAGTTTCCTCGGGGCACCATG
AGCGCCTAGTGACAGGGAGAGCCCGGCGATGCCGGCCGGCCGCGAGGCTGGCGCCTGCCT
GTGGTGCCGCTCTCCATGCTGGAGCGCCGTGGGTGGGCTCTCCCCGGGGTGACGGAAAGC
TGAGTTGAGCGGTGTGTGCCCCCTGTCTGGGGCTCAGGGCCCCCTGGCGAAAATGTGCCT
GGTTCGAAGGTGACTTAACAAGGCGCAGTGGATGTCCTTGGAGCGTGAACATACTGGGTG
AGGGCGCCACGTCTTTGGGCTGAGGTCCAGCAACGGGACCATGCCTGGCACACACACCGG
AGGCCGTTGAGTGGGCCCGGTGGCAGTAACGCCAGGGACTAGGCTTGGGGGTACGTTATC
TGAAAGCTACATGGTTGCATCGACCAGGGGGGAGTGACTGGTGCATGCGTGTTCTCTGAA
TGTCAACGTGTGGGGTACAGTGGAAGCTCTCTGAGCGTTTGGGTGGCAGGAGTGCCTACG
ATCCCCGTGTCCCTTGCGGTTTGGGCGTCACCGAACGCCACGGCGGGGCCTCCGTGGTGA
ACAGGGCCAGCACGTCTTTGTCCCGTGCACGGGATGGTTGACGGGGAAGGAGGATCCCGG
TAGCGCCCTGGGGTAGTGACCGAACCGTGGTCAGTTCGTCTGGGCCACTTGGGTGTCTGA
GAGTCCTTCGAGGGTTGGAGCGATTCCTAGGTAGTGCCAGGAATGGCTTGACACGAAGCC
TGTGAGGCCTTCGTGACCCGAAGAGCCATCGTGGGCTTCTGTCTCCCTGACGTGGGGGCC
GCTCGTTGAGCTGAGCATCGTGCAACGTCAGAAACGCCCGAGAGGGGCGACGAGAAAGCT
TAAGAGTGCTTTACGCACGGGAGTCATAGCGATCGGAGGATAGGCAGCCTTGTCTTTGGT
CGTCGTCCCCCGGCCTCGGGAGACAGCCACTGTGGCCTGGGCCCCTTACCTTTGCCGATG
GGAATTTGGAAAAGGAACACGCGCGGTCCCCGTATGCCCACACGTGTGATCTCTTGCCGC
AGGACGCAGTGGAGTGAGACCTGGGCTCCTTCCGGGGGATGAATTTCTCCTCTCCCCTGT
GTGCCGATGTCAGGGAAGCCTACGGGGGAGCAGTTCCGGCCGCCATCCCCAGAGTCCCGT
GGGAATCCCCTCCTACGGTAAGGGTCCTGTCCCACGGTCACCGCGGTGCCTGGTTGGGGT
GGGGATGGGACGGTGACTCCGCGTGGAGGCGGGGCCCTGACCGTGCTAGCCCGGCACGGG
GGCCGGTCATGGCTTGTGACGCCGGTCTCCCTGGTGGGAGAGGGTGGCTCGGCGAGTCCC
AGGGTGACAGAGAGCCGAGTGCTCAGTGTCGGACCCGTATCTGGGGCCCCAGGTCCCTTT
CGCACGCGTGCCTGGATCGATGATGTCTAAAAAAAAATGGAAACTTTTGAAATCTGAACA
AAATGAGTGAGGACTCGAGCTGAGGTCCAGCACGGGGATCGCCACGCTACCAGGGTGGAG
GGAGCTCAGTCAGCACAGCTAGGGGTGTGTGGCAAGGCCTGTGATGTTCGGAGAGCTAAA
ATGCTCACGCGCTTTGAAGCGAATTGCTTGGGTGGTGGTGTGTCCAGGCCCAGTTGGTGG
CTTGGGGTAGCATGGAAACCCTTTGAGGGCGTGGCCGGTGGCTTCCTTACCGCCCCCTCC
CGAGACCCCGGGGAAGTGAGCGGGAATTGGCGATTCCCCCTGGGAAATCAGTGCGCCTTC
CCATGAGCCCTTCTCCCACCTGGCCGAGCTGGCCAGGGGCTCCGATGGGTGGTCGATCTC
TGTTTTCTCAGGAGGGCAAATTGAAAGGTATGGCCCACATGCAGGGACGGGACCCCGCTT
TATTTCCTGGTCCCTTTCGCCTACGTGAAAGCACTCGCGTGGAGATCGAAGAGCAGACGC
CCCCTGTGGAATCTTAGCGATCTTTCTTATCAAAGACCGGGCTGGCCACTCAGCCAGCCA
CGGGATACGGCGTGCTCGACCCTTGTGGGTTCCCTCATCCACCCAGCAAGCCCTTTGGAG
CCTACGGCTGAGCCTACGTGTGATCTCTTGCCGCAGGACGCAGTGGAGTGAGACCTGGGC
TCCTTTCCGGGGGATGAATTTCTCCTCTCCCCTGTGTGCCGATGTCAGGGAAGCCTACGG
GGGAGCAGTTCCGGCCGCCATCCCCAGAGTCCCGTGGGAATCCCCTCCTACGGTAAGGGT
CCTGTCCCACGGTCACCGCGGTGCCTGGTTGGGGTGGGGATGGGACGGTGACTCCGCGTG
GAGGCGGGGCCCTGACCGTGCTAGCCCGGCACGGGGGCCGGTCATGGCTTGTGACGCCGG
TCTCCCTGGTGGGAGAGGGTGGCTCGGCGAGTCCCAGGGTGACAGAGAGCCGAGTGCTCA
GTGTCGGACCCGTATCTGGGGCCCCAGGTCCCTTTCGCACGCG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved