Microcebus_murinus Locus Poly:19:SNORA71
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Poly:19:SNORA71
Microcebus_murinus
Poly:19:SNORA71
GeneScaffold_4578
SNORA71, SNORA71
1001..1133, 3017..3150
4150
GCGACGCTGTGCCCGGGGCCCTGAACCCGGGCCGAGGGGCGCCAGAGCCCCGGTGACTT
TCACGCCCCTGCCCCTGACCTCGACTCCTGGCATCGGAACCCCTCCCCCAAACCGCTTGT
CTGTGGGCGGTTGCCTACAAAGTGTCAGTCATTATGCCAAGTCCTTATGATTGTTAACGC
GTTTATCCTCAGTAACCTTTAAAAGTGCTAAAACCTCGTTCTACAGACCATTTGGCTGAA
ATTTAAATCCCTGGGTCCCAGAGGGCAGAGTGTGGACCCCTGTCCCCGGCCTTGTACTAC
AGCCCCTTCCCCGTGCTTTTTCTCTGCCTAGGCCTTTTGAGCTCTGCGGCCCTCCTGGAG
ACAGATGAAAACGCTCCCCTGGTCGGCTTTGCTGGTTCTGCAGCAGCCAGCGCCCCCTCA
TCTCCTGCAGCACCCTGATCGGCACGCCCTGCTGGGCGCCGGCTGTCCTGCGTGGGAGGA
TGTCCCCGGGTATGTGCTGCTGCTCATGAGCACCTTAAAGGAAGACGGGGGTGCCTTCCG
GGTTGCCTCCTGCTGGCCCCAGCAGACAGGGTGGTCATGGAGCTCAGCCCGCCTCTGAGG
CCTGTCTGGAAGGCCCTGGTGCAGGAGGAAGCGCCGTGTAGCAGATGCGGGGCTGGGTTT
GCAGGTCACATCCTGGCTAAGTTACTTCATTCCCCTGAGCTTGACTTCCTGTAAAGTAGG
GAAGCTGCAAAATGTTAGGGCAGAGACCTTGACTGTTCTTGTTTTTGAACCCACATTGCC
TGGCTACATGTAGATACTGAGAATTTGTGGGGTGAATGAACAATTTAGACGTTTTTACCA
GAAGTTGGTCTTGCTGTGCACTCTGTTGATGGGGGCAGATGGTATTGTTATGCTGTATTA
AAAAGTGACAGCTTTCAGGGTCTTTTGGGTTTGGTGCTTGGAGAGTCTGCTGGCTGCTAA
TTTTGGCCTCTGTTCCTGGCTCACTTTCTGCCATTTTTTGCCCATGCATTCGTAAGTGAT
CATGGTCTGCCCATGTCCTGGTCACTGGTAGTGCAGGCAGAAGAAATGTGGGAAGGGTTG
CCCTGTGTTGGAGGGTCAACAGCCTCACCTTCCTGTTCCGGGACTTTCCCCTACTCCTGC
TTTTCAATTCTGCACACATCTCAGGGCCTCCAGGGTTTAGGGGGCTGCCATGTGTGTTGT
TGTTATCACTGGGGCTTTTACTTCCTGCTCCCTGCTGTTGGGACCAGGCTATGTGTATTG
CTTAAGTTCCCCCTGACGACCAGCAGAGTCGCTGCCAGTCAGCCATGGCACACTCCTGTA
AACTTGGCTCTGGCATCCTTTTCAGCCTGCTCTTGATTAGGTAAATGTTGGCCACCCTGC
CACAGACCATCCACTGCCTACTCTTTAGAGTTAACTCCTTTATTTTTCATGAGGAAGTAG
TATGTTTGCTCAGGAAATAATAACAGCCAACATTTGTGGAATGCTTACTGTCTGATAACT
ACCATGCCCCACCATGAGCAGGGACAGCCGGCTACTCATTCATGGCTTCTTGTCTATTGC
AGATGAGCCCACTGTGTGCAGAGGCATCATGGGAGTTGTCATGTTAGGAACATTCTAGAC
CTCAGTGTCCTTGAGGTAAGGTCTCTGGTCCATTTCTGGAGTGTTAGTTCCTTGCATCTA
GTACAGCCCTGTACATGTTCCCAGGGGCTTTGGGTGATGACACAGGGGAGCTGAGAGGTG
AGATGAAGGTGGCACCATGGGTCCCCAGATCCACTGCCCACCCCAGCCGACCTAGATCAC
CTCTGGCCCTTCTCATTTCTTCAGTGTTCAGTGGCTGCTGTAGGGGAGAAACCTCCAGAG
TCCCACTTGGGTAATGAGAGGTGCCTGGGTATTTGCCAACTCTCCCTGGATGTTAGCCAG
GAGCATGTTATAATGGAAAATGGATAGATCTAGCAACAGAGACTCTGGTCCCTGGCTTTG
AATCCCCCTCTGACACTCTCTTAGTCAGTGACCAATCTAGAACTTAATTTTCTTCATTTG
AAAAATAAAGTTGGGCTGGGCACAGTGGCTCATGCCTATAATCCTAGCACTCTGGGAGGC
TGAAGTGGAAGGATCACTTGAGCTCAGGACTTTGAGACCAGCCTAAGCAAGAGTGAGACC
CAGTCTCTACTAAAAATAGAAAAAAATTTAGCCAGGCAACTAAAAATAGAAAAAATTGGC
CAGATGTGGTGGTGTGTGCCTGTAGTCCCAACTATTCAAGAGGCTGAGGCATGAGGATCA
CTTGAGCCCAGGAGTTTGAGGTTGCAGTGAGCTAGGCTGATGCCATGGCACTCAGAGCAA
TAAAGTGAGACTCTGTCTCAGAAAAAGAAAAAGAAAAAGTTGTTTTCACTTGCTAATGTG
GATTTAAAAGAAAAAGAAAAAGCCAGGCGCAATGGCTCATACCTGTAATCTTAGCACTCT
GGGAGGCTGAAGAGGGTGGATTGCTCAAGGTCAAGAGTTCAAAACCAGCCTGAGCAAGAG
TGAGACCCTGTCTCTACTATAAATAGAAAGAAATTAATTGGCCAACTAAACACGTATATA
TATAAAAAATTAGCCAGGCATGGTGGCGCATGCCTGTAGTCCCAGCTACTCGGGAGGCTG
AGGCAAAAGGATCTCTTGAGCCCAGGAGTTTGAGGTTGCTGTGAGCTAAGCTGACGCCAT
GGCACTCTAGCCTGGGCAACAAAAGTGAGACTCTGTCTCAAAAAAAAAAAAAAAAGAAAG
TCATGATAGAGGTGACTTTTGTGGTACTTTAGACCACATGATTCCTATCTTTGCCAAACC
TAATATTTTTTCAGTGTTCTTGTACAATGTGACTTCTCTCTGATTCCTTGTGGCAGGGAG
GTTTTATGGGGCTTTTTCAGGAAACAAGGGCTACTGTTGGGATCCTGTGCTTGCCTGGGT
TGTTTTCCTGGACTCAACCTATTCCACAGGTCACTGGCATCTGCTTTTCTTCCTGTTCTC
TCTCTGCCCTTGTGTGCACCTGCATTCAAAAGTGATCACGGGCTGCCTGTGCCCTGGTCA
TCAGTAATGCAGGGAGAGGAATTGCTGAAAGCCGTTTCCCGTGTTTGGAGGGTTCACACC
TATCCCTTTCAAATGCTGGCGCTTTCACACACTCCTTCCCTCCTGTGAACACCTGGTCTC
ATGGGCATTGCAGGCTATGTGTGAGAGTCAGTGGTGGGAGATGCTTCACCTTGGCCTTTC
TCCAGGCTATGTCAGTGTCAAGGTTTAGGTACATTTTCGGTGGTGGAAAGAGCCAAGATT
AATATTTTTTCTTTTTTAAGAGAAAGGATCTCACTCTGTCTTTTAGGCTAGAGTGCAATG
GTGTTATCATAGCTCACTGCAGCCTCAAACTCCTGGGCTCAAGTGATCCTCCTGCCTCAG
TCTTCCAAGTAGCTGGGACTACAGGTGCACACCACCACACCTGGCTAAGTTTTCTACTTT
TTTTTTTTTTTTTTGAGACAGAGTCTCGCTTTGTTGCCCAAGCTAGAGTAGTGAGTGCCG
TGGCGTCAGCCTAGCTCACAGCAACCCTCAAACTCCTGGGCTCGAGCGATCCTCCTGCCT
CAGCCTCCCGACTAGCGGGGACTACAGGCATGTGCCACCATGCCCAGCTAATTTTTTCTA
TATATATATTAGTTGGCCAATTAATTTCTTTCTATTTATGGTAGAGACGGGGTCTTGCTC
TTGCTCAGGCTGGTTTTGAACTCCTGACCTCGAGCAATCCACCCACCTCGGCCTCCCAGA
GTGCTAGGATTACAGGTGTGAGCCACCGCGCCCGGCCAGTTTTCTATTTTTTATAGAGAG
AGGATCTTGTCCTTGCTCAGGCTGGTCTCGAACTCCTGGCCTCCACGTGATCCTCCTGCT
TTGGCCTCCCAAAGTGCTACGATTACAGGTGTGAGCCAAGATGAATTATTATTATTATTC
ACAAGTAAGTGTGATGTTGGATGGTATATAGTCATTGCCATAAGATTTGCAAAGAGAAGT
GGCGTATTGGAGGTGGTGGCTCTGGGCAGGCCTTTAAAGGAGTGGGATGTGATGGGCAAT
GGGAAGCTATTCTGGGGAGAGGTAGCAATGTGAAAAGACCTTTGAGACTGAAATGAGCAA
ACGCTCCCAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved